ClinVar Miner

List of variants in gene TTN reported as uncertain significance for not specified

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 2170
Download table as spreadsheet
HGVS dbSNP
NM_001256850.1(TTN):c.22427-10C>A rs72648975
NM_001256850.1(TTN):c.28091-2A>C rs6716782
NM_001256850.1(TTN):c.29560+3G>A rs563582627
NM_001256850.1(TTN):c.32876-8C>T rs371318311
NM_001256850.1(TTN):c.34690+6C>T rs187365142
NM_001256850.1(TTN):c.39359-6G>A rs372166634
NM_001256850.1(TTN):c.43537+5G>A rs374413644
NM_001256850.1(TTN):c.48364+6G>A rs149890360
NM_001256850.1(TTN):c.91981+4T>C rs373514079
NM_001267550.1(TTN):c.45599C>G rs201057307
NM_001267550.1(TTN):c.46387G>A rs200042932
NM_001267550.1(TTN):c.83315A>T rs578191491
NM_001267550.2(TTN):c.10012C>G (p.Gln3338Glu) rs771798473
NM_001267550.2(TTN):c.100226G>A (p.Cys33409Tyr) rs201112096
NM_001267550.2(TTN):c.100267A>G (p.Lys33423Glu) rs376528148
NM_001267550.2(TTN):c.100397G>A (p.Arg33466His) rs189626540
NM_001267550.2(TTN):c.100400T>G (p.Val33467Gly) rs200166942
NM_001267550.2(TTN):c.100417G>A (p.Gly33473Ser) rs397517783
NM_001267550.2(TTN):c.100429G>C (p.Glu33477Gln) rs794729556
NM_001267550.2(TTN):c.100432T>G (p.Trp33478Gly) rs372304158
NM_001267550.2(TTN):c.100447G>C (p.Glu33483Gln) rs368321767
NM_001267550.2(TTN):c.10045A>G (p.Thr3349Ala) rs777960129
NM_001267550.2(TTN):c.100466C>T (p.Ser33489Phe) rs794729557
NM_001267550.2(TTN):c.10046C>T (p.Thr3349Ile) rs727503678
NM_001267550.2(TTN):c.100534A>T (p.Asn33512Tyr) rs778965506
NM_001267550.2(TTN):c.100562G>A (p.Gly33521Asp) rs370516977
NM_001267550.2(TTN):c.100568C>A (p.Pro33523Gln) rs794729558
NM_001267550.2(TTN):c.100582A>G (p.Lys33528Glu) rs794729559
NM_001267550.2(TTN):c.10067C>T (p.Thr3356Ile) rs763323132
NM_001267550.2(TTN):c.100829G>A (p.Gly33610Asp) rs373754986
NM_001267550.2(TTN):c.100859G>C (p.Ser33620Thr) rs369261182
NM_001267550.2(TTN):c.100980G>C (p.Glu33660Asp) rs727503536
NM_001267550.2(TTN):c.101159A>G (p.Lys33720Arg) rs727503535
NM_001267550.2(TTN):c.101213G>A (p.Arg33738His) rs192391568
NM_001267550.2(TTN):c.101250C>G (p.Ile33750Met) rs397517784
NM_001267550.2(TTN):c.101281C>T (p.Arg33761Trp) rs201421156
NM_001267550.2(TTN):c.101369T>A (p.Met33790Lys) rs876658097
NM_001267550.2(TTN):c.101378A>T (p.Asp33793Val) rs200675195
NM_001267550.2(TTN):c.101506T>A (p.Cys33836Ser) rs766439271
NM_001267550.2(TTN):c.101557A>G (p.Lys33853Glu) rs727505163
NM_001267550.2(TTN):c.101613G>A (p.Arg33871=) rs797046068
NM_001267550.2(TTN):c.101696A>G (p.Asp33899Gly) rs794729560
NM_001267550.2(TTN):c.101754T>G (p.Ser33918Arg) rs952080555
NM_001267550.2(TTN):c.101821A>T (p.Arg33941Ter) rs878854388
NM_001267550.2(TTN):c.101822G>C (p.Arg33941Thr) rs762498249
NM_001267550.2(TTN):c.10182A>G (p.Gln3394=) rs797046059
NM_001267550.2(TTN):c.101890C>A (p.Arg33964Ser) rs779064623
NM_001267550.2(TTN):c.101908G>A (p.Asp33970Asn) rs749832500
NM_001267550.2(TTN):c.102011T>A (p.Leu34004Gln) rs727504897
NM_001267550.2(TTN):c.102028A>C (p.Ser34010Arg) rs727503534
NM_001267550.2(TTN):c.10204G>A (p.Glu3402Lys) rs766262957
