ClinVar Miner

List of variants in gene TSC1 reported as uncertain significance by Invitae

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 415
Download table as spreadsheet
NM_000368.4(TSC1):c.1007G>A (p.Arg336Gln) rs397514808
NM_000368.4(TSC1):c.1016C>T (p.Thr339Ile)
NM_000368.4(TSC1):c.101A>G (p.Asn34Ser) rs980870206
NM_000368.4(TSC1):c.1025C>T (p.Pro342Leu) rs1060503197
NM_000368.4(TSC1):c.1030-3C>G rs118203488
NM_000368.4(TSC1):c.1039T>C (p.Trp347Arg)
NM_000368.4(TSC1):c.1041G>C (p.Trp347Cys)
NM_000368.4(TSC1):c.1046C>A (p.Pro349Gln) rs1554817268
NM_000368.4(TSC1):c.1054G>A (p.Val352Ile) rs796053447
NM_000368.4(TSC1):c.106+5G>A rs1554820973
NM_000368.4(TSC1):c.1065G>A (p.Met355Ile) rs878853958
NM_000368.4(TSC1):c.1078A>G (p.Thr360Ala) rs201738258
NM_000368.4(TSC1):c.1078A>T (p.Thr360Ser) rs201738258
NM_000368.4(TSC1):c.1084C>T (p.Pro362Ser) rs397514864
NM_000368.4(TSC1):c.1084_1086delCCT (p.Pro362del) rs1554817252
NM_000368.4(TSC1):c.1096C>G (p.Pro366Ala) rs1041988929
NM_000368.4(TSC1):c.1097C>T (p.Pro366Leu) rs763915012
NM_000368.4(TSC1):c.1099C>G (p.Pro367Ala) rs1412914051
NM_000368.4(TSC1):c.109C>T (p.Arg37Cys) rs1309560054
NM_000368.4(TSC1):c.1105C>A (p.Leu369Met) rs118203496
NM_000368.4(TSC1):c.1113C>A (p.His371Gln) rs771217333
NM_000368.4(TSC1):c.1121G>A (p.Ser374Asn)
NM_000368.4(TSC1):c.1130T>G (p.Phe377Cys) rs1187617751
NM_000368.4(TSC1):c.1136C>T (p.Thr379Ile) rs1060503193
NM_000368.4(TSC1):c.1138A>G (p.Thr380Ala) rs1060503216
NM_000368.4(TSC1):c.1139C>G (p.Thr380Ser) rs1064796512
NM_000368.4(TSC1):c.1139C>T (p.Thr380Ile) rs1064796512
NM_000368.4(TSC1):c.1144G>A (p.Gly382Ser) rs367564729
NM_000368.4(TSC1):c.1148G>A (p.Gly383Glu) rs1554817166
NM_000368.4(TSC1):c.1167A>T (p.Gly389=) rs876660723
NM_000368.4(TSC1):c.1190C>T (p.Pro397Leu)
NM_000368.4(TSC1):c.1195C>G (p.Pro399Ala) rs1060503211
NM_000368.4(TSC1):c.1209G>A (p.Ser403=) rs141184479
NM_000368.4(TSC1):c.1211A>T (p.Asp404Val) rs1554817130
NM_000368.4(TSC1):c.1216T>C (p.Tyr406His) rs1554817128
NM_000368.4(TSC1):c.1217A>G (p.Tyr406Cys) rs143502728
NM_000368.4(TSC1):c.121C>A (p.Leu41Ile) rs118203334
NM_000368.4(TSC1):c.121C>T (p.Leu41Phe) rs118203334
NM_000368.4(TSC1):c.1223A>G (p.His408Arg) rs1554817122
NM_000368.4(TSC1):c.1231C>A (p.Leu411Ile) rs397514840
NM_000368.4(TSC1):c.1231C>T (p.Leu411Phe) rs397514840
NM_000368.4(TSC1):c.1232T>A (p.Leu411His)
NM_000368.4(TSC1):c.1238A>G (p.Gln413Arg) rs1060503218
NM_000368.4(TSC1):c.1250C>A (p.Thr417Lys) rs77464996
NM_000368.4(TSC1):c.1253C>A (p.Pro418His) rs997339959
NM_000368.4(TSC1):c.1253C>G (p.Pro418Arg)
NM_000368.4(TSC1):c.1256C>A (p.Pro419His) rs878853959
NM_000368.4(TSC1):c.1256C>G (p.Pro419Arg) rs878853959
