ClinVar Miner

List of variants in gene SMAD4 reported by Invitae

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 349
Download table as spreadsheet
NM_005359.5(SMAD4):c.-9C>G rs864622289
NM_005359.5(SMAD4):c.1002G>T (p.Gln334His) rs773598775
NM_005359.5(SMAD4):c.1005A>G (p.Val335=) rs878854762
NM_005359.5(SMAD4):c.1006G>C (p.Gly336Arg) rs878854763
NM_005359.5(SMAD4):c.1007G>A (p.Gly336Glu) rs1060500732
NM_005359.5(SMAD4):c.102A>G (p.Thr34=) rs146104321
NM_005359.5(SMAD4):c.1035C>T (p.Cys345=) rs1555686471
NM_005359.5(SMAD4):c.1037delC (p.Pro346Leufs) rs377767343
NM_005359.5(SMAD4):c.1039A>G (p.Ile347Val) rs747360831
NM_005359.5(SMAD4):c.1046C>T (p.Thr349Ile) rs564408927
NM_005359.5(SMAD4):c.1052A>T (p.Asp351Val) rs1060500741
NM_005359.5(SMAD4):c.1059C>T (p.Tyr353=) rs863224400
NM_005359.5(SMAD4):c.1075G>C (p.Gly359Arg) rs1555686486
NM_005359.5(SMAD4):c.1081C>G (p.Arg361Gly) rs80338963
NM_005359.5(SMAD4):c.1081C>T (p.Arg361Cys) rs80338963
NM_005359.5(SMAD4):c.1082G>A (p.Arg361His) rs377767347
NM_005359.5(SMAD4):c.1086T>C (p.Phe362=) rs1801250
NM_005359.5(SMAD4):c.1096C>T (p.Gln366Ter) rs1060500733
NM_005359.5(SMAD4):c.1098A>G (p.Gln366=) rs990054989
NM_005359.5(SMAD4):c.1106A>G (p.Asn369Ser) rs139569694
NM_005359.5(SMAD4):c.1124C>T (p.Ala375Val) rs1555686499
NM_005359.5(SMAD4):c.1125C>T (p.Ala375=) rs1060504023
NM_005359.5(SMAD4):c.1126A>G (p.Ile376Val) rs1555686501
NM_005359.5(SMAD4):c.1134_1135delAG (p.Arg378Serfs) rs1555686503
NM_005359.5(SMAD4):c.1138A>T (p.Arg380Trp) rs1568208291
NM_005359.5(SMAD4):c.1138delA (p.Arg380Glyfs) rs1555686506
NM_005359.5(SMAD4):c.1139+10G>A rs1324590608
NM_005359.5(SMAD4):c.1139+10G>C rs1324590608
NM_005359.5(SMAD4):c.1139G>A (p.Arg380Lys) rs377767353
NM_005359.5(SMAD4):c.1140-10T>A rs186332162
NM_005359.5(SMAD4):c.1140-10T>C rs186332162
NM_005359.5(SMAD4):c.1140-2A>C rs1568208715
NM_005359.5(SMAD4):c.1140-3A>C rs956212866
NM_005359.5(SMAD4):c.1140G>A (p.Arg380=) rs1060504025
NM_005359.5(SMAD4):c.1142T>A (p.Leu381Ter) rs863224507
NM_005359.5(SMAD4):c.1155A>G (p.Lys385=) rs752938351
NM_005359.5(SMAD4):c.1166_1167delTG (p.Leu389Terfs) rs1555686600
NM_005359.5(SMAD4):c.118A>G (p.Ile40Val) rs878854764
NM_005359.5(SMAD4):c.1198delA (p.Arg400Glyfs) rs1060500734
NM_005359.5(SMAD4):c.1200G>T (p.Arg400Ser) rs876658516
