ClinVar Miner

List of variants in gene TPP1 reported as likely pathogenic for Ceroid lipofuscinosis neuronal 2

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 45
Download table as spreadsheet
NM_000391.3(TPP1):c.1016G>A (p.Arg339Gln) rs765380155
NM_000391.3(TPP1):c.1076-1G>A rs1554901731
NM_000391.3(TPP1):c.1076-2A>G rs1424116749
NM_000391.3(TPP1):c.1076-2A>T rs1424116749
NM_000391.3(TPP1):c.1094G>A (p.Cys365Tyr) rs119455954
NM_000391.3(TPP1):c.1145+1G>A rs113019349
NM_000391.3(TPP1):c.1259C>A (p.Ser420Ter) rs1057516319
NM_000391.3(TPP1):c.1344_1345insAGTGGCCGTGCC (p.Ala448_Tyr449insSerGlyArgAla) rs1554901580
NM_000391.3(TPP1):c.1367_1368delCT (p.Ser456Terfs) rs1554901576
NM_000391.3(TPP1):c.1376A>C (p.Tyr459Ser) rs864309505
NM_000391.3(TPP1):c.1379G>A (p.Trp460Ter) rs786204753
NM_000391.3(TPP1):c.1392_1393delCA (p.Asn464Lysfs) rs1407106889
NM_000391.3(TPP1):c.1424C>T (p.Ser475Leu) rs121908202
NM_000391.3(TPP1):c.1449delG (p.Ile484Serfs) rs1057516264
NM_000391.3(TPP1):c.1449dupG (p.Ile484Aspfs) rs1057516264
NM_000391.3(TPP1):c.1525C>T (p.Gln509Ter) rs1184563885
NM_000391.3(TPP1):c.1551+1G>A rs786204553
NM_000391.3(TPP1):c.1551+1G>C rs786204553
NM_000391.3(TPP1):c.1551+1G>T rs786204553
NM_000391.3(TPP1):c.1552-1G>A rs1057516511
NM_000391.3(TPP1):c.1611_1621del11 (p.Cys537Trpfs) rs1554901463
NM_000391.3(TPP1):c.1661dupC (p.Ala555Serfs) rs1057516579
NM_000391.3(TPP1):c.17+1G>A rs779615685
NM_000391.3(TPP1):c.184_185delTC (p.Ser62Glyfs) rs1554902216
NM_000391.3(TPP1):c.184delT (p.Ser62Argfs) rs1554902217
NM_000391.3(TPP1):c.229G>C (p.Gly77Arg) rs121908195
NM_000391.3(TPP1):c.230-1G>C rs1057516667
NM_000391.3(TPP1):c.357dup (p.Leu120Serfs) rs1554902085
NM_000391.3(TPP1):c.380G>A (p.Arg127Gln) rs121908204
NM_000391.3(TPP1):c.381-10dupT rs146315473
NM_000391.3(TPP1):c.381-2A>G rs1554902052
NM_000391.3(TPP1):c.422dup (p.Tyr141Terfs) rs1554902043
NM_000391.3(TPP1):c.456G>C (p.Arg152Ser) rs869025274
NM_000391.3(TPP1):c.457_490delTCCCCACATCCCTACCAGCTTCCACAGGCCTTGG (p.Ser153Profs) rs878855331
NM_000391.3(TPP1):c.471C>A (p.Tyr157Ter) rs553522118
NM_000391.3(TPP1):c.509-1G>T rs56144125
NM_000391.3(TPP1):c.605C>T (p.Pro202Leu) rs121908205
NM_000391.3(TPP1):c.609dupT (p.Val204Cysfs) rs1057516366
NM_000391.3(TPP1):c.687+2T>G rs1057516945
NM_000391.3(TPP1):c.689delT (p.Phe230Serfs) rs1554901898
NM_000391.3(TPP1):c.819delC (p.Ser274Valfs) rs1057517313
NM_000391.3(TPP1):c.833A>G (p.Gln278Arg) rs796053439
NM_000391.3(TPP1):c.857A>G (p.Asn286Ser) rs119455958
NM_000391.3(TPP1):c.938_939delAT (p.Asn313Argfs) rs886041487
NM_000391.3(TPP1):c.972_979del8 (p.Ser324Argfs) rs778232650

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.