ClinVar Miner

List of variants in gene TP53 reported as pathogenic

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 343
Download table as spreadsheet
HGVS dbSNP
NC_000017.10:g.(?_7572917)_(7579922_?)del
NC_000017.10:g.(?_7572921)_(7579918_?)del
NM_000546.5(TP53):c.1008_1009GC[1] (p.Arg337fs) rs1131691040
NM_000546.5(TP53):c.1009C>T (p.Arg337Cys) rs587782529
NM_000546.5(TP53):c.1010G>A (p.Arg337His) rs121912664
NM_000546.5(TP53):c.1014_1015insT (p.Glu339Ter) rs1567542146
NM_000546.5(TP53):c.1015G>T (p.Glu339Ter) rs17882252
NM_000546.5(TP53):c.1018del (p.Met340fs) rs1131691005
NM_000546.5(TP53):c.1024C>T (p.Arg342Ter) rs730882029
NM_000546.5(TP53):c.1024del (p.Arg342fs) rs1131691022
NM_000546.5(TP53):c.1025G>C (p.Arg342Pro) rs375338359
NM_000546.5(TP53):c.1027_1034del (p.Arg342_Glu343insTer) rs1567542043
NM_000546.5(TP53):c.1031T>C (p.Leu344Pro) rs121912662
NM_000546.5(TP53):c.1036G>T (p.Glu346Ter) rs1567542019
NM_000546.5(TP53):c.1036del (p.Glu346fs) rs1567542031
NM_000546.5(TP53):c.1040C>A (p.Ala347Asp) rs397516434
NM_000546.5(TP53):c.1043_1051delinsG (p.Leu348_Lys351delinsTer) rs1567541951
NM_000546.5(TP53):c.1045G>T (p.Glu349Ter) rs1567541975
NM_000546.5(TP53):c.1049_1050del (p.Leu350fs) rs1131691008
NM_000546.5(TP53):c.105G>T (p.Leu35Phe) rs121912661
NM_000546.5(TP53):c.1077del (p.Ser362fs) rs1555524370
NM_000546.5(TP53):c.1083del (p.Ser362fs) rs1555524354
NM_000546.5(TP53):c.1101-2A>G rs587781664
NM_000546.5(TP53):c.1125del (p.Gln375fs) rs730882017
NM_000546.5(TP53):c.112del (p.Gln38fs) rs1555526795
NM_000546.5(TP53):c.121_124dup (p.Asp42delinsGlyTer) rs1555526784
NM_000546.5(TP53):c.137delinsGT (p.Ser46fs) rs587782650
NM_000546.5(TP53):c.140del (p.Pro47fs) rs1567557016
NM_000546.5(TP53):c.151G>T (p.Glu51Ter) rs1567556930
NM_000546.5(TP53):c.153dup (p.Gln52fs) rs1567556914
NM_000546.5(TP53):c.155_156del (p.Gln52fs) rs1555526750
NM_000546.5(TP53):c.155_157dup (p.Trp53Ter) rs587782609
NM_000546.5(TP53):c.155_158dup (p.Trp53Ter) rs1195793509
NM_000546.5(TP53):c.156dup (p.Trp53fs) rs1555526748
NM_000546.5(TP53):c.158G>A (p.Trp53Ter) rs876658483
NM_000546.5(TP53):c.159G>A (p.Trp53Ter) rs1064794618
NM_000546.5(TP53):c.176del (p.Gly59fs) rs1567556784
NM_000546.5(TP53):c.184G>T (p.Glu62Ter) rs1567556752
NM_000546.5(TP53):c.193A>T (p.Arg65Ter) rs1555526721
NM_000546.5(TP53):c.196dup (p.Met66fs)
NM_000546.5(TP53):c.202G>T (p.Glu68Ter) rs869312782
NM_000546.5(TP53):c.214_215insG (p.Pro72fs) rs1131691014
NM_000546.5(TP53):c.216del (p.Val73fs) rs730882018
NM_000546.5(TP53):c.216dup (p.Val73fs) rs730882018