NM_005359.5(SMAD4):c.1206T>A (p.Leu402=) rs758696549
NM_005359.5(SMAD4):c.1206dupT (p.Ser403Terfs) rs878854765
NM_005359.5(SMAD4):c.1215C>T (p.His405=) rs751732234
NM_005359.5(SMAD4):c.1218G>A (p.Ala406=) rs145097078
NM_005359.5(SMAD4):c.1219G>C (p.Val407Leu) rs147621330
NM_005359.5(SMAD4):c.1226T>C (p.Val409Ala) rs1555686607
NM_005359.5(SMAD4):c.1228_1229delCA (p.Gln410Glufs) rs1555686608
NM_005359.5(SMAD4):c.1242delA (p.Asp415Thrfs) rs377767358
NM_005359.5(SMAD4):c.1245_1248delCAGA (p.Asp415Glufs) rs80338965
NM_005359.5(SMAD4):c.1248A>G (p.Arg416=) rs786202472
NM_005359.5(SMAD4):c.1254T>G (p.Ala418=) rs1186154913
NM_005359.5(SMAD4):c.1257G>C (p.Gly419=) rs1303474905
NM_005359.5(SMAD4):c.1259G>A (p.Arg420His) rs1064793725
NM_005359.5(SMAD4):c.126T>C (p.Ser42=) rs1057523114
NM_005359.5(SMAD4):c.1276G>A (p.Val426Ile) rs1555686617
NM_005359.5(SMAD4):c.127T>G (p.Leu43Val) rs863224731
NM_005359.5(SMAD4):c.1287C>G (p.Ile429Met) rs1555686621
NM_005359.5(SMAD4):c.1287C>T (p.Ile429=) rs1555686621
NM_005359.5(SMAD4):c.1295G>A (p.Ser432Asn) rs770301659
NM_005359.5(SMAD4):c.1299A>G (p.Ala433=) rs370558697
NM_005359.5(SMAD4):c.1308+10A>G rs1060504024
NM_005359.5(SMAD4):c.1308+1G>A rs587781618
NM_005359.5(SMAD4):c.1309-1G>A rs1555687377
NM_005359.5(SMAD4):c.1311C>G (p.Val437=) rs751539807
NM_005359.5(SMAD4):c.1324C>T (p.Gln442Ter) rs1555687378
NM_005359.5(SMAD4):c.132A>G (p.Val44=) rs965942065
NM_005359.5(SMAD4):c.1333C>T (p.Arg445Ter) rs377767360
NM_005359.5(SMAD4):c.1343_1367delAGCAGCAGGCGGCTACTGCACAAGC (p.Gln448Leufs) rs1568211187
NM_005359.5(SMAD4):c.1353_1354insGCTACTGCACAAGCTGCAGCAGCTGCCC (p.Gln461Argfs) rs786204125
NM_005359.5(SMAD4):c.1371A>G (p.Ala457=) rs750933193
NM_005359.5(SMAD4):c.1392C>T (p.Ala464=) rs140487104
NM_005359.5(SMAD4):c.1393G>A (p.Val465Met) rs786201798
NM_005359.5(SMAD4):c.1393G>T (p.Val465Leu) rs786201798
NM_005359.5(SMAD4):c.1405A>G (p.Ile469Val) rs876658851
NM_005359.5(SMAD4):c.1407_1410dup (p.Gly471Profs) rs1555687386
NM_005359.5(SMAD4):c.1409delC (p.Pro470Leufs) rs1555687387
NM_005359.5(SMAD4):c.1422A>C (p.Ser474=) rs786201261
NM_005359.5(SMAD4):c.1423G>C (p.Val475Leu) rs864622428
NM_005359.5(SMAD4):c.1444A>G (p.Ile482Val) rs864622736
NM_005359.5(SMAD4):c.1447+2T>C rs1060500740
NM_005359.5(SMAD4):c.1447+3A>T rs754526507
NM_005359.5(SMAD4):c.1447+9G>A rs878854766