NM_000368.4(TSC1):c.1258A>G (p.Arg420Gly) rs1554817078
NM_000368.4(TSC1):c.1263+4C>T rs1554817077
NM_000368.4(TSC1):c.1264-6T>A rs370778877
NM_000368.4(TSC1):c.1276G>T (p.Asp426Tyr) rs765695557
NM_000368.4(TSC1):c.1277_1279delATT (p.Asp426_Ser427delinsAla)
NM_000368.4(TSC1):c.1289_1290insGCGCGGACC (p.Pro430_Cys431insArgGlyPro) rs1554816418
NM_000368.4(TSC1):c.1291T>C (p.Cys431Arg)
NM_000368.4(TSC1):c.1298A>G (p.His433Arg) rs1554816403
NM_000368.4(TSC1):c.130A>G (p.Thr44Ala) rs1399266964
NM_000368.4(TSC1):c.1315C>G (p.Leu439Val) rs199800297
NM_000368.4(TSC1):c.1328G>T (p.Gly443Val) rs1489175329
NM_000368.4(TSC1):c.1332A>C (p.Ser444=) rs773003016
NM_000368.4(TSC1):c.1333+6delA rs1060503212
NM_000368.4(TSC1):c.1340C>T (p.Pro447Leu)
NM_000368.4(TSC1):c.134T>C (p.Leu45Ser) rs1554820662
NM_000368.4(TSC1):c.1355G>C (p.Gly452Ala) rs371093730
NM_000368.4(TSC1):c.135G>A (p.Leu45=) rs149278759
NM_000368.4(TSC1):c.1376T>A (p.Leu459His) rs1554816231
NM_000368.4(TSC1):c.1410_1412delAGA (p.Glu470del)
NM_000368.4(TSC1):c.1415G>A (p.Ser472Asn)
NM_000368.4(TSC1):c.1415G>C (p.Ser472Thr)
NM_000368.4(TSC1):c.1430A>C (p.Lys477Thr) rs1554816213
NM_000368.4(TSC1):c.1436_1438delAAG (p.Glu479del)
NM_000368.4(TSC1):c.1438+5T>C rs1060503215
NM_000368.4(TSC1):c.1442C>T (p.Ala481Val) rs775367219
NM_000368.4(TSC1):c.1465A>T (p.Ile489Phe)
NM_000368.4(TSC1):c.1469C>T (p.Thr490Ile)
NM_000368.4(TSC1):c.1470_1472delCAC (p.Thr491del) rs1554816071
NM_000368.4(TSC1):c.1472C>T (p.Thr491Ile) rs1554816070
NM_000368.4(TSC1):c.1489G>A (p.Val497Met) rs946491568
NM_000368.4(TSC1):c.1489G>C (p.Val497Leu) rs946491568
NM_000368.4(TSC1):c.1528G>A (p.Asp510Asn) rs779206386
NM_000368.4(TSC1):c.1541G>A (p.Gly514Asp)
NM_000368.4(TSC1):c.1550G>A (p.Arg517Gln) rs371908551
NM_000368.4(TSC1):c.1562C>G (p.Ser521Trp)
NM_000368.4(TSC1):c.1571C>T (p.Ser524Phe) rs1276296733
NM_000368.4(TSC1):c.1580A>G (p.Gln527Arg) rs767708806
NM_000368.4(TSC1):c.1582_1602delGGCGCCAGCGTGAACCCTGAG (p.Gly528_Glu534del) rs766376606
NM_000368.4(TSC1):c.1589G>A (p.Ser530Asn) rs368481360
NM_000368.4(TSC1):c.1589G>C (p.Ser530Thr) rs368481360
NM_000368.4(TSC1):c.1591G>A (p.Val531Met)
NM_000368.4(TSC1):c.1594A>T (p.Asn532Tyr) rs765149885
NM_000368.4(TSC1):c.1600G>A (p.Glu534Lys) rs796053458
NM_000368.4(TSC1):c.1602_1603delGCinsTG (p.Glu534_Pro535delinsAspAla) rs1554815972
NM_000368.4(TSC1):c.1607T>C (p.Leu536Ser) rs776633158
NM_000368.4(TSC1):c.166C>T (p.Pro56Ser) rs1330089369
NM_000368.4(TSC1):c.1672C>T (p.Pro558Ser) rs1554815946
NM_000368.4(TSC1):c.1678G>A (p.Gly560Ser) rs746304922
NM_000368.4(TSC1):c.167C>T (p.Pro56Leu) rs750512029
NM_000368.4(TSC1):c.1738A>G (p.Ile580Val) rs1179358967