NM_000546.5(TP53):c.224dup (p.Ala76fs) rs1567556454
NM_000546.5(TP53):c.227_279del (p.Ala76fs) rs1555526610
NM_000546.5(TP53):c.246_253del (p.Ala83fs) rs1567556270
NM_000546.5(TP53):c.247del (p.Ala83fs) rs867725248
NM_000546.5(TP53):c.248_249del (p.Ala83fs) rs1131691010
NM_000546.5(TP53):c.250del (p.Ala84fs)
NM_000546.5(TP53):c.254del (p.Pro85fs) rs1064793279
NM_000546.5(TP53):c.257_279del (p.Ala86fs) rs886041861
NM_000546.5(TP53):c.2588dup rs1555523630
NM_000546.5(TP53):c.260_270del (p.Pro87fs) rs1567556165
NM_000546.5(TP53):c.267dup (p.Ser90fs) rs587783062
NM_000546.5(TP53):c.273G>A (p.Trp91Ter) rs876660548
NM_000546.5(TP53):c.277del (p.Leu93fs) rs1567556123
NM_000546.5(TP53):c.278del (p.Leu93fs) rs1567556114
NM_000546.5(TP53):c.284_288del (p.Ser95fs) rs878854068
NM_000546.5(TP53):c.294_297del (p.Ser99fs) rs730882015
NM_000546.5(TP53):c.295del (p.Ser99fs) rs1555526593
NM_000546.5(TP53):c.298C>T (p.Gln100Ter) rs1567555994
NM_000546.5(TP53):c.298del (p.Gln100fs) rs1567556006
NM_000546.5(TP53):c.310C>T (p.Gln104Ter) rs1567555934
NM_000546.5(TP53):c.310_329del (p.Gln104fs) rs1555526565
NM_000546.5(TP53):c.310del (p.Gln104fs) rs1567555939
NM_000546.5(TP53):c.314del (p.Gly105fs) rs1567555907
NM_000546.5(TP53):c.321C>A (p.Tyr107Ter) rs770776262
NM_000546.5(TP53):c.323_329dup (p.Leu111fs) rs1131691004
NM_000546.5(TP53):c.324_328delinsAAAA (p.Phe109fs) rs1131691031
NM_000546.5(TP53):c.326delinsCCCAA (p.Phe109fs) rs1131691038
NM_000546.5(TP53):c.328del (p.Arg110fs) rs587780066
NM_000546.5(TP53):c.329G>C (p.Arg110Pro) rs11540654
NM_000546.5(TP53):c.329G>T (p.Arg110Leu) rs11540654
NM_000546.5(TP53):c.329_330delinsCC (p.Arg110Pro)
NM_000546.5(TP53):c.334_364dup (p.Val122fs) rs1555526495
NM_000546.5(TP53):c.340_346dup (p.Ser116fs) rs1555526524
NM_000546.5(TP53):c.341T>A (p.Leu114Ter) rs781724995
NM_000546.5(TP53):c.342dup (p.His115fs)
NM_000546.5(TP53):c.358A>G (p.Lys120Glu) rs121912658
NM_000546.5(TP53):c.358A>T (p.Lys120Ter) rs121912658
NM_000546.5(TP53):c.361_371del (p.Ser121fs) rs1567555504
NM_000546.5(TP53):c.363_364TG[1] (p.Val122fs) rs587780067
NM_000546.5(TP53):c.371dup (p.Cys124fs) rs1267047192
NM_000546.5(TP53):c.372C>A (p.Cys124Ter) rs1555526478
NM_000546.5(TP53):c.375+1G>T
NM_000546.5(TP53):c.375G>A (p.Thr125=) rs55863639
NM_000546.5(TP53):c.376del (p.Tyr126fs) rs1567554542
NM_000546.5(TP53):c.383del (p.Pro128fs)
NM_000546.5(TP53):c.391A>T (p.Asn131Tyr) rs587782160
NM_000546.5(TP53):c.393del (p.Asn131fs) rs1567554408
NM_000546.5(TP53):c.394_409del (p.Lys132fs) rs786203589
NM_000546.5(TP53):c.398T>C (p.Met133Thr) rs28934873
