ClinVar Miner

List of variants in gene SMAD4 reported as pathogenic by GeneDx

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 18
Download table as spreadsheet
NM_005359.5(SMAD4):c.1082G>A (p.Arg361His) rs377767347
NM_005359.5(SMAD4):c.1134_1135delAG (p.Arg378Serfs) rs1555686503
NM_005359.5(SMAD4):c.1140-1G>A rs1555686594
NM_005359.5(SMAD4):c.1231_1232delAG (p.Ser411Leufs) rs730881952
NM_005359.5(SMAD4):c.1239C>A (p.Tyr413Ter) rs730881954
NM_005359.5(SMAD4):c.1245_1248delCAGA (p.Asp415Glufs) rs80338965
NM_005359.5(SMAD4):c.1259_1260insCG (p.Ala421Valfs) rs730881956
NM_005359.5(SMAD4):c.1333C>T (p.Arg445Ter) rs377767360
NM_005359.5(SMAD4):c.1338_1339delGA (p.Gln446Hisfs) rs730881957
NM_005359.5(SMAD4):c.1351_1375del25 (p.Ala451Leufs) rs587780124
NM_005359.5(SMAD4):c.1486C>T (p.Arg496Cys) rs397518413
NM_005359.5(SMAD4):c.1498A>G (p.Ile500Val) rs281875322
NM_005359.5(SMAD4):c.1499T>C (p.Ile500Thr) rs281875321
NM_005359.5(SMAD4):c.153dupA (p.Asp52Argfs) rs786203560
NM_005359.5(SMAD4):c.1547dupA (p.Ser517Glufs) rs587783060
NM_005359.5(SMAD4):c.669_691delTCAGCCTGCCAGTATACTGGGGG (p.Ser223Argfs) rs1064793271
NM_005359.5(SMAD4):c.728_735delGGCCTCAG (p.Gly243Alafs) rs1060500742
NM_005359.5(SMAD4):c.903C>G (p.Tyr301Ter) rs746084369

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.