NM_000368.4(TSC1):c.1744A>G (p.Thr582Ala)
NM_000368.4(TSC1):c.1745C>T (p.Thr582Ile) rs886063623
NM_000368.4(TSC1):c.1753C>T (p.Pro585Ser) rs766367103
NM_000368.4(TSC1):c.1771C>T (p.Pro591Ser) rs1429666367
NM_000368.4(TSC1):c.1772C>A (p.Pro591Gln) rs768985094
NM_000368.4(TSC1):c.1772C>T (p.Pro591Leu) rs768985094
NM_000368.4(TSC1):c.1781T>A (p.Val594Glu) rs1060503194
NM_000368.4(TSC1):c.1794C>A (p.Ser598Arg) rs766438395
NM_000368.4(TSC1):c.1800G>C (p.Gln600His) rs1254353359
NM_000368.4(TSC1):c.1802C>T (p.Pro601Leu) rs543077026
NM_000368.4(TSC1):c.1808C>G (p.Pro603Arg)
NM_000368.4(TSC1):c.1811A>G (p.Tyr604Cys) rs1057522817
NM_000368.4(TSC1):c.1818T>A (p.His606Gln) rs758769193
NM_000368.4(TSC1):c.1855T>G (p.Phe619Val) rs1554815776
NM_000368.4(TSC1):c.1871C>G (p.Thr624Ser)
NM_000368.4(TSC1):c.1871C>T (p.Thr624Ile) rs754401816
NM_000368.4(TSC1):c.1874A>C (p.Glu625Ala) rs886038287
NM_000368.4(TSC1):c.1884_1885delAAinsGC (p.Lys629Gln) rs1554815756
NM_000368.4(TSC1):c.1888A>C (p.Lys630Gln) rs1158059433
NM_000368.4(TSC1):c.188C>T (p.Thr63Ile)
NM_000368.4(TSC1):c.1895A>G (p.Lys632Arg) rs1554815747
NM_000368.4(TSC1):c.1916G>A (p.Gly639Asp) rs372583166
NM_000368.4(TSC1):c.1922C>A (p.Pro641His) rs397514863
NM_000368.4(TSC1):c.192G>T (p.Leu64Phe) rs1554820635
NM_000368.4(TSC1):c.1934C>T (p.Pro645Leu) rs1269162063
NM_000368.4(TSC1):c.1939G>A (p.Glu647Lys)
NM_000368.4(TSC1):c.1943T>C (p.Val648Ala) rs771341361
NM_000368.4(TSC1):c.1949A>G (p.Asp650Gly) rs939275328
NM_000368.4(TSC1):c.1960C>A (p.Gln654Lys) rs75820036
NM_000368.4(TSC1):c.1975G>A (p.Ala659Thr) rs914628341
NM_000368.4(TSC1):c.1976C>T (p.Ala659Val) rs118203609
NM_000368.4(TSC1):c.1997+3A>G rs1554815682
NM_000368.4(TSC1):c.1997A>G (p.Lys666Arg) rs1419720341
NM_000368.4(TSC1):c.2006T>C (p.Leu669Ser) rs118203617
NM_000368.4(TSC1):c.2018C>A (p.Ser673Tyr)
NM_000368.4(TSC1):c.2023G>A (p.Asp675Asn) rs768189353
NM_000368.4(TSC1):c.2023G>T (p.Asp675Tyr) rs768189353
NM_000368.4(TSC1):c.2026T>A (p.Trp676Arg) rs748901883
NM_000368.4(TSC1):c.2030C>T (p.Thr677Ile) rs779584449
NM_000368.4(TSC1):c.2038G>A (p.Gly680Arg) rs757322533
NM_000368.4(TSC1):c.2039G>A (p.Gly680Glu) rs118203623
NM_000368.4(TSC1):c.2050C>T (p.Pro684Ser) rs746909024
NM_000368.4(TSC1):c.2056G>A (p.Asp686Asn)
NM_000368.4(TSC1):c.2057A>G (p.Asp686Gly) rs786201465
NM_000368.4(TSC1):c.2066G>A (p.Arg689His) rs200827913
NM_000368.4(TSC1):c.2071C>G (p.Leu691Val) rs1554815343
NM_000368.4(TSC1):c.2071C>T (p.Leu691Phe) rs1554815343
NM_000368.4(TSC1):c.2077G>C (p.Asp693His) rs397514800
NM_000368.4(TSC1):c.208A>G (p.Lys70Glu) rs876658838
NM_000368.4(TSC1):c.2097C>A (p.His699Gln) rs1554815319
NM_000368.4(TSC1):c.210G>A (p.Lys70=) rs1060503219