NM_005359.5(SMAD4):c.1448-10T>C rs1284568919
NM_005359.5(SMAD4):c.1448G>A (p.Ser483Asn) rs786204060
NM_005359.5(SMAD4):c.1449T>G (p.Ser483Arg) rs745598003
NM_005359.5(SMAD4):c.1461T>A (p.Ala487=) rs769607309
NM_005359.5(SMAD4):c.1464T>C (p.Ala488=) rs1555687539
NM_005359.5(SMAD4):c.1486C>T (p.Arg496Cys) rs397518413
NM_005359.5(SMAD4):c.1489C>T (p.Arg497Cys) rs762118751
NM_005359.5(SMAD4):c.1492T>C (p.Leu498=) rs1057520520
NM_005359.5(SMAD4):c.1495T>C (p.Cys499Arg) rs1060500738
NM_005359.5(SMAD4):c.1498A>G (p.Ile500Val) rs281875322
NM_005359.5(SMAD4):c.1512delT (p.Phe505Leufs) rs864622252
NM_005359.5(SMAD4):c.1516G>A (p.Val506Met) rs1060500746
NM_005359.5(SMAD4):c.1529delG (p.Gly510Aspfs) rs1060500744
NM_005359.5(SMAD4):c.1533G>A (p.Pro511=) rs1057523968
NM_005359.5(SMAD4):c.1533G>T (p.Pro511=) rs1057523968
NM_005359.5(SMAD4):c.1534G>A (p.Asp512Asn) rs1555687578
NM_005359.5(SMAD4):c.153dupA (p.Asp52Argfs) rs786203560
NM_005359.5(SMAD4):c.1545A>G (p.Arg515=) rs760840557
NM_005359.5(SMAD4):c.1547dupA (p.Ser517Glufs) rs587783060
NM_005359.5(SMAD4):c.155A>T (p.Asp52Val) rs1057524809
NM_005359.5(SMAD4):c.1562C>T (p.Thr521Ile) rs876659840
NM_005359.5(SMAD4):c.1572G>A (p.Trp524Ter) rs1568211588
NM_005359.5(SMAD4):c.1573A>G (p.Ile525Val) rs149755320
NM_005359.5(SMAD4):c.1591C>T (p.Arg531Trp)
NM_005359.5(SMAD4):c.1596C>T (p.Ala532=) rs765606080
NM_005359.5(SMAD4):c.1597C>T (p.Leu533Phe) rs377767381
NM_005359.5(SMAD4):c.159A>G (p.Glu53=) rs768796731
NM_005359.5(SMAD4):c.1606C>T (p.Leu536=) rs587780790
NM_005359.5(SMAD4):c.1608A>G (p.Leu536=) rs753128184
NM_005359.5(SMAD4):c.160T>C (p.Leu54=) rs1053158497
NM_005359.5(SMAD4):c.1610A>G (p.Asp537Gly) rs1555687605
NM_005359.5(SMAD4):c.1611C>T (p.Asp537=) rs369598262
NM_005359.5(SMAD4):c.1612G>T (p.Glu538Ter) rs1568211615
NM_005359.5(SMAD4):c.1616_1631del16insCA (p.Val539Alafs) rs1568211617
NM_005359.5(SMAD4):c.1632G>A (p.Pro544=) rs549489716
NM_005359.5(SMAD4):c.1632G>C (p.Pro544=) rs549489716
NM_005359.5(SMAD4):c.1634T>A (p.Ile545Asn) rs730881955
NM_005359.5(SMAD4):c.1635T>G (p.Ile545Met) rs200595795
NM_005359.5(SMAD4):c.1644A>G (p.Pro548=) rs756795016
NM_005359.5(SMAD4):c.1645C>T (p.Gln549Ter) rs1555687613
NM_005359.5(SMAD4):c.1647A>G (p.Gln549=) rs113545983
NM_005359.5(SMAD4):c.1651T>G (p.Leu551Val) rs1064793950
NM_005359.5(SMAD4):c.1653A>G (p.Leu551=) rs199526820