NM_000546.5(TP53):c.403_405delinsGG (p.Cys135fs) rs1131691036
NM_000546.5(TP53):c.412G>C (p.Ala138Pro) rs28934875
NM_000546.5(TP53):c.415A>T (p.Lys139Ter) rs1212996409
NM_000546.5(TP53):c.416_420dup (p.Cys141fs) rs1555526250
NM_000546.5(TP53):c.422G>A (p.Cys141Tyr) rs587781288
NM_000546.5(TP53):c.427G>A (p.Val143Met) rs587782620
NM_000546.5(TP53):c.430C>T (p.Gln144Ter) rs757274881
NM_000546.5(TP53):c.437G>A (p.Trp146Ter) rs1206165503
NM_000546.5(TP53):c.438G>A (p.Trp146Ter) rs1131691026
NM_000546.5(TP53):c.439del (p.Val147fs) rs1567553924
NM_000546.5(TP53):c.445del (p.Ser149fs) rs1064793929
NM_000546.5(TP53):c.445dup (p.Ser149fs) rs1064793929
NM_000546.5(TP53):c.447_459del (p.Thr150fs) rs137852790
NM_000546.5(TP53):c.448_460del (p.Thr150fs) rs1064792930
NM_000546.5(TP53):c.450_452delinsT (p.Pro152fs) rs1567553834
NM_000546.5(TP53):c.451C>A (p.Pro151Thr) rs28934874
NM_000546.5(TP53):c.451C>T (p.Pro151Ser) rs28934874
NM_000546.5(TP53):c.454_466del (p.Pro152fs) rs876659215
NM_000546.5(TP53):c.455C>T (p.Pro152Leu) rs587782705
NM_000546.5(TP53):c.455del (p.Pro152fs) rs730882019
NM_000546.5(TP53):c.455dup (p.Pro153fs) rs730882019
NM_000546.5(TP53):c.45del (p.Gln16fs) rs1555526997
NM_000546.5(TP53):c.460_463del (p.Gly154fs) rs1567553658
NM_000546.5(TP53):c.469G>T (p.Val157Phe) rs121912654
NM_000546.5(TP53):c.471_474del (p.Arg158fs) rs1567553514
NM_000546.5(TP53):c.473G>A (p.Arg158His) rs587782144
NM_000546.5(TP53):c.473G>T (p.Arg158Leu) rs587782144
NM_000546.5(TP53):c.473_474delinsTT (p.Arg158Leu) rs1567553501
NM_000546.5(TP53):c.475_481dup (p.Ala161fs) rs863223301
NM_000546.5(TP53):c.488A>G (p.Tyr163Cys) rs148924904
NM_000546.5(TP53):c.489C>G (p.Tyr163Ter) rs1567553246
NM_000546.5(TP53):c.492_493delinsCT (p.Lys164_Gln165delinsAsnTer) rs1567553215
NM_000546.5(TP53):c.493C>T (p.Gln165Ter) rs730882001
NM_000546.5(TP53):c.497C>G (p.Ser166Ter) rs1555526101
NM_000546.5(TP53):c.499C>T (p.Gln167Ter) rs1555526097
NM_000546.5(TP53):c.501del (p.Gln167fs) rs1567553148
NM_000546.5(TP53):c.509_510dup (p.Glu171fs)
NM_000546.5(TP53):c.509_512del (p.Thr170fs) rs1555526082
NM_000546.5(TP53):c.511G>T (p.Glu171Ter) rs587781845
NM_000546.5(TP53):c.511_515dup (p.Val173fs) rs786202514
NM_000546.5(TP53):c.517G>A (p.Val173Met) rs876660754
NM_000546.5(TP53):c.517G>T (p.Val173Leu) rs876660754
NM_000546.5(TP53):c.517_535dup (p.His179fs) rs1567552753
NM_000546.5(TP53):c.522_559+5delGCGCTGCCCCCACCATGAGCGCTGCTCAGATAGCGATGGTGAG rs1555525957
NM_000546.5(TP53):c.523C>G (p.Arg175Gly) rs138729528
NM_000546.5(TP53):c.524G>A (p.Arg175His) rs28934578
NM_000546.5(TP53):c.527G>A (p.Cys176Tyr) rs786202962