NM_000368.4(TSC1):c.2111A>G (p.Tyr704Cys) rs752054698
NM_000368.4(TSC1):c.213C>A (p.His71Gln) rs765578482
NM_000368.4(TSC1):c.2141T>A (p.Leu714His) rs1438737976
NM_000368.4(TSC1):c.2143C>T (p.Arg715Trp)
NM_000368.4(TSC1):c.2145G>C (p.Arg715=)
NM_000368.4(TSC1):c.2153G>A (p.Arg718Gln) rs1060503207
NM_000368.4(TSC1):c.2162G>A (p.Arg721His) rs769566267
NM_000368.4(TSC1):c.2183C>T (p.Ala728Val)
NM_000368.4(TSC1):c.2195A>G (p.His732Arg) rs878853964
NM_000368.4(TSC1):c.2198A>C (p.Asn733Thr)
NM_000368.4(TSC1):c.2225T>C (p.Leu742Ser) rs1060503201
NM_000368.4(TSC1):c.2236G>T (p.Asp746Tyr) rs786203007
NM_000368.4(TSC1):c.2239A>G (p.Ile747Val)
NM_000368.4(TSC1):c.2275G>A (p.Ala759Thr) rs1060503199
NM_000368.4(TSC1):c.2276C>T (p.Ala759Val) rs1554815021
NM_000368.4(TSC1):c.2281T>C (p.Tyr761His) rs776386313
NM_000368.4(TSC1):c.2282A>G (p.Tyr761Cys) rs1554815018
NM_000368.4(TSC1):c.2299C>G (p.Gln767Glu)
NM_000368.4(TSC1):c.2303G>A (p.Arg768His) rs1033725987
NM_000368.4(TSC1):c.2317_2318delACinsCA (p.Thr773His) rs1060503202
NM_000368.4(TSC1):c.2323C>T (p.Leu775Phe) rs868755168
NM_000368.4(TSC1):c.2329A>G (p.Ser777Gly) rs1554814968
NM_000368.4(TSC1):c.2331C>G (p.Ser777Arg) rs1554814967
NM_000368.4(TSC1):c.2357G>A (p.Arg786Gln)
NM_000368.4(TSC1):c.2359G>A (p.Glu787Lys)
NM_000368.4(TSC1):c.2361G>C (p.Glu787Asp)
NM_000368.4(TSC1):c.236A>G (p.Tyr79Cys) rs373855276
NM_000368.4(TSC1):c.2375A>G (p.Gln792Arg) rs796053460
NM_000368.4(TSC1):c.2380C>A (p.Gln794Lys)
NM_000368.4(TSC1):c.2389C>A (p.Gln797Lys) rs397514862
NM_000368.4(TSC1):c.23G>C (p.Gly8Ala) rs1269896419
NM_000368.4(TSC1):c.23G>T (p.Gly8Val)
NM_000368.4(TSC1):c.2420T>C (p.Ile807Thr) rs118203690
NM_000368.4(TSC1):c.2423C>T (p.Ala808Val) rs756514375
NM_000368.4(TSC1):c.2431C>G (p.Arg811Gly) rs397514814
NM_000368.4(TSC1):c.2438A>G (p.Glu813Gly) rs1554814657
NM_000368.4(TSC1):c.2449G>T (p.Ala817Ser) rs1554814652
NM_000368.4(TSC1):c.2459A>G (p.Lys820Arg)
NM_000368.4(TSC1):c.2470A>G (p.Thr824Ala) rs1554814639
NM_000368.4(TSC1):c.2491G>A (p.Val831Ile) rs773279842
NM_000368.4(TSC1):c.2491G>T (p.Val831Phe) rs773279842
NM_000368.4(TSC1):c.2503-3T>C rs1355806067
NM_000368.4(TSC1):c.2513G>A (p.Ser838Asn) rs1060503208
NM_000368.4(TSC1):c.2519C>T (p.Ser840Leu)
NM_000368.4(TSC1):c.2547C>G (p.Asn849Lys) rs1554814418
NM_000368.4(TSC1):c.2549G>A (p.Arg850Lys) rs1060503195
NM_000368.4(TSC1):c.2585A>G (p.Tyr862Cys) rs1060503221
NM_000368.4(TSC1):c.2614G>C (p.Asp872His) rs746607455
NM_000368.4(TSC1):c.2626-3C>T rs1060503192
NM_000368.4(TSC1):c.2626G>A (p.Glu876Lys) rs747602915
NM_000368.4(TSC1):c.2630T>C (p.Val877Ala)
NM_000368.4(TSC1):c.2637G>A (p.Met879Ile) rs1554813610
NM_000368.4(TSC1):c.2637G>T (p.Met879Ile) rs1554813610