NM_005359.5(SMAD4):c.172A>G (p.Ile58Val) rs786204166
NM_005359.5(SMAD4):c.175A>G (p.Thr59Ala) rs587781977
NM_005359.5(SMAD4):c.177A>G (p.Thr59=) rs774480995
NM_005359.5(SMAD4):c.181A>C (p.Ile61Leu) rs1064794204
NM_005359.5(SMAD4):c.181A>G (p.Ile61Val) rs1064794204
NM_005359.5(SMAD4):c.183A>C (p.Ile61=) rs761937143
NM_005359.5(SMAD4):c.189A>G (p.Thr63=) rs1555685033
NM_005359.5(SMAD4):c.192T>C (p.Asn64=) rs1555685037
NM_005359.5(SMAD4):c.20C>T (p.Thr7Met) rs372316981
NM_005359.5(SMAD4):c.21G>A (p.Thr7=) rs142292491
NM_005359.5(SMAD4):c.228A>G (p.Arg76=) rs587780556
NM_005359.5(SMAD4):c.231A>G (p.Thr77=) rs760990830
NM_005359.5(SMAD4):c.23A>G (p.Asn8Ser) rs876658568
NM_005359.5(SMAD4):c.249+10A>C rs752243771
NM_005359.5(SMAD4):c.249_249+6dup rs1555685040
NM_005359.5(SMAD4):c.255T>G (p.Ala85=) rs1555685152
NM_005359.5(SMAD4):c.260G>C (p.Arg87Pro) rs1060500735
NM_005359.5(SMAD4):c.261G>A (p.Arg87=) rs1057520857
NM_005359.5(SMAD4):c.263_267delAAGGA (p.Lys88Ilefs) rs1060500739
NM_005359.5(SMAD4):c.26C>T (p.Thr9Ile) rs1555684986
NM_005359.5(SMAD4):c.276T>C (p.His92=) rs762501162
NM_005359.5(SMAD4):c.290G>A (p.Arg97His) rs1555685159
NM_005359.5(SMAD4):c.31A>G (p.Thr11Ala) rs587780791
NM_005359.5(SMAD4):c.332A>C (p.His111Pro) rs1064794363
NM_005359.5(SMAD4):c.336T>A (p.Val112=) rs1328102060
NM_005359.5(SMAD4):c.340T>A (p.Tyr114Asn) rs1555685170
NM_005359.5(SMAD4):c.342T>C (p.Tyr114=) rs757211048
NM_005359.5(SMAD4):c.351T>C (p.Tyr117=) rs1555685176
NM_005359.5(SMAD4):c.354G>A (p.Ala118=) rs145988618
NM_005359.5(SMAD4):c.366A>G (p.Lys122=) rs1057524633
NM_005359.5(SMAD4):c.367T>C (p.Cys123Arg) rs1568203472
NM_005359.5(SMAD4):c.369T>C (p.Cys123=) rs140926102
NM_005359.5(SMAD4):c.372T>C (p.Asp124=) rs1555685178
NM_005359.5(SMAD4):c.375T>C (p.Ser125=) rs863224401
NM_005359.5(SMAD4):c.380G>A (p.Cys127Tyr) rs1555685182
NM_005359.5(SMAD4):c.390A>G (p.Pro130=) rs755862230
NM_005359.5(SMAD4):c.394C>T (p.His132Tyr) rs1060500743
NM_005359.5(SMAD4):c.399C>T (p.Tyr133=) rs779069779
NM_005359.5(SMAD4):c.403C>T (p.Arg135Ter) rs377767326
NM_005359.5(SMAD4):c.411A>G (p.Val137=) rs201296880
NM_005359.5(SMAD4):c.424+5G>A rs200772603
NM_005359.5(SMAD4):c.424+6T>C rs771456293
NM_005359.5(SMAD4):c.425-8C>T rs1555685237
NM_005359.5(SMAD4):c.427C>T (p.Leu143Phe) rs1568203595