NM_000546.5(TP53):c.52del (p.Thr18fs) rs876658627
NM_000546.5(TP53):c.530C>G (p.Pro177Arg) rs751477326
NM_000546.5(TP53):c.532del (p.His178fs) rs786202525
NM_000546.5(TP53):c.533_540del (p.His178fs) rs1567552637
NM_000546.5(TP53):c.535C>T (p.His179Tyr) rs587780070
NM_000546.5(TP53):c.537T>A (p.His179Gln) rs876660821
NM_000546.5(TP53):c.537T>G (p.His179Gln) rs876660821
NM_000546.5(TP53):c.538G>T (p.Glu180Ter) rs879253911
NM_000546.5(TP53):c.541C>T (p.Arg181Cys) rs587782596
NM_000546.5(TP53):c.542G>A (p.Arg181His) rs397514495
NM_000546.5(TP53):c.545del (p.Cys182fs) rs1567552584
NM_000546.5(TP53):c.548C>G (p.Ser183Ter) rs1555525970
NM_000546.5(TP53):c.551_554del (p.Asp184fs)
NM_000546.5(TP53):c.551del (p.Asp184fs) rs1567552536
NM_000546.5(TP53):c.559+1G>A rs1131691042
NM_000546.5(TP53):c.560-1G>C rs1202793339
NM_000546.5(TP53):c.566C>T (p.Ala189Val) rs121912665
NM_000546.5(TP53):c.574C>T (p.Gln192Ter) rs866380588
NM_000546.5(TP53):c.582del (p.Ile195fs) rs1567552031
NM_000546.5(TP53):c.584T>C (p.Ile195Thr) rs760043106
NM_000546.5(TP53):c.586C>T (p.Arg196Ter) rs397516435
NM_000546.5(TP53):c.58del (p.Ser20fs) rs1131691018
NM_000546.5(TP53):c.592G>T (p.Glu198Ter) rs1567551854
NM_000546.5(TP53):c.592del (p.Glu198fs) rs1131691035
NM_000546.5(TP53):c.595G>T (p.Gly199Ter) rs1567551821
NM_000546.5(TP53):c.599del (p.Asn200fs) rs1131691011
NM_000546.5(TP53):c.609_610delinsCT (p.Glu204Ter) rs1567551718
NM_000546.5(TP53):c.615T>A (p.Tyr205Ter) rs786202222
NM_000546.5(TP53):c.626_627del (p.Arg209fs) rs1057517840
NM_000546.5(TP53):c.628_629del (p.Asn210fs) rs587776768
NM_000546.5(TP53):c.635_636del (p.Phe212fs) rs864309495
NM_000546.5(TP53):c.636del (p.Arg213fs) rs864309495
NM_000546.5(TP53):c.637C>T (p.Arg213Ter) rs397516436
NM_000546.5(TP53):c.638G>A (p.Arg213Gln) rs587778720
NM_000546.5(TP53):c.638G>C (p.Arg213Pro) rs587778720
NM_000546.5(TP53):c.643_644dup (p.Ser215fs) rs1555525759
NM_000546.5(TP53):c.643dup (p.Ser215fs) rs1567551402
NM_000546.5(TP53):c.646G>A (p.Val216Met) rs730882025
NM_000546.5(TP53):c.646_648GTG[2] (p.Val218del)
NM_000546.5(TP53):c.647_651dup (p.Val218fs) rs1567551279
NM_000546.5(TP53):c.651_666del (p.Val218fs) rs786202315
NM_000546.5(TP53):c.652G>A (p.Val218Met) rs878854072
NM_000546.5(TP53):c.655_670del (p.Pro219fs) rs1555525710
NM_000546.5(TP53):c.659A>C (p.Tyr220Ser) rs121912666
NM_000546.5(TP53):c.659A>G (p.Tyr220Cys) rs121912666
NM_000546.5(TP53):c.660T>A (p.Tyr220Ter) rs1567551150
NM_000546.5(TP53):c.661G>T (p.Glu221Ter) rs786201592
NM_000546.5(TP53):c.662del (p.Glu221fs) rs878854071