NM_000368.4(TSC1):c.2640G>T (p.Met880Ile) rs1218889799
NM_000368.4(TSC1):c.2645C>T (p.Ala882Val) rs1554813594
NM_000368.4(TSC1):c.265A>G (p.Ile89Val)
NM_000368.4(TSC1):c.2665_2666delGAinsAT (p.Glu889Ile) rs587778724
NM_000368.4(TSC1):c.266T>C (p.Ile89Thr)
NM_000368.4(TSC1):c.2672A>G (p.Asn891Ser) rs1060503203
NM_000368.4(TSC1):c.2677A>C (p.Ser893Arg)
NM_000368.4(TSC1):c.2683G>A (p.Val895Ile) rs576476807
NM_000368.4(TSC1):c.2686C>A (p.Leu896Ile)
NM_000368.4(TSC1):c.2686C>T (p.Leu896Phe)
NM_000368.4(TSC1):c.2700G>C (p.Gln900His)
NM_000368.4(TSC1):c.2710A>G (p.Thr904Ala) rs1554813482
NM_000368.4(TSC1):c.2711C>T (p.Thr904Ile)
NM_000368.4(TSC1):c.2722C>T (p.Arg908Trp) rs748845915
NM_000368.4(TSC1):c.2723G>A (p.Arg908Gln) rs780115763
NM_000368.4(TSC1):c.2749G>C (p.Ala917Pro) rs397514873
NM_000368.4(TSC1):c.2755A>C (p.Lys919Gln) rs1319954878
NM_000368.4(TSC1):c.2755A>G (p.Lys919Glu)
NM_000368.4(TSC1):c.2756A>C (p.Lys919Thr)
NM_000368.4(TSC1):c.2778G>C (p.Gln926His) rs1554813423
NM_000368.4(TSC1):c.2812A>C (p.Arg938=) rs1207111375
NM_000368.4(TSC1):c.2813+5C>T rs1060503223
NM_000368.4(TSC1):c.2813G>A (p.Arg938Lys) rs1249697208
NM_000368.4(TSC1):c.2815G>A (p.Gly939Arg)
NM_000368.4(TSC1):c.2830G>A (p.Ala944Thr) rs751362258
NM_000368.4(TSC1):c.2836A>T (p.Ser946Cys) rs1060503225
NM_000368.4(TSC1):c.2841G>T (p.Arg947Ser) rs1417111404
NM_000368.4(TSC1):c.2843A>G (p.Tyr948Cys) rs989183765
NM_000368.4(TSC1):c.2861_2862delTAinsAC (p.Ile954Asn)
NM_000368.4(TSC1):c.2867A>G (p.Gln956Arg) rs1212768461
NM_000368.4(TSC1):c.2867A>T (p.Gln956Leu) rs1212768461
NM_000368.4(TSC1):c.2885T>G (p.Ile962Ser) rs1438535722
NM_000368.4(TSC1):c.2890G>A (p.Asp964Asn)
NM_000368.4(TSC1):c.2891A>T (p.Asp964Val) rs1554813302
NM_000368.4(TSC1):c.2893T>A (p.Leu965Ile) rs1060503217
NM_000368.4(TSC1):c.2896T>C (p.Tyr966His) rs767946427
NM_000368.4(TSC1):c.289A>G (p.Ile97Val) rs138541569
NM_000368.4(TSC1):c.28C>T (p.Leu10Phe) rs1399717425
NM_000368.4(TSC1):c.2901C>T (p.Gly967=) rs774634388
NM_000368.4(TSC1):c.2930A>G (p.Lys977Arg) rs1433723046
NM_000368.4(TSC1):c.2933T>C (p.Leu978Pro)
NM_000368.4(TSC1):c.2938G>A (p.Glu980Lys) rs876658600
NM_000368.4(TSC1):c.2941_2943delGAA (p.Glu981del)
NM_000368.4(TSC1):c.2949_2957delAGAAGCAGC (p.Ala988_Glu990del) rs767902029
NM_000368.4(TSC1):c.2953G>A (p.Ala985Thr) rs1554813242
NM_000368.4(TSC1):c.2966C>T (p.Ala989Val) rs1554813219
NM_000368.4(TSC1):c.2974delA (p.Arg992Glyfs) rs1554813210
NM_000368.4(TSC1):c.2975+6A>T rs1060503220
NM_000368.4(TSC1):c.2976-10T>A rs913722609
NM_000368.4(TSC1):c.2986T>G (p.Cys996Gly) rs1554813029
NM_000368.4(TSC1):c.3000C>G (p.Cys1000Trp)
NM_000368.4(TSC1):c.3008C>T (p.Ser1003Phe) rs1554812991
