ClinVar Miner

List of variants in gene TTN reported as benign for Dilated cardiomyopathy 1G; Limb-girdle muscular dystrophy, type 2J

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 645
Download table as spreadsheet
NM_001256850.1(TTN):c.16232-9T>C rs141687561
NM_001256850.1(TTN):c.22709-7C>T rs771244164
NM_001256850.1(TTN):c.31604-6T>C rs375742678
NM_001256850.1(TTN):c.33586+8C>A rs762808097
NM_001256850.1(TTN):c.34523-784T>C rs200819643
NM_001256850.1(TTN):c.35188+6C>T rs72650067
NM_001256850.1(TTN):c.48079+10G>A rs370352450
NM_001256850.1(TTN):c.64489+10G>C rs72646883
NM_001267550.1(TTN):c.45599C>G rs201057307
NM_001267550.2(TTN):c.100059T>A (p.Ile33353=) rs56026369
NM_001267550.2(TTN):c.100094G>A (p.Arg33365Gln) rs55742743
NM_001267550.2(TTN):c.100096G>A (p.Val33366Ile) rs55675869
NM_001267550.2(TTN):c.100172-17dup rs397517782
NM_001267550.2(TTN):c.1002C>T (p.Thr334=) rs148094198
NM_001267550.2(TTN):c.1003G>A (p.Val335Met) rs72647846
NM_001267550.2(TTN):c.100459C>T (p.Pro33487Ser) rs72629779
NM_001267550.2(TTN):c.100579G>A (p.Val33527Ile) rs2278196
NM_001267550.2(TTN):c.100766-9C>T rs77483833
NM_001267550.2(TTN):c.100766-9dup rs202238743
NM_001267550.2(TTN):c.10100G>A (p.Arg3367Gln) rs34819099
NM_001267550.2(TTN):c.10104T>G (p.Val3368=) rs142460433
NM_001267550.2(TTN):c.101064T>C (p.Asp33688=) rs368168812
NM_001267550.2(TTN):c.101212C>T (p.Arg33738Cys) rs56273463
NM_001267550.2(TTN):c.101245G>A (p.Val33749Met) rs201554140
NM_001267550.2(TTN):c.10128G>A (p.Ser3376=) rs755262343
NM_001267550.2(TTN):c.101376T>C (p.Tyr33792=) rs367732133
NM_001267550.2(TTN):c.101406C>G (p.Val33802=) rs55802460
NM_001267550.2(TTN):c.10163G>A (p.Arg3388Gln) rs187703540
NM_001267550.2(TTN):c.101665G>A (p.Val33889Ile) rs34924609
NM_001267550.2(TTN):c.101697C>T (p.Asp33899=) rs114267234
NM_001267550.2(TTN):c.101766G>C (p.Gln33922His) rs55886356
NM_001267550.2(TTN):c.101803A>G (p.Ile33935Val) rs56376197
NM_001267550.2(TTN):c.10188A>G (p.Glu3396=) rs183336802
NM_001267550.2(TTN):c.101891G>A (p.Arg33964His) rs55669553
NM_001267550.2(TTN):c.102103G>A (p.Asp34035Asn) rs144963736
NM_001267550.2(TTN):c.10242C>T (p.Tyr3414=) rs45447891
NM_001267550.2(TTN):c.102595A>G (p.Ile34199Val) rs56347248
NM_001267550.2(TTN):c.102737G>A (p.Arg34246His) rs372716177
NM_001267550.2(TTN):c.102833G>T (p.Gly34278Val) rs3731752
NM_001267550.2(TTN):c.103053C>T (p.Thr34351=) rs3731753
NM_001267550.2(TTN):c.103147G>C (p.Glu34383Gln) rs148525155
NM_001267550.2(TTN):c.103363C>T (p.Arg34455Cys) rs72629785
NM_001267550.2(TTN):c.103974C>T (p.Ile34658=) rs199714102
NM_001267550.2(TTN):c.104205G>A (p.Thr34735=) rs752424146
NM_001267550.2(TTN):c.104347C>T (p.Leu34783Phe) rs539735520
NM_001267550.2(TTN):c.104365G>A (p.Glu34789Lys) rs190565627
NM_001267550.2(TTN):c.104377A>C (p.Met34793Leu) rs72629787
NM_001267550.2(TTN):c.104560G>C (p.Val34854Leu) rs55866005
NM_001267550.2(TTN):c.104576G>A (p.Arg34859Gln) rs68080670
NM_001267550.2(TTN):c.104592G>A (p.Pro34864=) rs144094650
NM_001267550.2(TTN):c.104769A>C (p.Thr34923=) rs56375087
NM_001267550.2(TTN):c.105085T>C (p.Leu35029=) rs374678473
NM_001267550.2(TTN):c.105127C>T (p.Arg35043Cys) rs200378865
NM_001267550.2(TTN):c.105180G>C (p.Glu35060Asp) rs56308529
NM_001267550.2(TTN):c.105183G>A (p.Ala35061=) rs371075036
NM_001267550.2(TTN):c.105228G>A (p.Ser35076=) rs55938627
NM_001267550.2(TTN):c.105468G>A (p.Pro35156=) rs55806007
NM_001267550.2(TTN):c.105529G>A (p.Val35177Met) rs55865284
NM_001267550.2(TTN):c.105582C>T (p.Ser35194=) rs3829749
NM_001267550.2(TTN):c.105769G>A (p.Glu35257Lys) rs56324595
NM_001267550.2(TTN):c.105782C>T (p.Pro35261Leu) rs16866380
NM_001267550.2(TTN):c.105787_105788delinsTT (p.Ala35263Phe) rs794729250
NM_001267550.2(TTN):c.10608G>A (p.Gln3536=) rs371651343
NM_001267550.2(TTN):c.106476T>C (p.Cys35492=) rs6725673
NM_001267550.2(TTN):c.106578T>A (p.Ser35526=) rs55838839
NM_001267550.2(TTN):c.106619T>C (p.Ile35540Thr) rs55880440
NM_001267550.2(TTN):c.106638G>A (p.Arg35546=) rs56324602
NM_001267550.2(TTN):c.106787C>T (p.Thr35596Ile) rs55842557
NM_001267550.2(TTN):c.106788A>T (p.Thr35596=) rs369896045
NM_001267550.2(TTN):c.106857C>T (p.Asn35619=) rs116604145
NM_001267550.2(TTN):c.1068G>A (p.Glu356=) rs144716589
NM_001267550.2(TTN):c.10700G>A (p.Ser3567Asn) rs72955213
NM_001267550.2(TTN):c.107267T>C (p.Val35756Ala) rs16866378
NM_001267550.2(TTN):c.107576T>C (p.Met35859Thr) rs72629793
NM_001267550.2(TTN):c.107688G>A (p.Pro35896=) rs542575761
NM_001267550.2(TTN):c.107700A>G (p.Glu35900=) rs55832587
NM_001267550.2(TTN):c.107766T>C (p.Gly35922=) rs147293964
NM_001267550.2(TTN):c.107961T>C (p.His35987=) rs377439315