NM_000546.5(TP53):c.665del (p.Pro222fs) rs1567551073
NM_000546.5(TP53):c.672+1G>A rs863224499
NM_000546.5(TP53):c.672G>A (p.Glu224=) rs267605076
NM_000546.5(TP53):c.672del rs1567550969
NM_000546.5(TP53):c.673-1G>A rs878854073
NM_000546.5(TP53):c.673-1G>T rs878854073
NM_000546.5(TP53):c.673-2A>G rs1555525585
NM_000546.5(TP53):c.675del (p.Gly226fs) rs1567550076
NM_000546.5(TP53):c.680del (p.Ser227fs) rs1567550018
NM_000546.5(TP53):c.681dup (p.Asp228Ter) rs1567550002
NM_000546.5(TP53):c.685_692del (p.Cys229fs) rs730882016
NM_000546.5(TP53):c.700T>C (p.Tyr234His) rs864622237
NM_000546.5(TP53):c.701A>G (p.Tyr234Cys) rs587780073
NM_000546.5(TP53):c.702_714del (p.His233_Tyr234insTer) rs1567549676
NM_000546.5(TP53):c.706T>C (p.Tyr236His) rs587782289
NM_000546.5(TP53):c.706T>G (p.Tyr236Asp) rs587782289
NM_000546.5(TP53):c.711_712GT[1] (p.Met237_Cys238insTer) rs1555525539
NM_000546.5(TP53):c.711del (p.Met237fs)
NM_000546.5(TP53):c.712T>A (p.Cys238Ser) rs1057519981
NM_000546.5(TP53):c.712T>C (p.Cys238Arg) rs1057519981
NM_000546.5(TP53):c.713G>A (p.Cys238Tyr) rs730882005
NM_000546.5(TP53):c.713G>T (p.Cys238Phe) rs730882005
NM_000546.5(TP53):c.714T>G (p.Cys238Trp) rs193920789
NM_000546.5(TP53):c.714del (p.Met237_Cys238insTer) rs1555525537
NM_000546.5(TP53):c.714dup (p.Asn239Ter) rs1567549651
NM_000546.5(TP53):c.715_724del (p.Asn239fs) rs1555525518
NM_000546.5(TP53):c.716_717insT (p.Ser240fs) rs1131691541
NM_000546.5(TP53):c.716del (p.Asn239fs) rs1060501197
NM_000546.5(TP53):c.722C>T (p.Ser241Phe) rs28934573
NM_000546.5(TP53):c.724T>C (p.Cys242Arg) rs1057519982
NM_000546.5(TP53):c.725G>A (p.Cys242Tyr) rs121912655
NM_000546.5(TP53):c.730G>A (p.Gly244Ser) rs1057519989
NM_000546.5(TP53):c.730_744del (p.Gly244_Arg248del) rs1555525486
NM_000546.5(TP53):c.731G>A (p.Gly244Asp) rs985033810
NM_000546.5(TP53):c.733G>A (p.Gly245Ser) rs28934575
NM_000546.5(TP53):c.733G>T (p.Gly245Cys) rs28934575
NM_000546.5(TP53):c.734G>A (p.Gly245Asp) rs121912656
NM_000546.5(TP53):c.736A>G (p.Met246Val) rs483352695
NM_000546.5(TP53):c.737T>G (p.Met246Arg) rs587780074
NM_000546.5(TP53):c.742C>T (p.Arg248Trp) rs121912651
NM_000546.5(TP53):c.743G>A (p.Arg248Gln) rs11540652
NM_000546.5(TP53):c.746G>T (p.Arg249Met) rs587782329
NM_000546.5(TP53):c.747G>T (p.Arg249Ser) rs28934571
NM_000546.5(TP53):c.750del (p.Ile251fs) rs1567549203
NM_000546.5(TP53):c.751A>C (p.Ile251Leu) rs730882007
NM_000546.5(TP53):c.754del (p.Leu252fs) rs1555525470
NM_000546.5(TP53):c.755T>C (p.Leu252Pro) rs121912653
NM_000546.5(TP53):c.759del (p.Ile254fs) rs1567549129
NM_000546.5(TP53):c.766_770delACACTins16 (p.?)