NM_000368.4(TSC1):c.3010A>G (p.Met1004Val)
NM_000368.4(TSC1):c.3019C>T (p.His1007Tyr) rs764738792
NM_000368.4(TSC1):c.3023A>G (p.Asn1008Ser) rs1263094349
NM_000368.4(TSC1):c.3032C>A (p.Ala1011Glu) rs796053449
NM_000368.4(TSC1):c.3034T>C (p.Ser1012Pro) rs764979889
NM_000368.4(TSC1):c.3047G>A (p.Gly1016Asp) rs1313165721
NM_000368.4(TSC1):c.3059C>T (p.Thr1020Ile) rs1060503214
NM_000368.4(TSC1):c.305C>G (p.Ser102Cys) rs1307630727
NM_000368.4(TSC1):c.3067C>T (p.Pro1023Ser) rs138445573
NM_000368.4(TSC1):c.3068C>T (p.Pro1023Leu) rs1554812917
NM_000368.4(TSC1):c.3076G>A (p.Ala1026Thr) rs533565295
NM_000368.4(TSC1):c.3076G>T (p.Ala1026Ser)
NM_000368.4(TSC1):c.3080G>A (p.Arg1027Gln) rs796053461
NM_000368.4(TSC1):c.3080G>T (p.Arg1027Leu) rs796053461
NM_000368.4(TSC1):c.3086G>T (p.Ser1029Ile) rs796053450
NM_000368.4(TSC1):c.3091G>A (p.Gly1031Arg) rs772043928
NM_000368.4(TSC1):c.3107G>A (p.Gly1036Glu) rs774196458
NM_000368.4(TSC1):c.3112A>G (p.Ser1038Gly) rs768443391
NM_000368.4(TSC1):c.3113G>A (p.Ser1038Asn) rs1060503196
NM_000368.4(TSC1):c.3121A>G (p.Ser1041Gly) rs1060503204
NM_000368.4(TSC1):c.3121_3129dup (p.Ser1043_Glu1044insSerSerSer) rs2234980
NM_000368.4(TSC1):c.3125G>A (p.Ser1042Asn) rs148931779
NM_000368.4(TSC1):c.312G>T (p.Lys104Asn) rs1554820281
NM_000368.4(TSC1):c.3133C>G (p.Leu1045Val)
NM_000368.4(TSC1):c.3140C>T (p.Thr1047Ile) rs587778726
NM_000368.4(TSC1):c.3143C>T (p.Pro1048Leu) rs1203864892
NM_000368.4(TSC1):c.3164G>T (p.Arg1055Met) rs1167652701
NM_000368.4(TSC1):c.3169G>A (p.Gly1057Ser) rs587778727
NM_000368.4(TSC1):c.3172C>A (p.Pro1058Thr) rs112066743
NM_000368.4(TSC1):c.3177C>G (p.Phe1059Leu) rs753263747
NM_000368.4(TSC1):c.3181A>C (p.Ser1061Arg)
NM_000368.4(TSC1):c.3181A>G (p.Ser1061Gly)
NM_000368.4(TSC1):c.3185G>A (p.Arg1062Gln) rs755396992
NM_000368.4(TSC1):c.3200T>G (p.Met1067Arg) rs1167362899
NM_000368.4(TSC1):c.3206A>T (p.Glu1069Val) rs1554812780
NM_000368.4(TSC1):c.3209C>G (p.Ala1070Gly) rs1060503200
NM_000368.4(TSC1):c.3209C>T (p.Ala1070Val) rs1060503200
NM_000368.4(TSC1):c.3215C>T (p.Ala1072Val)
NM_000368.4(TSC1):c.3244C>G (p.Pro1082Ala) rs1060503191
NM_000368.4(TSC1):c.3245C>T (p.Pro1082Leu) rs767439431
NM_000368.4(TSC1):c.3266G>C (p.Gly1089Ala) rs762845573
NM_000368.4(TSC1):c.3278G>A (p.Arg1093Gln) rs550526986
NM_000368.4(TSC1):c.3289C>T (p.Arg1097Cys) rs779599439
NM_000368.4(TSC1):c.3290G>A (p.Arg1097His) rs118203750
NM_000368.4(TSC1):c.3293A>G (p.Asn1098Ser) rs1554812687
NM_000368.4(TSC1):c.3300C>T (p.Ser1100=) rs754282309
NM_000368.4(TSC1):c.3301G>A (p.Glu1101Lys) rs1554812661
NM_000368.4(TSC1):c.3305G>C (p.Ser1102Thr) rs1263464680
NM_000368.4(TSC1):c.3308A>G (p.Gln1103Arg)