NM_001267550.2(TTN):c.1079G>C (p.Arg360Thr) rs56128843
NM_001267550.2(TTN):c.10850C>T (p.Ser3617Phe) rs57389274
NM_001267550.2(TTN):c.10854A>C (p.Gln3618His) rs79466278
NM_001267550.2(TTN):c.10931G>A (p.Ser3644Asn) rs78535378
NM_001267550.2(TTN):c.11019C>T (p.Cys3673=) rs72955212
NM_001267550.2(TTN):c.11370A>G (p.Gln3790=) rs72648918
NM_001267550.2(TTN):c.1137A>G (p.Arg379=) rs55972547
NM_001267550.2(TTN):c.11506G>A (p.Val3836Met) rs397517825
NM_001267550.2(TTN):c.11719C>G (p.Leu3907Val) rs55853696
NM_001267550.2(TTN):c.11811T>C (p.Pro3937=) rs571602215
NM_001267550.2(TTN):c.11969C>T (p.Pro3990Leu) rs33971253
NM_001267550.2(TTN):c.12024C>T (p.Leu4008=) rs371694842
NM_001267550.2(TTN):c.12117C>T (p.Pro4039=) rs55895721
NM_001267550.2(TTN):c.1213G>A (p.Ala405Thr) rs112266780
NM_001267550.2(TTN):c.12233C>T (p.Thr4078Ile) rs80136515
NM_001267550.2(TTN):c.12234C>G (p.Thr4078=) rs192857526
NM_001267550.2(TTN):c.12235A>G (p.Ile4079Val) rs34070843
NM_001267550.2(TTN):c.12580A>T (p.Ile4194Phe) rs34618570
NM_001267550.2(TTN):c.12780G>T (p.Ala4260=) rs746578
NM_001267550.2(TTN):c.13194A>G (p.Gln4398=) rs375347596
NM_001267550.2(TTN):c.13202G>A (p.Arg4401Gln) rs200431386
NM_001267550.2(TTN):c.13287T>C (p.Ala4429=) rs370604524
NM_001267550.2(TTN):c.13706G>A (p.Ser4569Asn) rs115532048
NM_001267550.2(TTN):c.13859G>A (p.Gly4620Asp) rs55857742
NM_001267550.2(TTN):c.13969A>C (p.Asn4657His) rs200204761
NM_001267550.2(TTN):c.14004C>T (p.Thr4668=) rs201200682
NM_001267550.2(TTN):c.14698G>A (p.Ala4900Thr) rs72648923
NM_001267550.2(TTN):c.14765G>A (p.Ser4922Asn) rs184740744
NM_001267550.2(TTN):c.14784C>A (p.Leu4928=) rs373875040
NM_001267550.2(TTN):c.14870C>G (p.Thr4957Ser) rs72648925
NM_001267550.2(TTN):c.1492G>A (p.Val498Ile) rs72647851
NM_001267550.2(TTN):c.14984C>G (p.Pro4995Arg) rs72648927
NM_001267550.2(TTN):c.15178G>A (p.Val5060Ile) rs72648929
NM_001267550.2(TTN):c.15178G>C (p.Val5060Leu) rs72648929
NM_001267550.2(TTN):c.15552C>T (p.Thr5184=) rs146353237
NM_001267550.2(TTN):c.15584A>G (p.Glu5195Gly) rs72648931
NM_001267550.2(TTN):c.15717G>A (p.Thr5239=) rs72648932
NM_001267550.2(TTN):c.15850G>A (p.Val5284Met) rs66839174
NM_001267550.2(TTN):c.15906C>T (p.Val5302=) rs375179152
NM_001267550.2(TTN):c.16055-9A>C rs368897883
NM_001267550.2(TTN):c.16056T>C (p.Asp5352=) rs376820575
NM_001267550.2(TTN):c.16095C>T (p.Asn5365=) rs72648935
NM_001267550.2(TTN):c.16113T>C (p.Asn5371=) rs143845692
NM_001267550.2(TTN):c.16303G>A (p.Val5435Met) rs72648937
NM_001267550.2(TTN):c.16422A>G (p.Gln5474=) rs371026448
NM_001267550.2(TTN):c.16529A>G (p.Tyr5510Cys) rs72648939
NM_001267550.2(TTN):c.16621+10G>A rs539530049
NM_001267550.2(TTN):c.16621+7A>T rs10200398
NM_001267550.2(TTN):c.17048A>G (p.Tyr5683Cys) rs72648942
NM_001267550.2(TTN):c.1709C>T (p.Ala570Val) rs146690035
NM_001267550.2(TTN):c.17115C>T (p.Gly5705=) rs370036981
NM_001267550.2(TTN):c.17312C>G (p.Thr5771Ser) rs16866477
NM_001267550.2(TTN):c.17543G>A (p.Gly5848Glu) rs185962498
NM_001267550.2(TTN):c.1776T>C (p.Asp592=) rs147081804
NM_001267550.2(TTN):c.177C>T (p.Ser59=) rs191057824
NM_001267550.2(TTN):c.17888A>G (p.Glu5963Gly) rs146983095
NM_001267550.2(TTN):c.178G>T (p.Asp60Tyr) rs35683768
NM_001267550.2(TTN):c.17989G>A (p.Ala5997Thr) rs72648946
NM_001267550.2(TTN):c.18075C>T (p.Pro6025=) rs557350005
NM_001267550.2(TTN):c.18379T>G (p.Cys6127Gly) rs370812788
NM_001267550.2(TTN):c.18390A>T (p.Thr6130=) rs66523653
NM_001267550.2(TTN):c.18407G>A (p.Arg6136Gln) rs117551279
NM_001267550.2(TTN):c.18531G>C (p.Val6177=) rs370684491
NM_001267550.2(TTN):c.18659G>C (p.Cys6220Ser) rs191692293
NM_001267550.2(TTN):c.18745G>A (p.Asp6249Asn) rs201263441
NM_001267550.2(TTN):c.18776C>G (p.Thr6259Ser) rs72648949
NM_001267550.2(TTN):c.18816T>C (p.Ile6272=) rs146219199
NM_001267550.2(TTN):c.18824A>G (p.Asn6275Ser) rs184412722
NM_001267550.2(TTN):c.18856G>A (p.Val6286Ile) rs149131555
NM_001267550.2(TTN):c.18903C>T (p.Thr6301=) rs72648950
NM_001267550.2(TTN):c.18961A>G (p.Ile6321Val) rs145204073
NM_001267550.2(TTN):c.19004A>G (p.Asp6335Gly) rs72648951
NM_001267550.2(TTN):c.19150C>A (p.Pro6384Thr) rs72648953
NM_001267550.2(TTN):c.19191G>A (p.Thr6397=) rs140495148
NM_001267550.2(TTN):c.19204A>G (p.Met6402Val) rs72648954
NM_001267550.2(TTN):c.19383T>C (p.Asn6461=) rs76771282
NM_001267550.2(TTN):c.19738C>T (p.Pro6580Ser) rs116572520
NM_001267550.2(TTN):c.19976C>T (p.Thr6659Met) rs16866475
NM_001267550.2(TTN):c.20025C>A (p.Ala6675=) rs373842558
NM_001267550.2(TTN):c.20147T>A (p.Met6716Lys) rs28626194
NM_001267550.2(TTN):c.20175A>G (p.Ile6725Met) rs146627500
