ClinVar Miner

List of variants in gene STK11 studied for not specified

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 252
Download table as spreadsheet
HGVS dbSNP
NM_000455.4(STK11):c.*11C>T rs553039153
NM_000455.4(STK11):c.*16+10G>A rs587781180
NM_000455.4(STK11):c.*16+12C>T rs730881966
NM_000455.4(STK11):c.*16+14G>A rs772576776
NM_000455.4(STK11):c.*16+16G>C rs762548463
NM_000455.4(STK11):c.*16+18C>T rs1057522995
NM_000455.4(STK11):c.*16+19C>T rs1040395243
NM_000455.4(STK11):c.*16+20G>A rs1044825795
NM_000455.4(STK11):c.*16+20G>T rs1044825795
NM_000455.4(STK11):c.*16+5G>A rs876661268
NM_000455.4(STK11):c.*16+7C>T rs992400907
NM_000455.4(STK11):c.*16+7_*16+36delCGCGGCGGGGCCCGGGTGGGGCATGTGGGG rs1064794374
NM_000455.4(STK11):c.*16+8G>A rs930846814
NM_000455.4(STK11):c.*17-10C>T rs926599353
NM_000455.4(STK11):c.*17-13T>A rs971149433
NM_000455.4(STK11):c.*17-14C>T rs896033152
NM_000455.4(STK11):c.*17-6C>T rs866505758
NM_000455.4(STK11):c.*17-8C>T rs554370182
NM_000455.4(STK11):c.*18C>G rs1057522352
NM_000455.4(STK11):c.*29A>G rs730881968
NM_000455.4(STK11):c.*29_*40delAGCCCCGCCAGG rs1064795093
NM_000455.4(STK11):c.*34C>T rs727503761
NM_000455.4(STK11):c.*35G>T rs1016942739
NM_000455.4(STK11):c.*6G>A rs1057523753
NM_000455.4(STK11):c.*8C>T rs587782259
NM_000455.4(STK11):c.*9G>A rs1057522868
NM_000455.4(STK11):c.-10T>G rs748868995
NM_000455.4(STK11):c.-11C>T rs772584871
NM_000455.4(STK11):c.-11delC rs1555734834
NM_000455.4(STK11):c.-17A>G rs1555734829
NM_000455.4(STK11):c.-19C>T rs1057522370
NM_000455.4(STK11):c.-1C>T rs759284466
NM_000455.4(STK11):c.-2G>T rs774072752
NM_000455.4(STK11):c.-48C>G rs1044460918
NM_000455.4(STK11):c.-49A>C rs549974432
NM_000455.4(STK11):c.-50_-43delCACCCGCG rs1064794909
NM_000455.4(STK11):c.-7delG rs1064795642
NM_000455.4(STK11):c.1002C>T (p.Ser334=) rs1057521267
NM_000455.4(STK11):c.1008T>C (p.Thr336=) rs878853981
NM_000455.4(STK11):c.1015C>G (p.Pro339Ala) rs769644352
NM_000455.4(STK11):c.1017G>A (p.Pro339=) rs773049570
NM_000455.4(STK11):c.1020C>T (p.Tyr340=) rs786202471
NM_000455.4(STK11):c.1027G>A (p.Asp343Asn) rs368547224
NM_000455.4(STK11):c.1032G>A (p.Leu344=) rs371928158
NM_000455.4(STK11):c.1036G>A (p.Gly346Ser) rs375431906
NM_000455.4(STK11):c.1038C>T (p.Gly346=) rs767565606
NM_000455.4(STK11):c.1039G>A (p.Ala347Thr) rs369744528
NM_000455.4(STK11):c.1041G>A (p.Ala347=) rs537906142
NM_000455.4(STK11):c.1044C>T (p.Asp348=) rs778274196
NM_000455.4(STK11):c.1045G>A (p.Glu349Lys) rs553752236
