ClinVar Miner

List of variants in gene SMAD4 reported as pathogenic by Invitae

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 37
Download table as spreadsheet
HGVS dbSNP
NC_000018.10:g.(?_51030213)_(51078477_?)del
NC_000018.10:g.(?_51065417)_(51067193_?)del
NC_000018.10:g.(?_51067019)_(51085042_?)del
NC_000018.10:g.(?_51076628)_(51078477_?)del
NC_000018.9:g.(?_48573411)_(48604843_?)del
NM_005359.5(SMAD4):c.(?_-1)_(*1_?)del
NM_005359.5(SMAD4):c.1037delC (p.Pro346Leufs) rs377767343
NM_005359.5(SMAD4):c.1081C>T (p.Arg361Cys) rs80338963
NM_005359.5(SMAD4):c.1082G>A (p.Arg361His) rs377767347
NM_005359.5(SMAD4):c.1096C>T (p.Gln366Ter) rs1060500733
NM_005359.5(SMAD4):c.1134_1135delAG (p.Arg378Serfs) rs1555686503
NM_005359.5(SMAD4):c.1138delA (p.Arg380Glyfs) rs1555686506
NM_005359.5(SMAD4):c.1142T>A (p.Leu381Ter) rs863224507
NM_005359.5(SMAD4):c.1166_1167delTG (p.Leu389Terfs) rs1555686600
NM_005359.5(SMAD4):c.1198delA (p.Arg400Glyfs) rs1060500734
NM_005359.5(SMAD4):c.1206dupT (p.Ser403Terfs) rs878854765
NM_005359.5(SMAD4):c.1228_1229delCA (p.Gln410Glufs) rs1555686608
NM_005359.5(SMAD4):c.1245_1248delCAGA (p.Asp415Glufs) rs80338965
NM_005359.5(SMAD4):c.1324C>T (p.Gln442Ter) rs1555687378
NM_005359.5(SMAD4):c.1333C>T (p.Arg445Ter) rs377767360
NM_005359.5(SMAD4):c.1343_1367delAGCAGCAGGCGGCTACTGCACAAGC (p.Gln448Leufs)
NM_005359.5(SMAD4):c.1353_1354insGCTACTGCACAAGCTGCAGCAGCTGCCC (p.Gln461Argfs) rs786204125
NM_005359.5(SMAD4):c.1407_1410dup (p.Gly471Profs) rs1555687386
NM_005359.5(SMAD4):c.1409delC (p.Pro470Leufs) rs1555687387
NM_005359.5(SMAD4):c.1498A>G (p.Ile500Val) rs281875322
NM_005359.5(SMAD4):c.1529delG (p.Gly510Aspfs) rs1060500744
NM_005359.5(SMAD4):c.153dupA (p.Asp52Argfs) rs786203560
NM_005359.5(SMAD4):c.1547dupA (p.Ser517Glufs) rs587783060
NM_005359.5(SMAD4):c.1572G>A (p.Trp524Ter)
NM_005359.5(SMAD4):c.263_267delAAGGA (p.Lys88Ilefs) rs1060500739
NM_005359.5(SMAD4):c.430_431delTC (p.Ser144Argfs) rs377767328
NM_005359.5(SMAD4):c.461C>G (p.Ser154Ter) rs1555685624
NM_005359.5(SMAD4):c.585C>G (p.Tyr195Ter)
NM_005359.5(SMAD4):c.728_735delGGCCTCAG (p.Gly243Alafs) rs1060500742
NM_005359.5(SMAD4):c.731_732insGCCC(p.Gln245Profs) rs377767335
NM_005359.5(SMAD4):c.906G>A (p.Trp302Ter) rs878854769
NM_005359.5(SMAD4):c.939dup (p.Ile314Hisfs)

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.