NM_001267550.2(TTN):c.20355G>A (p.Ser6785=) rs549470227
NM_001267550.2(TTN):c.20602G>A (p.Gly6868Arg) rs17355460
NM_001267550.2(TTN):c.21019A>T (p.Ile7007Phe) rs114626713
NM_001267550.2(TTN):c.21044C>T (p.Ala7015Val) rs72648960
NM_001267550.2(TTN):c.21106G>A (p.Asp7036Asn) rs72648962
NM_001267550.2(TTN):c.21173G>A (p.Gly7058Asp) rs72648964
NM_001267550.2(TTN):c.21489C>G (p.Thr7163=) rs376882041
NM_001267550.2(TTN):c.21555C>A (p.Ile7185=) rs201155967
NM_001267550.2(TTN):c.21779C>A (p.Ser7260Tyr) rs187925021
NM_001267550.2(TTN):c.21800G>A (p.Gly7267Asp) rs375627540
NM_001267550.2(TTN):c.22074A>G (p.Lys7358=) rs34562585
NM_001267550.2(TTN):c.22077A>T (p.Gly7359=) rs202102237
NM_001267550.2(TTN):c.2226C>A (p.Ser742=) rs151025677
NM_001267550.2(TTN):c.22611T>C (p.His7537=) rs16866469
NM_001267550.2(TTN):c.22634G>A (p.Arg7545Gln) rs72648969
NM_001267550.2(TTN):c.22692A>T (p.Thr7564=) rs187182557
NM_001267550.2(TTN):c.2270C>T (p.Pro757Leu) rs116307796
NM_001267550.2(TTN):c.22786G>C (p.Asp7596His) rs72648970
NM_001267550.2(TTN):c.23001G>A (p.Thr7667=) rs16866467
NM_001267550.2(TTN):c.23023G>T (p.Asp7675Tyr) rs552951988
NM_001267550.2(TTN):c.23177C>T (p.Ser7726Leu) rs17452588
NM_001267550.2(TTN):c.23232C>G (p.Asn7744Lys) rs72648972
NM_001267550.2(TTN):c.23301C>T (p.Ser7767=) rs73038337
NM_001267550.2(TTN):c.23538C>G (p.Phe7846Leu) rs149523263
NM_001267550.2(TTN):c.23853C>A (p.Ala7951=) rs201766927
NM_001267550.2(TTN):c.24075T>G (p.Ile8025Met) rs371496970
NM_001267550.2(TTN):c.24150C>T (p.Ser8050=) rs185062935
NM_001267550.2(TTN):c.24160A>T (p.Ile8054Leu) rs72648976
NM_001267550.2(TTN):c.24195C>T (p.Ser8065=) rs182425565
NM_001267550.2(TTN):c.24345C>T (p.Ser8115=) rs72648977
NM_001267550.2(TTN):c.24471C>T (p.Gly8157=) rs113391261
NM_001267550.2(TTN):c.24579A>G (p.Thr8193=) rs72648979
NM_001267550.2(TTN):c.24652A>G (p.Ser8218Gly) rs72648980
NM_001267550.2(TTN):c.24880A>G (p.Arg8294Gly) rs72648982
NM_001267550.2(TTN):c.24909G>A (p.Lys8303=) rs72648983
NM_001267550.2(TTN):c.24973A>G (p.Lys8325Glu) rs72648984
NM_001267550.2(TTN):c.25008C>T (p.Cys8336=) rs116378128
NM_001267550.2(TTN):c.25134A>G (p.Ala8378=) rs371819104
NM_001267550.2(TTN):c.25209T>C (p.Asp8403=) rs569860898
NM_001267550.2(TTN):c.25398T>A (p.Asp8466Glu) rs72648986
NM_001267550.2(TTN):c.25490G>A (p.Arg8497His) rs149855485
NM_001267550.2(TTN):c.25626G>T (p.Gln8542His) rs2562832
NM_001267550.2(TTN):c.25704G>A (p.Arg8568=) rs150544093
NM_001267550.2(TTN):c.25936C>T (p.Arg8646Cys) rs72648987
NM_001267550.2(TTN):c.25978G>A (p.Val8660Ile) rs141856116
NM_001267550.2(TTN):c.26439C>T (p.Asn8813=) rs200088963
NM_001267550.2(TTN):c.26466C>G (p.Ala8822=) rs140003804
NM_001267550.2(TTN):c.26682G>A (p.Pro8894=) rs142812510
NM_001267550.2(TTN):c.26694G>T (p.Gly8898=) rs199525540
NM_001267550.2(TTN):c.26762-39TTTGT[10] rs71393436
NM_001267550.2(TTN):c.26762-39TTTGT[11] rs71393436
NM_001267550.2(TTN):c.26762-39TTTGT[5] rs71393436
NM_001267550.2(TTN):c.26762-39TTTGT[7] rs71393436
NM_001267550.2(TTN):c.26762-39TTTGT[8] rs71393436
NM_001267550.2(TTN):c.26863A>G (p.Ile8955Val) rs72648994
NM_001267550.2(TTN):c.26991A>G (p.Thr8997=) rs61232800
NM_001267550.2(TTN):c.2765G>A (p.Arg922His) rs56046320
NM_001267550.2(TTN):c.27702T>C (p.Ile9234=) rs143368674
NM_001267550.2(TTN):c.2781A>C (p.Thr927=) rs55892860
NM_001267550.2(TTN):c.27846C>T (p.Ser9282=) rs182355009
NM_001267550.2(TTN):c.28070C>T (p.Thr9357Ile) rs144930507
NM_001267550.2(TTN):c.28313G>A (p.Arg9438Gln) rs72648998
NM_001267550.2(TTN):c.28547G>A (p.Arg9516His) rs374156904
NM_001267550.2(TTN):c.28662G>A (p.Arg9554=) rs2742332
NM_001267550.2(TTN):c.289G>A (p.Val97Met) rs185921345
NM_001267550.2(TTN):c.29079G>A (p.Ala9693=) rs372997298
NM_001267550.2(TTN):c.29128G>A (p.Val9710Ile) rs72649002
NM_001267550.2(TTN):c.29178C>A (p.Ile9726=) rs72650003
NM_001267550.2(TTN):c.29325C>T (p.Asn9775=) rs377442695
NM_001267550.2(TTN):c.2949C>T (p.Ile983=) rs56310516
NM_001267550.2(TTN):c.29541C>T (p.Phe9847=) rs56812642
NM_001267550.2(TTN):c.29812A>T (p.Thr9938Ser) rs72650006
NM_001267550.2(TTN):c.29938G>A (p.Ala9980Thr) rs189286381
NM_001267550.2(TTN):c.30231A>G (p.Pro10077=) rs74324101
NM_001267550.2(TTN):c.30274C>T (p.His10092Tyr) rs72650011
NM_001267550.2(TTN):c.30384T>C (p.Asp10128=) rs188584219
NM_001267550.2(TTN):c.30426C>T (p.Asp10142=) rs147524531
NM_001267550.2(TTN):c.30444G>A (p.Ser10148=) rs367901929
NM_001267550.2(TTN):c.30512-19_30512-18dup rs397517532
NM_001267550.2(TTN):c.30952G>A (p.Glu10318Lys) rs73038324
NM_001267550.2(TTN):c.32011+10C>G rs192002980
NM_001267550.2(TTN):c.32049A>G (p.Lys10683=) rs375408527
NM_001267550.2(TTN):c.32254G>A (p.Val10752Ile) rs72650028