NM_000455.4(STK11):c.1050C>T (p.Asp350=) rs779583262
NM_000455.4(STK11):c.1062C>G (p.Phe354Leu) rs59912467
NM_000455.4(STK11):c.1062C>T (p.Phe354=) rs59912467
NM_000455.4(STK11):c.1063G>A (p.Asp355Asn) rs769403473
NM_000455.4(STK11):c.1068C>T (p.Ile356=) rs187744790
NM_000455.4(STK11):c.1069G>A (p.Glu357Lys) rs759473833
NM_000455.4(STK11):c.1072G>A (p.Asp358Asn) rs587778696
NM_000455.4(STK11):c.1088C>T (p.Thr363Ile) rs587778695
NM_000455.4(STK11):c.1107C>T (p.Pro369=) rs376069854
NM_000455.4(STK11):c.1108+11C>T rs368857989
NM_000455.4(STK11):c.1108+12G>A rs1057521545
NM_000455.4(STK11):c.1108+14G>A rs888983934
NM_000455.4(STK11):c.1108+16G>A rs770723400
NM_000455.4(STK11):c.1108+18C>G rs1160511142
NM_000455.4(STK11):c.1108+19C>T rs745809310
NM_000455.4(STK11):c.1108+3G>A rs755746417
NM_000455.4(STK11):c.1109-13G>A rs568152768
NM_000455.4(STK11):c.1109-13G>T rs568152768
NM_000455.4(STK11):c.1109-14C>T rs780434041
NM_000455.4(STK11):c.1109-15C>A rs1057520799
NM_000455.4(STK11):c.1109-15C>T rs1057520799
NM_000455.4(STK11):c.1109-17T>C rs1555740052
NM_000455.4(STK11):c.1109-3C>T rs864622219
NM_000455.4(STK11):c.1109-5C>T rs587782020
NM_000455.4(STK11):c.1140T>C (p.Asn380=) rs1057521658
NM_000455.4(STK11):c.1164G>A (p.Lys388=) rs786202390
NM_000455.4(STK11):c.116G>T (p.Arg39Leu) rs786203250
NM_000455.4(STK11):c.117C>T (p.Arg39=) rs786203942
NM_000455.4(STK11):c.1185A>G (p.Thr395=) rs370207155
NM_000455.4(STK11):c.1190C>T (p.Ala397Val) rs558040549
NM_000455.4(STK11):c.1191G>A (p.Ala397=) rs774759899
NM_000455.4(STK11):c.1193C>T (p.Ala398Val) rs768058962
NM_000455.4(STK11):c.1194G>A (p.Ala398=) rs184271025
NM_000455.4(STK11):c.120C>T (p.Arg40=) rs878853984
NM_000455.4(STK11):c.1211C>T (p.Ser404Phe) rs200078204
NM_000455.4(STK11):c.1225C>T (p.Arg409Trp) rs368466538
NM_000455.4(STK11):c.1226G>A (p.Arg409Gln) rs587782364
NM_000455.4(STK11):c.1243C>G (p.Arg415Gly) rs864622448
NM_000455.4(STK11):c.1248G>C (p.Lys416Asn)
NM_000455.4(STK11):c.1257C>T (p.Ser419=) rs375328708
NM_000455.4(STK11):c.1258G>A (p.Ala420Thr) rs762482152
NM_000455.4(STK11):c.125G>T (p.Arg42Leu) rs148830698
NM_000455.4(STK11):c.1262_1263delGC (p.Ser421Lysfs) rs876661216
NM_000455.4(STK11):c.1283C>G (p.Ser428Trp) rs587781537
NM_000455.4(STK11):c.1284G>A (p.Ser428=) rs369097329
NM_000455.4(STK11):c.1286C>T (p.Ala429Val) rs757369900
NM_000455.4(STK11):c.1296G>A (p.Gln432=) rs587781179
NM_000455.4(STK11):c.143A>G (p.Lys48Arg) rs766776431
NM_000455.4(STK11):c.159_170delCCTGCTGGGGGA (p.Asp53_Gly56del) rs1131690953