NM_000368.4(TSC1):c.3311G>T (p.Cys1104Phe) rs796053467
NM_000368.4(TSC1):c.3319G>A (p.Asp1107Asn) rs1060503226
NM_000368.4(TSC1):c.331C>T (p.Pro111Ser)
NM_000368.4(TSC1):c.3322G>A (p.Gly1108Ser) rs118203753
NM_000368.4(TSC1):c.3332G>A (p.Ser1111Asn) rs1554812642
NM_000368.4(TSC1):c.334C>T (p.Leu112Phe) rs1554820276
NM_000368.4(TSC1):c.3350T>C (p.Leu1117Pro) rs762641110
NM_000368.4(TSC1):c.3364G>A (p.Gly1122Ser)
NM_000368.4(TSC1):c.3368_3369delAA (p.Lys1123Argfs) rs878853967
NM_000368.4(TSC1):c.3386C>T (p.Ala1129Val) rs772233665
NM_000368.4(TSC1):c.3400A>C (p.Asn1134His) rs1554812610
NM_000368.4(TSC1):c.3408T>A (p.Asp1136Glu) rs751398082
NM_000368.4(TSC1):c.340C>T (p.Pro114Ser) rs779395169
NM_000368.4(TSC1):c.3416A>C (p.His1139Pro) rs764018144
NM_000368.4(TSC1):c.3419C>T (p.Pro1140Leu) rs751126355
NM_000368.4(TSC1):c.3424C>G (p.Pro1142Ala) rs1060503227
NM_000368.4(TSC1):c.3434C>T (p.Pro1145Leu) rs767904247
NM_000368.4(TSC1):c.3436G>T (p.Asp1146Tyr) rs397514806
NM_000368.4(TSC1):c.3442G>A (p.Val1148Ile) rs1554812551
NM_000368.4(TSC1):c.3455A>G (p.His1152Arg) rs1554812543
NM_000368.4(TSC1):c.3469A>G (p.Asn1157Asp) rs796053451
NM_000368.4(TSC1):c.3475A>C (p.Thr1159Pro) rs1216169846
NM_000368.4(TSC1):c.3482A>G (p.His1161Arg)
NM_000368.4(TSC1):c.3486A>T (p.Glu1162Asp) rs749746550
NM_000368.4(TSC1):c.348A>T (p.Leu116Phe) rs755799702
NM_000368.4(TSC1):c.358C>A (p.Leu120Ile) rs1554820263
NM_000368.4(TSC1):c.362A>T (p.Lys121Met) rs118203369
NM_000368.4(TSC1):c.370A>G (p.Thr124Ala) rs745871522
NM_000368.4(TSC1):c.376G>A (p.Val126Ile) rs397514843
NM_000368.4(TSC1):c.385C>G (p.Leu129Val) rs1060503198
NM_000368.4(TSC1):c.389C>T (p.Thr130Ile) rs779340088
NM_000368.4(TSC1):c.397G>A (p.Val133Ile) rs118203381
NM_000368.4(TSC1):c.418C>G (p.Leu140Val) rs1554819915
NM_000368.4(TSC1):c.43G>A (p.Asp15Asn) rs1554821020
NM_000368.4(TSC1):c.448C>T (p.His150Tyr) rs1060503206
NM_000368.4(TSC1):c.460T>A (p.Phe154Ile) rs1485129708
NM_000368.4(TSC1):c.467A>C (p.Asp156Ala) rs893232039
NM_000368.4(TSC1):c.478C>T (p.Arg160Cys) rs1554819886
NM_000368.4(TSC1):c.479G>A (p.Arg160His) rs749979841
NM_000368.4(TSC1):c.47C>G (p.Ser16Cys) rs774900322
NM_000368.4(TSC1):c.47C>T (p.Ser16Phe) rs774900322
NM_000368.4(TSC1):c.484T>C (p.Ser162Pro) rs1060503205
NM_000368.4(TSC1):c.503A>C (p.Lys168Thr) rs1007335343
NM_000368.4(TSC1):c.514G>A (p.Val172Met) rs952813051
NM_000368.4(TSC1):c.514G>C (p.Val172Leu)
NM_000368.4(TSC1):c.518C>T (p.Ala173Val) rs777484049
NM_000368.4(TSC1):c.523G>T (p.Val175Phe)
NM_000368.4(TSC1):c.524T>C (p.Val175Ala) rs1415895533
NM_000368.4(TSC1):c.527A>G (p.Tyr176Cys) rs1060503209
NM_000368.4(TSC1):c.548G>C (p.Ser183Thr) rs1554819580
NM_000368.4(TSC1):c.54G>C (p.Met18Ile) rs940292214