NM_001267550.2(TTN):c.32350C>G (p.Leu10784Val) rs72650029
NM_001267550.2(TTN):c.32367G>A (p.Lys10789=) rs79232842
NM_001267550.2(TTN):c.32593G>C (p.Val10865Leu) rs150733188
NM_001267550.2(TTN):c.32624C>T (p.Pro10875Leu) rs72650031
NM_001267550.2(TTN):c.32648G>A (p.Arg10883Lys) rs116676813
NM_001267550.2(TTN):c.32703G>A (p.Glu10901=) rs397517542
NM_001267550.2(TTN):c.32743G>C (p.Ala10915Pro) rs72650032
NM_001267550.2(TTN):c.32750C>T (p.Pro10917Leu) rs73973137
NM_001267550.2(TTN):c.32954G>C (p.Arg10985Pro) rs181395238
NM_001267550.2(TTN):c.33018A>G (p.Thr11006=) rs765492188
NM_001267550.2(TTN):c.33063A>G (p.Glu11021=) rs115744476
NM_001267550.2(TTN):c.33501_33503AGA[6] (p.Glu11172dup) rs368327166
NM_001267550.2(TTN):c.34129_34149GTTCTACCTGAAGAAGAGGAA[1] (p.11363_11369VLPEEEE[3]) rs587780487
NM_001267550.2(TTN):c.34216C>A (p.Pro11406Thr) rs532102837
NM_001267550.2(TTN):c.34241_34243AAG[2] (p.Glu11416del) rs397517549
NM_001267550.2(TTN):c.34474C>A (p.Pro11492Thr) rs182428755
NM_001267550.2(TTN):c.34505G>T (p.Gly11502Val) rs190209925
NM_001267550.2(TTN):c.34566A>C (p.Glu11522Asp) rs140640738
NM_001267550.2(TTN):c.34769A>G (p.Glu11590Gly) rs201167067
NM_001267550.2(TTN):c.34864G>A (p.Val11622Ile) rs202014478
NM_001267550.2(TTN):c.34970G>A (p.Arg11657His) rs59887778
NM_001267550.2(TTN):c.35264A>C (p.Lys11755Thr) rs189966800
NM_001267550.2(TTN):c.35875+8T>G rs192408585
NM_001267550.2(TTN):c.36126A>C (p.Glu12042Asp) rs113231696
NM_001267550.2(TTN):c.36203-9T>C rs2562849
NM_001267550.2(TTN):c.36285C>T (p.His12095=) rs201184203
NM_001267550.2(TTN):c.36299A>T (p.Glu12100Val) rs73973133
NM_001267550.2(TTN):c.36318A>G (p.Lys12106=) rs2115557
NM_001267550.2(TTN):c.36489G>A (p.Ala12163=) rs115493456
NM_001267550.2(TTN):c.36509A>T (p.Glu12170Val) rs200840285
NM_001267550.2(TTN):c.36625G>T (p.Val12209Leu) rs72650053
NM_001267550.2(TTN):c.36655T>G (p.Leu12219Val) rs12994774
NM_001267550.2(TTN):c.36676A>G (p.Lys12226Glu) rs200815663
NM_001267550.2(TTN):c.3668C>T (p.Ala1223Val) rs78269740
NM_001267550.2(TTN):c.37009C>T (p.Pro12337Ser) rs201474544
NM_001267550.2(TTN):c.37202-4T>C rs202032281
NM_001267550.2(TTN):c.37247C>T (p.Ser12416Leu) rs370765948
NM_001267550.2(TTN):c.37432C>T (p.Pro12478Ser) rs200992277
NM_001267550.2(TTN):c.37461A>T (p.Glu12487Asp) rs200021871
NM_001267550.2(TTN):c.37525G>A (p.Glu12509Lys) rs201797790
NM_001267550.2(TTN):c.37705G>A (p.Val12569Ile) rs568086259
NM_001267550.2(TTN):c.37722T>C (p.Val12574=) rs377422414
NM_001267550.2(TTN):c.38323C>T (p.Leu12775Phe) rs186232617
NM_001267550.2(TTN):c.38336T>C (p.Val12779Ala) rs2099130
NM_001267550.2(TTN):c.38378A>G (p.Lys12793Arg) rs189389531
NM_001267550.2(TTN):c.38753T>C (p.Leu12918Ser) rs2562847
NM_001267550.2(TTN):c.38880A>G (p.Pro12960=) rs2742354
NM_001267550.2(TTN):c.38929C>T (p.Pro12977Ser) rs150223722
NM_001267550.2(TTN):c.38955T>G (p.Val12985=) rs375699886
NM_001267550.2(TTN):c.39006G>T (p.Ser13002=) rs548745743
NM_001267550.2(TTN):c.39045G>C (p.Val13015=) rs192464868
NM_001267550.2(TTN):c.39082G>A (p.Val13028Met) rs73038314
NM_001267550.2(TTN):c.39085C>A (p.Pro13029Thr) rs397517553
NM_001267550.2(TTN):c.39183T>A (p.Pro13061=) rs12474306
NM_001267550.2(TTN):c.39616C>T (p.Pro13206Ser) rs186404793
NM_001267550.2(TTN):c.39690G>A (p.Ala13230=) rs528832388
NM_001267550.2(TTN):c.39704C>G (p.Pro13235Arg) rs72650066
NM_001267550.2(TTN):c.39731_39748TTGCTCCTGAAGAGGAAA[1] (p.13244_13249IAPEEE[1]) rs139512154
NM_001267550.2(TTN):c.40141+7G>A rs77960621
NM_001267550.2(TTN):c.40515G>A (p.Pro13505=) rs367958537
NM_001267550.2(TTN):c.41010T>C (p.Asp13670=) rs193191368
NM_001267550.2(TTN):c.41103C>T (p.Gly13701=) rs72650077
NM_001267550.2(TTN):c.41508T>C (p.Ala13836=) rs55847232
NM_001267550.2(TTN):c.41958A>G (p.Ala13986=) rs186699871
NM_001267550.2(TTN):c.42024+6T>C rs140002940
NM_001267550.2(TTN):c.42071A>G (p.His14024Arg) rs2288563
NM_001267550.2(TTN):c.42156C>T (p.Ile14052=) rs76815324
NM_001267550.2(TTN):c.42219C>T (p.Phe14073=) rs150612172
NM_001267550.2(TTN):c.426C>T (p.Ala142=) rs56137037
NM_001267550.2(TTN):c.42978C>T (p.Tyr14326=) rs369959066
NM_001267550.2(TTN):c.43488G>A (p.Arg14496=) rs56034831
NM_001267550.2(TTN):c.43596T>C (p.Asn14532=) rs16866423
NM_001267550.2(TTN):c.43603C>T (p.Arg14535Cys) rs12471771
NM_001267550.2(TTN):c.44529C>T (p.His14843=) rs55973744
NM_001267550.2(TTN):c.44548+9A>G rs372725070
NM_001267550.2(TTN):c.44784T>C (p.Asp14928=) rs186105748
NM_001267550.2(TTN):c.45053C>T (p.Ala15018Val) rs72677221
NM_001267550.2(TTN):c.45120T>G (p.Ile15040Met) rs74580375
NM_001267550.2(TTN):c.45174C>T (p.Gly15058=) rs372609980