NM_000455.4(STK11):c.163C>T (p.Leu55=) rs1057520869
NM_000455.4(STK11):c.168G>C (p.Gly56=) rs1057521938
NM_000455.4(STK11):c.189G>A (p.Val63=) rs1342321548
NM_000455.4(STK11):c.207G>T (p.Ser69=) rs746735912
NM_000455.4(STK11):c.216G>T (p.Leu72=) rs1057524353
NM_000455.4(STK11):c.237C>T (p.Ile79=) rs751859508
NM_000455.4(STK11):c.243G>A (p.Lys81=) rs961970080
NM_000455.4(STK11):c.246G>A (p.Lys82=) rs759751510
NM_000455.4(STK11):c.264C>A (p.Ile88=) rs56354945
NM_000455.4(STK11):c.267C>T (p.Pro89=) rs778290623
NM_000455.4(STK11):c.290+11C>T rs1057520983
NM_000455.4(STK11):c.290+15C>T rs1057520378
NM_000455.4(STK11):c.290+18G>A rs757929417
NM_000455.4(STK11):c.290+36G>T rs3764640
NM_000455.4(STK11):c.290+7A>G rs587782371
NM_000455.4(STK11):c.291-14C>T rs1057521012
NM_000455.4(STK11):c.291-18C>T rs1176351456
NM_000455.4(STK11):c.291-20C>G rs973142127
NM_000455.4(STK11):c.298C>G (p.Gln100Glu) rs757841535
NM_000455.4(STK11):c.300A>G (p.Gln100=) rs765890997
NM_000455.4(STK11):c.303A>G (p.Leu101=) rs1057522543
NM_000455.4(STK11):c.312G>A (p.Arg104=) rs780749732
NM_000455.4(STK11):c.318G>T (p.Arg106=) rs777784520
NM_000455.4(STK11):c.348G>T (p.Val116=) rs774482643
NM_000455.4(STK11):c.357C>T (p.Asn119=) rs372511774
NM_000455.4(STK11):c.369G>A (p.Gln123=) rs140112347
NM_000455.4(STK11):c.374+11C>T rs368923696
NM_000455.4(STK11):c.374+24G>T rs2075604
NM_000455.4(STK11):c.374+9T>A rs762297795
NM_000455.4(STK11):c.375-49G>A rs34928889
NM_000455.4(STK11):c.375-7G>A rs587781176
NM_000455.4(STK11):c.396C>T (p.Cys132=) rs730881969
NM_000455.4(STK11):c.397G>A (p.Val133Met) rs567769257
NM_000455.4(STK11):c.414A>G (p.Glu138=) rs1045257509
NM_000455.4(STK11):c.425G>A (p.Ser142Asn)
NM_000455.4(STK11):c.426C>T (p.Ser142=) rs758448869
NM_000455.4(STK11):c.432G>A (p.Pro144=) rs376788924
NM_000455.4(STK11):c.434A>G (p.Glu145Gly) rs369764220
NM_000455.4(STK11):c.441T>C (p.Arg147=) rs786201456
NM_000455.4(STK11):c.449T>C (p.Val150Ala) rs587781802
NM_000455.4(STK11):c.453C>T (p.Cys151=) rs786201510
NM_000455.4(STK11):c.464+10C>T rs587782445
NM_000455.4(STK11):c.464+11G>C rs571895916
NM_000455.4(STK11):c.464+15C>T rs1057521355
NM_000455.4(STK11):c.464+20delG rs730881960
NM_000455.4(STK11):c.464+40_464+46dupGGGGGCC rs58579265
NM_000455.4(STK11):c.464+5G>A rs587781681
NM_000455.4(STK11):c.464+8C>T rs863224669
NM_000455.4(STK11):c.464+9G>A rs376313955
NM_000455.4(STK11):c.465-15G>T rs765010137
NM_000455.4(STK11):c.465-18G>T rs587781177
NM_000455.4(STK11):c.465-20C>T rs768282654