NM_000546.5(TP53):c.766_770delinsCAGGTCAGGACATCCA (p.Thr256fs) rs876659098
NM_000546.5(TP53):c.766dup (p.Thr256fs)
NM_000546.5(TP53):c.770T>A (p.Leu257Gln) rs28934577
NM_000546.5(TP53):c.772G>A (p.Glu258Lys) rs121912652
NM_000546.5(TP53):c.772G>T (p.Glu258Ter) rs121912652
NM_000546.5(TP53):c.77_80delinsAAGAACGT (p.Leu26fs) rs397516438
NM_000546.5(TP53):c.783-1G>A rs1555525367
NM_000546.5(TP53):c.785del (p.Gly262fs) rs879253905
NM_000546.5(TP53):c.788del (p.Asn263fs)
NM_000546.5(TP53):c.790del (p.Leu264fs) rs1060501194
NM_000546.5(TP53):c.794T>C (p.Leu265Pro) rs879253942
NM_000546.5(TP53):c.795_796delinsCT (p.Gly266Ter) rs1555525344
NM_000546.5(TP53):c.796_808del (p.Gly266fs) rs886039855
NM_000546.5(TP53):c.797G>A (p.Gly266Glu) rs193920774
NM_000546.5(TP53):c.797del (p.Gly266fs) rs1567548223
NM_000546.5(TP53):c.801dup (p.Asn268fs)
NM_000546.5(TP53):c.808_817del (p.Phe270fs) rs587781987
NM_000546.5(TP53):c.809T>C (p.Phe270Ser) rs1057519986
NM_000546.5(TP53):c.810del (p.Phe270fs) rs1567548114
NM_000546.5(TP53):c.812_815dup (p.Arg273fs)
NM_000546.5(TP53):c.814G>T (p.Val272Leu) rs121912657
NM_000546.5(TP53):c.817C>A (p.Arg273Ser) rs121913343
NM_000546.5(TP53):c.817C>G (p.Arg273Gly) rs121913343
NM_000546.5(TP53):c.817C>T (p.Arg273Cys) rs121913343
NM_000546.5(TP53):c.818G>A (p.Arg273His) rs28934576
NM_000546.5(TP53):c.818G>C (p.Arg273Pro) rs28934576
NM_000546.5(TP53):c.818G>T (p.Arg273Leu) rs28934576
NM_000546.5(TP53):c.818_819GT[1] (p.Val274fs) rs1567547933
NM_000546.5(TP53):c.824G>A (p.Cys275Tyr) rs863224451
NM_000546.5(TP53):c.826G>C (p.Ala276Pro) rs1131691029
NM_000546.5(TP53):c.827C>G (p.Ala276Gly) rs786202082
NM_000546.5(TP53):c.831T>A (p.Cys277Ter) rs1057523347
NM_000546.5(TP53):c.832C>T (p.Pro278Ser) rs17849781
NM_000546.5(TP53):c.833C>T (p.Pro278Leu) rs876659802
NM_000546.5(TP53):c.836G>A (p.Gly279Glu) rs1064793881
NM_000546.5(TP53):c.837_838GA[2] (p.Asp281fs) rs1567547661
NM_000546.5(TP53):c.839G>C (p.Arg280Thr) rs121912660
NM_000546.5(TP53):c.839del (p.Arg280fs) rs1567547721
NM_000546.5(TP53):c.841G>A (p.Asp281Asn) rs764146326
NM_000546.5(TP53):c.841G>T (p.Asp281Tyr) rs764146326
NM_000546.5(TP53):c.842A>G (p.Asp281Gly) rs587781525
NM_000546.5(TP53):c.842A>T (p.Asp281Val) rs587781525
NM_000546.5(TP53):c.842_843insG (p.Asp281fs) rs1555525226
NM_000546.5(TP53):c.844C>G (p.Arg282Gly) rs28934574
NM_000546.5(TP53):c.844C>T (p.Arg282Trp) rs28934574
NM_000546.5(TP53):c.844_847delinsAG (p.Arg283fs) rs1555525209
NM_000546.5(TP53):c.844del (p.Arg282fs) rs1131691027
NM_000546.5(TP53):c.845G>C (p.Arg282Pro) rs730882008
NM_000546.5(TP53):c.848_857del (p.Arg283fs) rs1555525170
NM_000546.5(TP53):c.848_867dup (p.Arg290fs)
NM_000546.5(TP53):c.853G>A (p.Glu285Lys) rs112431538