NM_001267550.2(TTN):c.45175G>A (p.Ala15059Thr) rs144668626
NM_001267550.2(TTN):c.45206A>T (p.Glu15069Val) rs114331773
NM_001267550.2(TTN):c.45328G>A (p.Asp15110Asn) rs17354992
NM_001267550.2(TTN):c.45408G>T (p.Lys15136Asn) rs72677225
NM_001267550.2(TTN):c.45526C>T (p.Leu15176=) rs61004744
NM_001267550.2(TTN):c.45738T>C (p.Ala15246=) rs2303829
NM_001267550.2(TTN):c.46693G>T (p.Ala15565Ser) rs145520397
NM_001267550.2(TTN):c.46800A>G (p.Glu15600=) rs190058852
NM_001267550.2(TTN):c.46880C>T (p.Ala15627Val) rs115813214
NM_001267550.2(TTN):c.47191C>T (p.Arg15731Cys) rs72677231
NM_001267550.2(TTN):c.47271T>C (p.Asp15757=) rs76081119
NM_001267550.2(TTN):c.47315G>A (p.Arg15772Gln) rs72677233
NM_001267550.2(TTN):c.47379C>T (p.Tyr15793=) rs374281025
NM_001267550.2(TTN):c.47400G>A (p.Lys15800=) rs114145817
NM_001267550.2(TTN):c.47545C>A (p.Pro15849Thr) rs146181477
NM_001267550.2(TTN):c.47723G>A (p.Arg15908His) rs72677237
NM_001267550.2(TTN):c.47737C>T (p.Leu15913Phe) rs138576504
NM_001267550.2(TTN):c.47955A>G (p.Pro15985=) rs192953152
NM_001267550.2(TTN):c.48727C>T (p.Pro16243Ser) rs72677242
NM_001267550.2(TTN):c.48996G>A (p.Glu16332=) rs72677244
NM_001267550.2(TTN):c.49371A>T (p.Leu16457=) rs146163169
NM_001267550.2(TTN):c.49443A>C (p.Pro16481=) rs74321406
NM_001267550.2(TTN):c.49731T>C (p.His16577=) rs2115558
NM_001267550.2(TTN):c.49919G>C (p.Ser16640Thr) rs55663050
NM_001267550.2(TTN):c.49985A>C (p.Asn16662Thr) rs36043230
NM_001267550.2(TTN):c.49998T>C (p.Asn16666=) rs376917681
NM_001267550.2(TTN):c.50363T>C (p.Ile16788Thr) rs397517599
NM_001267550.2(TTN):c.50452G>A (p.Glu16818Lys) rs397517600
NM_001267550.2(TTN):c.51482C>T (p.Ala17161Val) rs16866412
NM_001267550.2(TTN):c.51684G>A (p.Ala17228=) rs2288566
NM_001267550.2(TTN):c.52110G>A (p.Pro17370=) rs139789997
NM_001267550.2(TTN):c.5231C>T (p.Pro1744Leu) rs75686037
NM_001267550.2(TTN):c.52406-12dup rs1553688916
NM_001267550.2(TTN):c.52821T>C (p.Asp17607=) rs2303831
NM_001267550.2(TTN):c.52917T>C (p.Asp17639=) rs73036398
NM_001267550.2(TTN):c.53123A>T (p.Lys17708Ile) rs2303832
NM_001267550.2(TTN):c.53192T>C (p.Ile17731Thr) rs72646809
NM_001267550.2(TTN):c.53260T>C (p.Phe17754Leu) rs397517612
NM_001267550.2(TTN):c.5388T>C (p.Asp1796=) rs72647878
NM_001267550.2(TTN):c.54105G>A (p.Ala18035=) rs371155050
NM_001267550.2(TTN):c.54148C>T (p.Arg18050Cys) rs55734111
NM_001267550.2(TTN):c.54189T>C (p.Tyr18063=) rs2303834
NM_001267550.2(TTN):c.54208A>C (p.Arg18070=) rs138240658
NM_001267550.2(TTN):c.542G>A (p.Ser181Asn) rs72647843
NM_001267550.2(TTN):c.54903C>G (p.Gly18301=) rs190830121
NM_001267550.2(TTN):c.54947C>G (p.Thr18316Ser) rs758527900
NM_001267550.2(TTN):c.55029G>A (p.Arg18343=) rs62178963
NM_001267550.2(TTN):c.55449C>T (p.Pro18483=) rs187366691
NM_001267550.2(TTN):c.55547T>C (p.Ile18516Thr) rs146608896
NM_001267550.2(TTN):c.55553A>G (p.Lys18518Arg) rs72646823
NM_001267550.2(TTN):c.55659G>A (p.Val18553=) rs368450420
NM_001267550.2(TTN):c.55925T>A (p.Leu18642Gln) rs140714512
NM_001267550.2(TTN):c.55929A>G (p.Gln18643=) rs151335428
NM_001267550.2(TTN):c.561G>A (p.Ser187=) rs141444282
NM_001267550.2(TTN):c.56529G>A (p.Thr18843=) rs72646827
NM_001267550.2(TTN):c.56910C>T (p.Gly18970=) rs148299739
NM_001267550.2(TTN):c.56970T>C (p.Pro18990=) rs372019333
NM_001267550.2(TTN):c.5697C>T (p.Ile1899=) rs148434577
NM_001267550.2(TTN):c.57462G>A (p.Gln19154=) rs72646832
NM_001267550.2(TTN):c.57464G>A (p.Arg19155Lys) rs72646833
NM_001267550.2(TTN):c.57648C>T (p.Ile19216=) rs55956577
NM_001267550.2(TTN):c.57683G>A (p.Arg19228His) rs114711705
NM_001267550.2(TTN):c.57770G>A (p.Arg19257Gln) rs202076328
NM_001267550.2(TTN):c.58122C>G (p.Thr19374=) rs189818369
NM_001267550.2(TTN):c.58155C>A (p.Pro19385=) rs373587801
NM_001267550.2(TTN):c.5823A>G (p.Arg1941=) rs149668487
NM_001267550.2(TTN):c.58419A>G (p.Gln19473=) rs186563991
NM_001267550.2(TTN):c.58426G>A (p.Val19476Ile) rs397517636
NM_001267550.2(TTN):c.58612A>G (p.Thr19538Ala) rs200017524
NM_001267550.2(TTN):c.58636G>C (p.Glu19546Gln) rs201840554
NM_001267550.2(TTN):c.5875T>A (p.Phe1959Ile) rs562856820
NM_001267550.2(TTN):c.58869A>G (p.Lys19623=) rs191066933
NM_001267550.2(TTN):c.58933C>T (p.Leu19645=) rs2303836
NM_001267550.2(TTN):c.59165T>C (p.Val19722Ala) rs116592778
NM_001267550.2(TTN):c.59282A>G (p.Asn19761Ser) rs563969986
NM_001267550.2(TTN):c.59315C>T (p.Pro19772Leu) rs72646840
NM_001267550.2(TTN):c.59316G>A (p.Pro19772=) rs377180286
NM_001267550.2(TTN):c.59322A>G (p.Pro19774=) rs188063446
NM_001267550.2(TTN):c.59835C>T (p.Asn19945=) rs72646842
NM_001267550.2(TTN):c.5993G>A (p.Arg1998His) rs144135510