NM_000455.4(STK11):c.465-4G>A rs587780009
NM_000455.4(STK11):c.465-5C>A
NM_000455.4(STK11):c.465-7C>T rs864622317
NM_000455.4(STK11):c.465-8G>A rs878853990
NM_000455.4(STK11):c.480G>T (p.Leu160=) rs1176365465
NM_000455.4(STK11):c.48G>A (p.Glu16=) rs969419908
NM_000455.4(STK11):c.527A>C (p.Asp176Ala) rs1064794805
NM_000455.4(STK11):c.528C>T (p.Asp176=) rs876658393
NM_000455.4(STK11):c.537G>A (p.Pro179=) rs528535500
NM_000455.4(STK11):c.544C>T (p.Leu182=) rs1057522875
NM_000455.4(STK11):c.552C>T (p.Leu184=) rs587780719
NM_000455.4(STK11):c.555C>T (p.Thr185=) rs1060503781
NM_000455.4(STK11):c.566C>T (p.Thr189Ile) rs587781515
NM_000455.4(STK11):c.579C>A (p.Ser193=) rs730881961
NM_000455.4(STK11):c.579C>T (p.Ser193=) rs730881961
NM_000455.4(STK11):c.597+11G>T rs770719299
NM_000455.4(STK11):c.597+14A>G rs372358818
NM_000455.4(STK11):c.597+8C>T rs565387911
NM_000455.4(STK11):c.597+9G>A rs863224361
NM_000455.4(STK11):c.598-12G>A rs587781578
NM_000455.4(STK11):c.598-7G>A rs377502057
NM_000455.4(STK11):c.598-8C>T rs373610101
NM_000455.4(STK11):c.613G>A (p.Ala205Thr) rs730881981
NM_000455.4(STK11):c.615G>A (p.Ala205=) rs532889728
NM_000455.4(STK11):c.618G>A (p.Ala206=) rs370976710
NM_000455.4(STK11):c.618G>T (p.Ala206=) rs370976710
NM_000455.4(STK11):c.619G>A (p.Asp207Asn) rs587778694
NM_000455.4(STK11):c.621C>T (p.Asp207=) rs569380138
NM_000455.4(STK11):c.632G>A (p.Arg211Gln) rs730881982
NM_000455.4(STK11):c.648C>T (p.Ser216=) rs376083300
NM_000455.4(STK11):c.651G>A (p.Pro217=) rs368348370
NM_000455.4(STK11):c.663G>A (p.Pro221=) rs587780720
NM_000455.4(STK11):c.663G>T (p.Pro221=) rs587780720
NM_000455.4(STK11):c.666C>T (p.Pro222=) rs542189325
NM_000455.4(STK11):c.678C>T (p.Asn226=) rs748832988
NM_000455.4(STK11):c.690C>T (p.Thr230=) rs1057520971
NM_000455.4(STK11):c.696C>T (p.Ser232=) rs566823619
NM_000455.4(STK11):c.710A>G (p.Asp237Gly) rs1555738459
NM_000455.4(STK11):c.720G>A (p.Ser240=) rs759743897
NM_000455.4(STK11):c.723T>C (p.Ala241=) rs533550278
NM_000455.4(STK11):c.726G>A (p.Gly242=) rs776823114
NM_000455.4(STK11):c.726G>T (p.Gly242=) rs776823114
NM_000455.4(STK11):c.734+11C>T rs773604294
NM_000455.4(STK11):c.734+12G>A rs876661094
NM_000455.4(STK11):c.734+17C>G rs751929304
NM_000455.4(STK11):c.734+19C>T rs372338167
NM_000455.4(STK11):c.734+19dupC rs730881962
NM_000455.4(STK11):c.734+20G>A rs375315233
NM_000455.4(STK11):c.734+41T>C rs115624397
NM_000455.4(STK11):c.735-16_735-15delTC rs775965325
NM_000455.4(STK11):c.735-17C>T rs1057520874