NM_005359.5(SMAD4):c.430_431delTC (p.Ser144Argfs) rs377767328
NM_005359.5(SMAD4):c.443delT (p.Leu148Argfs)
NM_005359.5(SMAD4):c.449G>A (p.Ser150Asn) rs750355699
NM_005359.5(SMAD4):c.454+2T>C rs1555685248
NM_005359.5(SMAD4):c.454+8A>T rs864622099
NM_005359.5(SMAD4):c.455-6A>G rs181178864
NM_005359.5(SMAD4):c.460T>G (p.Ser154Ala) rs864622209
NM_005359.5(SMAD4):c.461C>G (p.Ser154Ter) rs1555685624
NM_005359.5(SMAD4):c.463A>G (p.Ser155Gly) rs1057519259
NM_005359.5(SMAD4):c.464G>A (p.Ser155Asn) rs199790852
NM_005359.5(SMAD4):c.466A>T (p.Met156Leu) rs534355764
NM_005359.5(SMAD4):c.469_471delATG (p.Met157del) rs786201939
NM_005359.5(SMAD4):c.471G>A (p.Met157Ile) rs780716382
NM_005359.5(SMAD4):c.472G>T (p.Val158Leu) rs1555685628
NM_005359.5(SMAD4):c.479A>G (p.Asp160Gly) rs1555685629
NM_005359.5(SMAD4):c.47G>C (p.Cys16Ser) rs1555684993
NM_005359.5(SMAD4):c.486T>C (p.Tyr162=) rs1057523970
NM_005359.5(SMAD4):c.491A>G (p.His164Arg) rs876660058
NM_005359.5(SMAD4):c.49C>T (p.Leu17=) rs1555684997
NM_005359.5(SMAD4):c.512C>T (p.Ser171Leu) rs1568205010
NM_005359.5(SMAD4):c.521C>A (p.Thr174Asn) rs138800446
NM_005359.5(SMAD4):c.525A>G (p.Glu175=) rs368528856
NM_005359.5(SMAD4):c.535A>G (p.Ile179Val) rs542392980
NM_005359.5(SMAD4):c.535A>T (p.Ile179Phe) rs542392980
NM_005359.5(SMAD4):c.554C>A (p.Pro185Gln) rs770798845
NM_005359.5(SMAD4):c.554C>T (p.Pro185Leu) rs770798845
NM_005359.5(SMAD4):c.556C>G (p.Pro186Ala) rs1555685648
NM_005359.5(SMAD4):c.560G>A (p.Ser187Asn) rs927620013
NM_005359.5(SMAD4):c.565C>A (p.Arg189Ser) rs140743238
NM_005359.5(SMAD4):c.565C>T (p.Arg189Cys) rs140743238
NM_005359.5(SMAD4):c.566G>A (p.Arg189His) rs759288477
NM_005359.5(SMAD4):c.573G>A (p.Ser191=) rs761936246
NM_005359.5(SMAD4):c.575C>T (p.Thr192Ile) rs587780792
NM_005359.5(SMAD4):c.580A>G (p.Thr194Ala) rs1432058632
NM_005359.5(SMAD4):c.582A>G (p.Thr194=) rs145805120
NM_005359.5(SMAD4):c.585C>G (p.Tyr195Ter) rs1316902116
NM_005359.5(SMAD4):c.586A>G (p.Ser196Gly) rs946539148
NM_005359.5(SMAD4):c.593C>G (p.Pro198Arg) rs1189715258
NM_005359.5(SMAD4):c.606C>G (p.Ala202=) rs780665234
NM_005359.5(SMAD4):c.607C>G (p.Pro203Ala) rs199809905
NM_005359.5(SMAD4):c.615G>A (p.Glu205=) rs1555685667
NM_005359.5(SMAD4):c.615G>T (p.Glu205Asp) rs1555685667
NM_005359.5(SMAD4):c.621T>C (p.Asn207=) rs1452122852
NM_005359.5(SMAD4):c.625A>G (p.Thr209Ala) rs1555685670