NM_001267550.2(TTN):c.59943C>A (p.Pro19981=) rs202017608
NM_001267550.2(TTN):c.60055G>A (p.Glu20019Lys) rs201487340
NM_001267550.2(TTN):c.60232G>A (p.Val20078Met) rs77351975
NM_001267550.2(TTN):c.6041C>T (p.Thr2014Ile) rs189149543
NM_001267550.2(TTN):c.60490G>C (p.Val20164Leu) rs72646843
NM_001267550.2(TTN):c.60821C>T (p.Pro20274Leu) rs72646845
NM_001267550.2(TTN):c.61029T>C (p.Phe20343=) rs6706088
NM_001267550.2(TTN):c.61100G>A (p.Arg20367Gln) rs141973925
NM_001267550.2(TTN):c.61224G>A (p.Val20408=) rs566188777
NM_001267550.2(TTN):c.61922G>A (p.Arg20641Gln) rs199895260
NM_001267550.2(TTN):c.62178T>C (p.Thr20726=) rs72646847
NM_001267550.2(TTN):c.63023C>T (p.Thr21008Ile) rs72646850
NM_001267550.2(TTN):c.63026G>A (p.Arg21009Gln) rs72646851
NM_001267550.2(TTN):c.63165G>A (p.Pro21055=) rs72646852
NM_001267550.2(TTN):c.6353T>C (p.Ile2118Thr) rs56404770
NM_001267550.2(TTN):c.63876C>T (p.Asn21292=) rs199598302
NM_001267550.2(TTN):c.63879C>T (p.Asp21293=) rs200463088
NM_001267550.2(TTN):c.63917G>A (p.Arg21306His) rs202240487
NM_001267550.2(TTN):c.64032C>T (p.Asn21344=) rs72646857
NM_001267550.2(TTN):c.64762G>A (p.Gly21588Arg) rs181717727
NM_001267550.2(TTN):c.64789G>A (p.Val21597Met) rs150661999
NM_001267550.2(TTN):c.65092C>T (p.Arg21698Cys) rs72646861
NM_001267550.2(TTN):c.65147C>T (p.Ser21716Leu) rs13021201
NM_001267550.2(TTN):c.65516C>T (p.Ala21839Val) rs55948748
NM_001267550.2(TTN):c.65604T>C (p.Ala21868=) rs200825430
NM_001267550.2(TTN):c.65743C>A (p.Gln21915Lys) rs62618736
NM_001267550.2(TTN):c.65775C>T (p.Ser21925=) rs72646867
NM_001267550.2(TTN):c.66576C>A (p.Leu22192=) rs187378247
NM_001267550.2(TTN):c.66614G>A (p.Arg22205Lys) rs72646869
NM_001267550.2(TTN):c.66702C>T (p.Ala22234=) rs371802557
NM_001267550.2(TTN):c.66977A>G (p.Lys22326Arg) rs202125813
NM_001267550.2(TTN):c.6727G>T (p.Asp2243Tyr) rs138787974
NM_001267550.2(TTN):c.67542T>G (p.Thr22514=) rs72646876
NM_001267550.2(TTN):c.67635T>C (p.Val22545=) rs2288570
NM_001267550.2(TTN):c.67809G>A (p.Ala22603=) rs548223512
NM_001267550.2(TTN):c.68079G>A (p.Thr22693=) rs11904444
NM_001267550.2(TTN):c.68082C>T (p.Cys22694=) rs79406408
NM_001267550.2(TTN):c.69130C>T (p.Pro23044Ser) rs55980498
NM_001267550.2(TTN):c.69145A>G (p.Ile23049Val) rs72646881
NM_001267550.2(TTN):c.69231T>C (p.Leu23077=) rs12615797
NM_001267550.2(TTN):c.69383C>A (p.Ser23128Tyr) rs72646882
NM_001267550.2(TTN):c.69585C>T (p.Ser23195=) rs67041405
NM_001267550.2(TTN):c.69676A>G (p.Ser23226Gly) rs72646885
NM_001267550.2(TTN):c.69740C>T (p.Pro23247Leu) rs115658240
NM_001267550.2(TTN):c.70131A>G (p.Thr23377=) rs369503828
NM_001267550.2(TTN):c.7061G>A (p.Arg2354His) rs75031300
NM_001267550.2(TTN):c.70677T>C (p.Asp23559=) rs72646890
NM_001267550.2(TTN):c.70696G>C (p.Gly23566Arg) rs55801134
NM_001267550.2(TTN):c.70761G>T (p.Gly23587=) rs190149868
NM_001267550.2(TTN):c.70815G>A (p.Val23605=) rs55847238
NM_001267550.2(TTN):c.70832C>T (p.Ala23611Val) rs72646891
NM_001267550.2(TTN):c.70907G>A (p.Arg23636His) rs56071233
NM_001267550.2(TTN):c.70952T>G (p.Ile23651Ser) rs149075285
NM_001267550.2(TTN):c.70998A>G (p.Thr23666=) rs767989384
NM_001267550.2(TTN):c.71369G>A (p.Arg23790His) rs55677134
NM_001267550.2(TTN):c.71940G>A (p.Leu23980=) rs72646893
NM_001267550.2(TTN):c.72033A>G (p.Pro24011=) rs72646894
NM_001267550.2(TTN):c.72105T>C (p.Phe24035=) rs397517691
NM_001267550.2(TTN):c.72113C>T (p.Thr24038Met) rs370375696
NM_001267550.2(TTN):c.72132T>C (p.Gly24044=) rs56169243
NM_001267550.2(TTN):c.72624A>G (p.Pro24208=) rs56293906
NM_001267550.2(TTN):c.72782G>A (p.Arg24261Gln) rs142874389
NM_001267550.2(TTN):c.72803G>A (p.Arg24268His) rs140018785
NM_001267550.2(TTN):c.72906T>A (p.Ala24302=) rs773886758
NM_001267550.2(TTN):c.72931A>G (p.Thr24311Ala) rs56201325
NM_001267550.2(TTN):c.73168A>G (p.Thr24390Ala) rs182491843
NM_001267550.2(TTN):c.73336C>T (p.Leu24446=) rs189768015
NM_001267550.2(TTN):c.73825G>C (p.Glu24609Gln) rs55762754
NM_001267550.2(TTN):c.74042A>G (p.Gln24681Arg) rs537071956
NM_001267550.2(TTN):c.74972T>C (p.Ile24991Thr) rs744427
NM_001267550.2(TTN):c.75034C>T (p.Arg25012Trp) rs368914555
NM_001267550.2(TTN):c.75192T>C (p.Thr25064=) rs370480927
NM_001267550.2(TTN):c.7530A>G (p.Ser2510=) rs189187431
NM_001267550.2(TTN):c.75441A>G (p.Lys25147=) rs56151652
NM_001267550.2(TTN):c.75738A>G (p.Glu25246=) rs371344165
NM_001267550.2(TTN):c.75745C>T (p.Arg25249Cys) rs397517702
NM_001267550.2(TTN):c.76113A>G (p.Glu25371=) rs140350441
NM_001267550.2(TTN):c.76343G>A (p.Ser25448Asn) rs3813243
NM_001267550.2(TTN):c.76720T>C (p.Tyr25574His) rs3813245
NM_001267550.2(TTN):c.76722T>C (p.Tyr25574=) rs55696153