NM_000546.5(TP53):c.854A>T (p.Glu285Val) rs121912667
NM_000546.5(TP53):c.856G>A (p.Glu286Lys) rs786201059
NM_000546.5(TP53):c.856G>T (p.Glu286Ter) rs786201059
NM_000546.5(TP53):c.859_860GA[3] (p.Asn288fs) rs1555525158
NM_000546.5(TP53):c.863_864insGGCACAGAGGAAGAGAA (p.Asn288fs) rs1555525156
NM_000546.5(TP53):c.86_96+4del rs1555526916
NM_000546.5(TP53):c.86del (p.Asn29fs) rs1555526931
NM_000546.5(TP53):c.870dup (p.Lys291fs) rs1555525140
NM_000546.5(TP53):c.875A>T (p.Lys292Ile) rs121912663
NM_000546.5(TP53):c.880G>T (p.Glu294Ter) rs1057520607
NM_000546.5(TP53):c.888_892del (p.His296fs) rs1567547030
NM_000546.5(TP53):c.892G>T (p.Glu298Ter) rs201744589
NM_000546.5(TP53):c.896_909del (p.Leu299fs) rs1555525054
NM_000546.5(TP53):c.901_902dup (p.Gly302fs)
NM_000546.5(TP53):c.902del (p.Pro301fs) rs876660726
NM_000546.5(TP53):c.906del (p.Ser303fs) rs786202055
NM_000546.5(TP53):c.908_909insGGGG (p.Ser303fs) rs1567546889
NM_000546.5(TP53):c.90_91insA (p.Val31fs) rs1131691618
NM_000546.5(TP53):c.912dup (p.Lys305Ter) rs1567546818
NM_000546.5(TP53):c.916C>T (p.Arg306Ter) rs121913344
NM_000546.5(TP53):c.917_919+10del rs1555525040
NM_000546.5(TP53):c.917_919+15delGAGGTAAGCAAGCAGGAC
NM_000546.5(TP53):c.917_919+6delGAGGTAAGC rs1567546716
NM_000546.5(TP53):c.919+1G>A rs1131691039
NM_000546.5(TP53):c.919+2T>A rs1131691016
NM_000546.5(TP53):c.919+2T>G rs1131691016
NM_000546.5(TP53):c.920-1G>A rs587781702
NM_000546.5(TP53):c.920-1G>T rs587781702
NM_000546.5(TP53):c.920-2A>G rs397516439
NM_000546.5(TP53):c.933del (p.Asn311fs) rs1567546373
NM_000546.5(TP53):c.937_946del (p.Ser313fs) rs1567546226
NM_000546.5(TP53):c.945del (p.Gln317fs)
NM_000546.5(TP53):c.949C>T (p.Gln317Ter) rs764735889
NM_000546.5(TP53):c.949del (p.Gln317fs) rs1567546196
NM_000546.5(TP53):c.950del (p.Gln317fs) rs1555524976
NM_000546.5(TP53):c.96+1G>C rs1131691003
NM_000546.5(TP53):c.96+1G>T rs1131691003
NM_000546.5(TP53):c.968_986del (p.Leu323fs) rs1567545918
NM_000546.5(TP53):c.97-11C>G
NM_000546.5(TP53):c.97-2A>G rs879254212
NM_000546.5(TP53):c.973G>T (p.Gly325Ter) rs863224500
NM_000546.5(TP53):c.974G>T (p.Gly325Val) rs121912659
NM_000546.5(TP53):c.976G>T (p.Glu326Ter) rs876659384
NM_000546.5(TP53):c.978_979AT[1] (p.Tyr327fs)
NM_000546.5(TP53):c.97dup (p.Ser33fs) rs1131691041
NM_000546.5(TP53):c.983dup (p.Thr329fs) rs886041285
NM_000546.5(TP53):c.990_993del (p.Gln331fs) rs1555524949
NM_000546.5(TP53):c.993+1G>A rs11575997
NM_000546.5(TP53):c.993+1G>C rs11575997
NM_000546.5(TP53):c.993+1del rs1131691033
NM_000546.5(TP53):c.994-1G>A rs587782272
NM_000546.5(TP53):c.994-1G>C rs587782272
NM_000546.5(TP53):c.996_997del (p.Ile332fs) rs1567542299
TP53, 1-BP DEL, CODON 257
TP53, 11-BP DEL/5-BP INS

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.