NM_005359.5(SMAD4):c.627C>T (p.Thr209=) rs905151346
NM_005359.5(SMAD4):c.628A>G (p.Ser210Gly) rs1568205087
NM_005359.5(SMAD4):c.633T>C (p.Thr211=) rs1060504027
NM_005359.5(SMAD4):c.634G>A (p.Ala212Thr) rs863224732
NM_005359.5(SMAD4):c.638A>G (p.Asn213Ser) rs757977781
NM_005359.5(SMAD4):c.639C>T (p.Asn213=) rs878854767
NM_005359.5(SMAD4):c.641T>A (p.Phe214Tyr) rs1060500736
NM_005359.5(SMAD4):c.643C>T (p.Pro215Ser) rs1064793270
NM_005359.5(SMAD4):c.647A>G (p.Asn216Ser) rs138386557
NM_005359.5(SMAD4):c.651T>A (p.Ile217=) rs997151197
NM_005359.5(SMAD4):c.651T>G (p.Ile217Met) rs997151197
NM_005359.5(SMAD4):c.661T>A (p.Ser221Thr) rs1568205115
NM_005359.5(SMAD4):c.667+3G>A rs757971589
NM_005359.5(SMAD4):c.667+6T>C rs1060500745
NM_005359.5(SMAD4):c.667+9T>C rs776523203
NM_005359.5(SMAD4):c.667A>G (p.Ser223Gly) rs1568205121
NM_005359.5(SMAD4):c.668-3T>C rs1568206021
NM_005359.5(SMAD4):c.668-6C>G rs748992694
NM_005359.5(SMAD4):c.668-7C>T rs1060504028
NM_005359.5(SMAD4):c.668G>T (p.Ser223Ile) rs774334251
NM_005359.5(SMAD4):c.671A>T (p.Gln224Leu) rs587780793
NM_005359.5(SMAD4):c.677C>T (p.Ala226Val) rs539739051
NM_005359.5(SMAD4):c.684A>C (p.Ile228=) rs1555685906
NM_005359.5(SMAD4):c.688G>C (p.Gly230Arg) rs1568206043
NM_005359.5(SMAD4):c.692G>C (p.Gly231Ala) rs759679579
NM_005359.5(SMAD4):c.693C>T (p.Gly231=) rs765597059
NM_005359.5(SMAD4):c.698A>G (p.His233Arg) rs1555685910
NM_005359.5(SMAD4):c.69delG (p.Met24Cysfs)
NM_005359.5(SMAD4):c.705A>G (p.Glu235=) rs1555685912
NM_005359.5(SMAD4):c.707G>A (p.Gly236Glu) rs1568206062
NM_005359.5(SMAD4):c.70A>G (p.Met24Val) rs876659391
NM_005359.5(SMAD4):c.728_735delGGCCTCAG (p.Gly243Alafs) rs1060500742
NM_005359.5(SMAD4):c.731_732insGCCC(p.Gln245Profs) rs377767335
NM_005359.5(SMAD4):c.736C>A (p.Pro246Thr) rs876659967
NM_005359.5(SMAD4):c.743A>T (p.Gln248Leu) rs751985298
NM_005359.5(SMAD4):c.745C>G (p.Gln249Glu) rs1370953444
NM_005359.5(SMAD4):c.746_747delAGinsCC (p.Gln249Pro) rs587782209
NM_005359.5(SMAD4):c.750G>A (p.Gln250=) rs1555685922
NM_005359.5(SMAD4):c.755G>T (p.Gly252Val) rs878854768
NM_005359.5(SMAD4):c.760A>G (p.Thr254Ala) rs1284924848
NM_005359.5(SMAD4):c.763G>T (p.Gly255Cys) rs1555685930
NM_005359.5(SMAD4):c.787+7A>G rs779803439
NM_005359.5(SMAD4):c.787A>G (p.Asn263Asp) rs1568206105
NM_005359.5(SMAD4):c.788-3T>C rs1555685949