NM_000368.4(TSC1):c.556G>A (p.Ala186Thr) rs1279777367
NM_000368.4(TSC1):c.569G>A (p.Arg190His)
NM_000368.4(TSC1):c.598G>A (p.Val200Ile) rs118203410
NM_000368.4(TSC1):c.602C>T (p.Ser201Phe)
NM_000368.4(TSC1):c.610C>T (p.Arg204Cys) rs1060505021
NM_000368.4(TSC1):c.623G>C (p.Ser208Thr)
NM_000368.4(TSC1):c.647T>C (p.Phe216Ser) rs118203416
NM_000368.4(TSC1):c.64C>T (p.Arg22Trp) rs749030456
NM_000368.4(TSC1):c.65G>A (p.Arg22Gln) rs141736779
NM_000368.4(TSC1):c.65G>C (p.Arg22Pro) rs141736779
NM_000368.4(TSC1):c.670A>T (p.Met224Leu) rs535397245
NM_000368.4(TSC1):c.671T>A (p.Met224Lys)
NM_000368.4(TSC1):c.692C>T (p.Pro231Leu) rs1322586198
NM_000368.4(TSC1):c.725T>C (p.Leu242Pro) rs1554819388
NM_000368.4(TSC1):c.73G>A (p.Val25Met) rs1230244328
NM_000368.4(TSC1):c.749T>C (p.Leu250Ser) rs118203447
NM_000368.4(TSC1):c.759T>A (p.His253Gln)
NM_000368.4(TSC1):c.772G>A (p.Glu258Lys) rs118203450
NM_000368.4(TSC1):c.782A>G (p.Lys261Arg) rs371225009
NM_000368.4(TSC1):c.792G>A (p.Leu264=) rs1257538409
NM_000368.4(TSC1):c.797C>T (p.Pro266Leu) rs1554817662
NM_000368.4(TSC1):c.809C>T (p.Ser270Leu) rs878853968
NM_000368.4(TSC1):c.818A>G (p.Asp273Gly) rs768057796
NM_000368.4(TSC1):c.819T>G (p.Asp273Glu) rs148756522
NM_000368.4(TSC1):c.826T>C (p.Ser276Pro)
NM_000368.4(TSC1):c.830T>C (p.Val277Ala) rs200749357
NM_000368.4(TSC1):c.840A>G (p.Gln280=) rs1171852730
NM_000368.4(TSC1):c.848C>T (p.Ala283Val) rs1554817613
NM_000368.4(TSC1):c.850C>A (p.Arg284Ser) rs140544652
NM_000368.4(TSC1):c.850C>T (p.Arg284Cys) rs140544652
NM_000368.4(TSC1):c.857C>G (p.Pro286Arg) rs375144225
NM_000368.4(TSC1):c.871G>A (p.Asp291Asn)
NM_000368.4(TSC1):c.878C>G (p.Thr293Ser)
NM_000368.4(TSC1):c.881C>A (p.Thr294Asn) rs878853969
NM_000368.4(TSC1):c.898A>G (p.Thr300Ala) rs796053456
NM_000368.4(TSC1):c.899C>T (p.Thr300Ile) rs370916731
NM_000368.4(TSC1):c.89A>G (p.Lys30Arg) rs796053452
NM_000368.4(TSC1):c.902A>G (p.Gln301Arg) rs1389512342
NM_000368.4(TSC1):c.903G>C (p.Gln301His)
NM_000368.4(TSC1):c.912T>C (p.Tyr304=) rs118203466
NM_000368.4(TSC1):c.913+4A>C rs1178304676
NM_000368.4(TSC1):c.917G>A (p.Cys306Tyr) rs752290177
NM_000368.4(TSC1):c.931C>G (p.Pro311Ala)
NM_000368.4(TSC1):c.938C>T (p.Ser313Phe)
NM_000368.4(TSC1):c.93G>T (p.Glu31Asp) rs781059342
NM_000368.4(TSC1):c.941C>T (p.Thr314Met) rs373454700
NM_000368.4(TSC1):c.943T>A (p.Ser315Thr) rs185815387
NM_000368.4(TSC1):c.947G>A (p.Arg316Gln) rs375956049
NM_000368.4(TSC1):c.957_959delGTT (p.Leu320del) rs755655903
NM_000368.4(TSC1):c.974A>G (p.Gln325Arg)
NM_000368.4(TSC1):c.975G>T (p.Gln325His) rs1554817398
NM_000368.4(TSC1):c.988C>A (p.Leu330Met) rs1060503222

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.