NM_001267550.2(TTN):c.76739C>T (p.Thr25580Met) rs56372592
NM_001267550.2(TTN):c.76922G>A (p.Arg25641His) rs369707906
NM_001267550.2(TTN):c.77205G>A (p.Val25735=) rs55857909
NM_001267550.2(TTN):c.77279A>G (p.Asn25760Ser) rs3813246
NM_001267550.2(TTN):c.7740T>G (p.Ile2580Met) rs146590898
NM_001267550.2(TTN):c.77638A>G (p.Thr25880Ala) rs56018860
NM_001267550.2(TTN):c.78147A>G (p.Gln26049=) rs149127072
NM_001267550.2(TTN):c.78942T>C (p.Asp26314=) rs560223850
NM_001267550.2(TTN):c.79062T>A (p.Gly26354=) rs3731744
NM_001267550.2(TTN):c.79265T>C (p.Ile26422Thr) rs3731745
NM_001267550.2(TTN):c.79318C>T (p.Arg26440Cys) rs55861600
NM_001267550.2(TTN):c.79319G>A (p.Arg26440His) rs56044609
NM_001267550.2(TTN):c.79410G>A (p.Gly26470=) rs140942979
NM_001267550.2(TTN):c.79612A>G (p.Thr26538Ala) rs150682764
NM_001267550.2(TTN):c.79689C>A (p.Val26563=) rs10185798
NM_001267550.2(TTN):c.79783G>C (p.Asp26595His) rs56307213
NM_001267550.2(TTN):c.80115G>T (p.Glu26705Asp) rs558830502
NM_001267550.2(TTN):c.80271C>T (p.Val26757=) rs199875474
NM_001267550.2(TTN):c.80322C>T (p.Ala26774=) rs55892928
NM_001267550.2(TTN):c.80635C>A (p.Gln26879Lys) rs79926414
NM_001267550.2(TTN):c.80661C>T (p.Asn26887=) rs201069672
NM_001267550.2(TTN):c.8069C>T (p.Thr2690Ile) rs374620001
NM_001267550.2(TTN):c.80799C>A (p.Thr26933=) rs3813247
NM_001267550.2(TTN):c.80858C>T (p.Thr26953Met) rs377506142
NM_001267550.2(TTN):c.80859G>A (p.Thr26953=) rs771257647
NM_001267550.2(TTN):c.80944T>C (p.Phe26982Leu) rs200406978
NM_001267550.2(TTN):c.81057T>C (p.Thr27019=) rs114908705
NM_001267550.2(TTN):c.81539T>C (p.Ile27180Thr) rs182126530
NM_001267550.2(TTN):c.81558T>C (p.Asn27186=) rs56181243
NM_001267550.2(TTN):c.81855C>T (p.Ile27285=) rs56214710
NM_001267550.2(TTN):c.81938G>A (p.Gly27313Glu) rs199670463
NM_001267550.2(TTN):c.81958G>A (p.Ala27320Thr) rs56365600
NM_001267550.2(TTN):c.82081C>G (p.Pro27361Ala) rs56137800
NM_001267550.2(TTN):c.82103A>G (p.Asp27368Gly) rs145373396
NM_001267550.2(TTN):c.82385C>A (p.Thr27462Lys) rs55933739
NM_001267550.2(TTN):c.82489G>A (p.Gly27497Arg) rs201158906
NM_001267550.2(TTN):c.82497C>T (p.Thr27499=) rs199629314
NM_001267550.2(TTN):c.82560C>A (p.Asn27520Lys) rs56264840
NM_001267550.2(TTN):c.82575G>A (p.Thr27525=) rs11896779
NM_001267550.2(TTN):c.82740G>A (p.Thr27580=) rs56345408
NM_001267550.2(TTN):c.82797C>T (p.Gly27599=) rs72648216
NM_001267550.2(TTN):c.82798G>A (p.Ala27600Thr) rs11896637
NM_001267550.2(TTN):c.83056G>A (p.Val27686Ile) rs56309296
NM_001267550.2(TTN):c.83063G>A (p.Arg27688His) rs185002960
NM_001267550.2(TTN):c.83272T>C (p.Phe27758Leu) rs188323108
NM_001267550.2(TTN):c.83740A>G (p.Thr27914Ala) rs188370772
NM_001267550.2(TTN):c.84352C>T (p.Arg28118Cys) rs56057221
NM_001267550.2(TTN):c.84453A>G (p.Pro28151=) rs73036373
NM_001267550.2(TTN):c.84461C>T (p.Pro28154Leu) rs200350579
NM_001267550.2(TTN):c.8467G>T (p.Val2823Phe) rs33917087
NM_001267550.2(TTN):c.84893G>A (p.Arg28298Gln) rs187270666
NM_001267550.2(TTN):c.85248A>T (p.Thr28416=) rs187180708
NM_001267550.2(TTN):c.85406C>G (p.Ser28469Cys) rs202040332
NM_001267550.2(TTN):c.85691A>T (p.Lys28564Ile) rs199859344
NM_001267550.2(TTN):c.86052T>C (p.Thr28684=) rs76928874
NM_001267550.2(TTN):c.86301G>A (p.Lys28767=) rs56310931
NM_001267550.2(TTN):c.86658G>A (p.Glu28886=) rs760858743
NM_001267550.2(TTN):c.86683G>A (p.Val28895Met) rs201290358
NM_001267550.2(TTN):c.86811A>G (p.Val28937=) rs55972010
NM_001267550.2(TTN):c.87087T>C (p.Leu29029=) rs12621078
NM_001267550.2(TTN):c.87669T>C (p.His29223=) rs72648229
NM_001267550.2(TTN):c.87808G>A (p.Val29270Ile) rs141624266
NM_001267550.2(TTN):c.87877C>T (p.Arg29293Cys) rs191482653
NM_001267550.2(TTN):c.88297G>A (p.Asp29433Asn) rs189202799
NM_001267550.2(TTN):c.88394C>T (p.Ser29465Phe) rs146181116
NM_001267550.2(TTN):c.88476C>G (p.Thr29492=) rs190406444
NM_001267550.2(TTN):c.88485C>T (p.Leu29495=) rs371612136
NM_001267550.2(TTN):c.88510G>A (p.Asp29504Asn) rs376679796
NM_001267550.2(TTN):c.88611T>G (p.Pro29537=) rs555380931
NM_001267550.2(TTN):c.88708A>G (p.Ile29570Val) rs139506970
NM_001267550.2(TTN):c.88858C>T (p.Leu29620=) rs115070904
NM_001267550.2(TTN):c.89317A>T (p.Ile29773Leu) rs77853750
NM_001267550.2(TTN):c.89386G>A (p.Val29796Met) rs72648237
NM_001267550.2(TTN):c.89989T>A (p.Leu29997Met) rs369855092
NM_001267550.2(TTN):c.89994G>A (p.Ser29998=) rs142891278
NM_001267550.2(TTN):c.90536G>A (p.Arg30179His) rs149567378
NM_001267550.2(TTN):c.90638T>C (p.Ile30213Thr) rs114026724
NM_001267550.2(TTN):c.9077A>T (p.Asn3026Ile) rs11900987
NM_001267550.2(TTN):c.90826T>G (p.Cys30276Gly) rs150430592
NM_001267550.2(TTN):c.90968G>A (p.Arg30323Lys) rs11887722