NM_005359.5(SMAD4):c.788-9A>C rs775484792
NM_005359.5(SMAD4):c.789C>T (p.Asn263=) rs763510526
NM_005359.5(SMAD4):c.792C>T (p.Ser264=) rs1555685951
NM_005359.5(SMAD4):c.812G>A (p.Ser271Asn) rs1343555503
NM_005359.5(SMAD4):c.816G>A (p.Arg272=) rs1231028123
NM_005359.5(SMAD4):c.825A>G (p.Pro275=) rs762166596
NM_005359.5(SMAD4):c.842C>T (p.Pro281Leu) rs1568206174
NM_005359.5(SMAD4):c.845A>C (p.His282Pro) rs1555685962
NM_005359.5(SMAD4):c.84A>G (p.Gln28=) rs778465458
NM_005359.5(SMAD4):c.852A>G (p.Gln284=) rs144378484
NM_005359.5(SMAD4):c.856G>A (p.Gly286Ser) rs750111831
NM_005359.5(SMAD4):c.870C>T (p.His290=) rs1060504029
NM_005359.5(SMAD4):c.871C>T (p.His291Tyr) rs863224733
NM_005359.5(SMAD4):c.875C>T (p.Pro292Leu) rs786201404
NM_005359.5(SMAD4):c.880A>G (p.Met294Val) rs7238500
NM_005359.5(SMAD4):c.884C>T (p.Pro295Leu) rs370176106
NM_005359.5(SMAD4):c.885G>A (p.Pro295=) rs772028872
NM_005359.5(SMAD4):c.888C>G (p.Pro296=) rs1060504026
NM_005359.5(SMAD4):c.890A>G (p.His297Arg) rs1060500737
NM_005359.5(SMAD4):c.899A>G (p.His300Arg) rs1060500731
NM_005359.5(SMAD4):c.8A>G (p.Asn3Ser)
NM_005359.5(SMAD4):c.904+7T>G rs1207550894
NM_005359.5(SMAD4):c.906G>A (p.Trp302Ter) rs878854769
NM_005359.5(SMAD4):c.909T>C (p.Pro303=) rs141149381
NM_005359.5(SMAD4):c.909T>G (p.Pro303=) rs141149381
NM_005359.5(SMAD4):c.910G>A (p.Val304Ile) rs375185293
NM_005359.5(SMAD4):c.917A>G (p.Asn306Ser) rs730881953
NM_005359.5(SMAD4):c.918T>G (p.Asn306Lys) rs1555686075
NM_005359.5(SMAD4):c.924T>C (p.Leu308=) rs864622414
NM_005359.5(SMAD4):c.927A>G (p.Ala309=) rs369088915
NM_005359.5(SMAD4):c.935C>G (p.Pro312Arg) rs1555686082
NM_005359.5(SMAD4):c.939C>T (p.Pro313=) rs1305282354
NM_005359.5(SMAD4):c.939dup (p.Ile314Hisfs) rs1568206602
NM_005359.5(SMAD4):c.940A>G (p.Ile314Val) rs748622028
NM_005359.5(SMAD4):c.947A>G (p.Asn316Ser) rs377119288
NM_005359.5(SMAD4):c.954T>C (p.Pro318=) rs773615487
NM_005359.5(SMAD4):c.955+1delG rs1555686086
NM_005359.5(SMAD4):c.955+7G>A rs200386455
NM_005359.5(SMAD4):c.956-3T>C rs748283001
NM_005359.5(SMAD4):c.956-4A>G rs1295343500
NM_005359.5(SMAD4):c.966T>C (p.Tyr322=) rs1465916558
NM_005359.5(SMAD4):c.969G>T (p.Trp323Cys)
NM_005359.5(SMAD4):c.9T>C (p.Asn3=) rs762273127
NM_005359.6(SMAD4):c.1067dup (p.Ser357Phefs)
Single allele

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.