NM_000455.4(STK11):c.735-9G>C rs201899557
NM_000455.4(STK11):c.738C>T (p.Tyr246=) rs137853083
NM_000455.4(STK11):c.759C>T (p.Tyr253=) rs137853075
NM_000455.4(STK11):c.771G>A (p.Gly257=) rs777998890
NM_000455.4(STK11):c.787T>C (p.Leu263=) rs372378119
NM_000455.4(STK11):c.789G>A (p.Leu263=) rs1555738654
NM_000455.4(STK11):c.795G>A (p.Glu265=) rs730881963
NM_000455.4(STK11):c.807G>A (p.Lys269=) rs1057523146
NM_000455.4(STK11):c.816C>T (p.Tyr272=) rs9282859
NM_000455.4(STK11):c.825G>A (p.Pro275=) rs202011521
NM_000455.4(STK11):c.837C>T (p.Gly279=) rs373021819
NM_000455.4(STK11):c.838_839delCCinsGT (p.Pro280Val) rs786205863
NM_000455.4(STK11):c.841_842delCC (p.Pro281Alafs) rs121913321
NM_000455.4(STK11):c.842C>T (p.Pro281Leu) rs121913322
NM_000455.4(STK11):c.843G>A (p.Pro281=) rs756095270
NM_000455.4(STK11):c.846C>G (p.Leu282=) rs777872290
NM_000455.4(STK11):c.84C>T (p.Arg28=) rs778468876
NM_000455.4(STK11):c.854T>C (p.Leu285Pro) rs1555738724
NM_000455.4(STK11):c.862+20G>T rs1057522675
NM_000455.4(STK11):c.862+26A>C rs762458568
NM_000455.4(STK11):c.863-14C>T rs756001994
NM_000455.4(STK11):c.863-17C>T rs535445817
NM_000455.4(STK11):c.863-6C>T rs757276643
NM_000455.4(STK11):c.876C>T (p.Tyr292=) rs148928808
NM_000455.4(STK11):c.882G>A (p.Pro294=) rs587781178
NM_000455.4(STK11):c.891G>A (p.Arg297=) rs730881984
NM_000455.4(STK11):c.894C>A (p.Phe298Leu) rs199681533
NM_000455.4(STK11):c.900C>T (p.Ile300=) rs546089394
NM_000455.4(STK11):c.90C>T (p.Asp30=) rs771765869
NM_000455.4(STK11):c.920+12C>T rs186518799
NM_000455.4(STK11):c.920+32G>A rs374147918
NM_000455.4(STK11):c.920+5G>A rs587780013
NM_000455.4(STK11):c.920+6C>T rs730881964
NM_000455.4(STK11):c.920+7G>A rs2075607
NM_000455.4(STK11):c.920+7G>C rs2075607
NM_000455.4(STK11):c.920+7G>T rs2075607
NM_000455.4(STK11):c.921-10G>A rs183406870
NM_000455.4(STK11):c.921-18_921-15delGCTT rs752464256
NM_000455.4(STK11):c.921-4G>A rs1057522188
NM_000455.4(STK11):c.921-58A>G
NM_000455.4(STK11):c.921-9C>T rs761688641
NM_000455.4(STK11):c.921-9delC rs1555739151
NM_000455.4(STK11):c.942T>C (p.Pro314=) rs1256260277
NM_000455.4(STK11):c.945G>A (p.Pro315=) rs376329042
NM_000455.4(STK11):c.963C>T (p.Pro321=) rs878853993
NM_000455.4(STK11):c.96C>G (p.Thr32=) rs79175212
NM_000455.4(STK11):c.970C>G (p.Pro324Ala) rs549474196
NM_000455.4(STK11):c.972G>A (p.Pro324=) rs553474397
NM_000455.4(STK11):c.976C>A (p.Pro326Thr) rs771632414
NM_000455.4(STK11):c.984C>G (p.Thr328=) rs730881965

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.