NM_001267550.2(TTN):c.91347T>C (p.Asp30449=) rs193022702
NM_001267550.2(TTN):c.9150A>G (p.Thr3050=) rs72647886
NM_001267550.2(TTN):c.91557T>C (p.Asp30519=) rs202185465
NM_001267550.2(TTN):c.91573A>G (p.Ile30525Val) rs72648244
NM_001267550.2(TTN):c.91643C>T (p.Ala30548Val) rs553668520
NM_001267550.2(TTN):c.91765G>A (p.Ala30589Thr) rs148617456
NM_001267550.2(TTN):c.91884A>T (p.Arg30628Ser) rs144922355
NM_001267550.2(TTN):c.91937A>G (p.Asn30646Ser) rs72648245
NM_001267550.2(TTN):c.92009T>C (p.Ile30670Thr) rs369342933
NM_001267550.2(TTN):c.92176C>T (p.Pro30726Ser) rs72648247
NM_001267550.2(TTN):c.92191A>G (p.Ile30731Val) rs16866391
NM_001267550.2(TTN):c.92537T>C (p.Val30846Ala) rs77968867
NM_001267550.2(TTN):c.92715C>T (p.Gly30905=) rs140576051
NM_001267550.2(TTN):c.92780T>A (p.Ile30927Lys) rs531432790
NM_001267550.2(TTN):c.92901C>T (p.Ser30967=) rs11694623
NM_001267550.2(TTN):c.93387C>T (p.Ser31129=) rs35445420
NM_001267550.2(TTN):c.9338G>A (p.Arg3113His) rs141258018
NM_001267550.2(TTN):c.93444C>T (p.Tyr31148=) rs561739832
NM_001267550.2(TTN):c.9359G>A (p.Arg3120Gln) rs72647894
NM_001267550.2(TTN):c.93900C>T (p.Ser31300=) rs200173934
NM_001267550.2(TTN):c.93901G>A (p.Val31301Ile) rs67665715
NM_001267550.2(TTN):c.94016C>T (p.Thr31339Ile) rs184078016
NM_001267550.2(TTN):c.94046G>A (p.Arg31349His) rs181104321
NM_001267550.2(TTN):c.94348C>T (p.Arg31450Cys) rs541040798
NM_001267550.2(TTN):c.94846C>T (p.Leu31616=) rs72648255
NM_001267550.2(TTN):c.94851T>A (p.Asp31617Glu) rs72648256
NM_001267550.2(TTN):c.94863C>T (p.His31621=) rs373871146
NM_001267550.2(TTN):c.95035G>A (p.Asp31679Asn) rs116567963
NM_001267550.2(TTN):c.95047A>G (p.Ser31683Gly) rs72648257
NM_001267550.2(TTN):c.95148C>T (p.Thr31716=) rs140663434
NM_001267550.2(TTN):c.9519C>T (p.Asp3173=) rs151129843
NM_001267550.2(TTN):c.95205C>T (p.Asp31735=) rs373182578
NM_001267550.2(TTN):c.95244C>T (p.Arg31748=) rs368243641
NM_001267550.2(TTN):c.95259C>T (p.Leu31753=) rs72648258
NM_001267550.2(TTN):c.95297C>T (p.Ser31766Phe) rs191484894
NM_001267550.2(TTN):c.95406A>G (p.Arg31802=) rs199652273
NM_001267550.2(TTN):c.95553C>T (p.Ser31851=) rs72648260
NM_001267550.2(TTN):c.95555T>C (p.Leu31852Pro) rs62621206
NM_001267550.2(TTN):c.96015C>T (p.Pro32005=) rs183620684
NM_001267550.2(TTN):c.96108G>A (p.Val32036=) rs372773283
NM_001267550.2(TTN):c.96180T>C (p.Ile32060=) rs572401798
NM_001267550.2(TTN):c.96501T>C (p.Ser32167=) rs139223781
NM_001267550.2(TTN):c.96918C>T (p.Ile32306=) rs72648266
NM_001267550.2(TTN):c.96944C>T (p.Thr32315Ile) rs56027402
NM_001267550.2(TTN):c.970C>T (p.Pro324Ser) rs72647845
NM_001267550.2(TTN):c.97257T>C (p.Ile32419=) rs373206096
NM_001267550.2(TTN):c.97464T>C (p.Ser32488=) rs571147766
NM_001267550.2(TTN):c.97490T>C (p.Ile32497Thr) rs55660660
NM_001267550.2(TTN):c.97760G>A (p.Arg32587His) rs55704830
NM_001267550.2(TTN):c.97760G>C (p.Arg32587Pro) rs55704830
NM_001267550.2(TTN):c.98164A>T (p.Ile32722Phe) rs72648270
NM_001267550.2(TTN):c.98242C>T (p.Arg32748Cys) rs72648272
NM_001267550.2(TTN):c.98267C>T (p.Thr32756Ile) rs199805060
NM_001267550.2(TTN):c.98390A>G (p.Asn32797Ser) rs149001703
NM_001267550.2(TTN):c.98439G>A (p.Val32813=) rs368487246
NM_001267550.2(TTN):c.98499C>T (p.Leu32833=) rs138968178
NM_001267550.2(TTN):c.98595A>G (p.Glu32865=) rs55977045
NM_001267550.2(TTN):c.98683+7G>C rs141150066
NM_001267550.2(TTN):c.98721C>A (p.Leu32907=) rs375361462
NM_001267550.2(TTN):c.99031T>A (p.Ser33011Thr) rs78814506
NM_001267550.2(TTN):c.99111T>C (p.Tyr33037=) rs77257306
NM_001267550.2(TTN):c.99345T>G (p.Gly33115=) rs56398525
NM_001267550.2(TTN):c.99810C>T (p.Val33270=) rs564536939
NM_001267550.2(TTN):c.99830G>A (p.Gly33277Glu) rs397517781
NM_003319.4(TTN):c.19502-5A>G rs182706301
NM_133378.4(TTN):c.13451-7C>T rs371785683
NM_133378.4(TTN):c.14009-9A>G rs72648944
NM_133378.4(TTN):c.26492-8T>G rs72650010
NM_133378.4(TTN):c.28990+9G>A rs148231130
NM_133378.4(TTN):c.29608+10T>C rs72650039
NM_133378.4(TTN):c.31825+10A>C rs397517554
NM_133378.4(TTN):c.32930-9A>G rs373511249
NM_133378.4(TTN):c.37379-10A>G rs72677222
NM_133378.4(TTN):c.40756+8C>T rs2288565
NM_133378.4(TTN):c.62012-5C>G rs72646886
NM_133378.4(TTN):c.80003-4G>T rs201770959
NM_133378.4(TTN):c.84148+8T>A rs56145100
NM_133378.4(TTN):c.93062-10T>C rs202214630
NM_133379.5(TTN):c.10114+5G>A rs115985443
NM_133379.5(TTN):c.12067G>A (p.Gly4023Arg) rs143253411
NM_133379.5(TTN):c.1398+8C>T rs72647848
NM_133379.5(TTN):c.14492G>A (p.Cys4831Tyr) rs150615457
NM_133379.5(TTN):c.1537-4G>A rs56006378
NM_133379.5(TTN):c.1938+10G>C rs190935632

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.