NM_001267550.2(TTN):c.102190G>A (p.Ala34064Thr) rs200237973
NM_001267550.2(TTN):c.102271C>T (p.Arg34091Trp) rs140319117
NM_001267550.2(TTN):c.102339T>G (p.Cys34113Trp) rs794729561
NM_001267550.2(TTN):c.102394T>C (p.Ser34132Pro) rs876658098
NM_001267550.2(TTN):c.102428T>C (p.Met34143Thr) rs397517786
NM_001267550.2(TTN):c.102520G>A (p.Val34174Ile) rs200430493
NM_001267550.2(TTN):c.102524G>A (p.Arg34175Gln) rs201954720
NM_001267550.2(TTN):c.102638A>G (p.Asn34213Ser) rs375332499
NM_001267550.2(TTN):c.102737G>A (p.Arg34246His) rs372716177
NM_001267550.2(TTN):c.102751A>G (p.Met34251Val) rs56173891
NM_001267550.2(TTN):c.102761T>C (p.Leu34254Pro) rs556155561
NM_001267550.2(TTN):c.102811G>A (p.Val34271Ile) rs794727542
NM_001267550.2(TTN):c.102814G>C (p.Gly34272Arg) rs794729562
NM_001267550.2(TTN):c.102853C>G (p.Pro34285Ala) rs794729563
NM_001267550.2(TTN):c.102877A>G (p.Lys34293Glu) rs72629783
NM_001267550.2(TTN):c.103131C>T (p.Gly34377=) rs797046069
NM_001267550.2(TTN):c.103292C>T (p.Thr34431Met) rs192001910
NM_001267550.2(TTN):c.103430T>C (p.Ile34477Thr) rs751914956
NM_001267550.2(TTN):c.103434C>A (p.Asp34478Glu) rs376371272
NM_001267550.2(TTN):c.103471G>C (p.Glu34491Gln) rs556218739
NM_001267550.2(TTN):c.103514A>T (p.Glu34505Val) rs761105256
NM_001267550.2(TTN):c.103658T>C (p.Ile34553Thr) rs727505196
NM_001267550.2(TTN):c.103679A>G (p.Lys34560Arg) rs544590023
NM_001267550.2(TTN):c.103688T>C (p.Val34563Ala) rs55945684
NM_001267550.2(TTN):c.103730A>G (p.Gln34577Arg) rs727505009
NM_001267550.2(TTN):c.103804C>G (p.Gln34602Glu) rs727505242
NM_001267550.2(TTN):c.103859G>A (p.Arg34620His) rs367927066
NM_001267550.2(TTN):c.103909C>T (p.Arg34637Trp) rs200716930
NM_001267550.2(TTN):c.103910G>A (p.Arg34637Gln) rs199642423
NM_001267550.2(TTN):c.103912C>T (p.Arg34638Cys) rs374444254
NM_001267550.2(TTN):c.103913G>A (p.Arg34638His) rs371528685
NM_001267550.2(TTN):c.103924_103926del (p.Pro34642del) rs771366227
NM_001267550.2(TTN):c.103946G>A (p.Arg34649Gln) rs397517788
NM_001267550.2(TTN):c.104000T>C (p.Ile34667Thr) rs727504476
NM_001267550.2(TTN):c.104047C>G (p.Leu34683Val) rs775454484
NM_001267550.2(TTN):c.104168G>T (p.Arg34723Ile) rs794729564
NM_001267550.2(TTN):c.104179A>G (p.Arg34727Gly) rs555555534
NM_001267550.2(TTN):c.104192A>G (p.Tyr34731Cys) rs397517789
NM_001267550.2(TTN):c.104222C>T (p.Thr34741Ile) rs727505306
NM_001267550.2(TTN):c.104251G>C (p.Ala34751Pro) rs185683410
NM_001267550.2(TTN):c.104261C>T (p.Ala34754Val) rs727505020
NM_001267550.2(TTN):c.104353G>C (p.Glu34785Gln) rs772532135
NM_001267550.2(TTN):c.104414G>T (p.Arg34805Leu) rs115150240
NM_001267550.2(TTN):c.104474C>A (p.Ala34825Asp) rs766157074
NM_001267550.2(TTN):c.104519G>A (p.Arg34840Gln) rs199710082
NM_001267550.2(TTN):c.104522G>A (p.Arg34841His) rs373709706
NM_001267550.2(TTN):c.104539T>C (p.Tyr34847His) rs794729565
NM_001267550.2(TTN):c.104619_104621AAG[1] (p.Arg34875del) rs1553487597
NM_001267550.2(TTN):c.104796T>G (p.Ser34932Arg) rs794729566
NM_001267550.2(TTN):c.104845C>T (p.Arg34949Cys) rs576270358
NM_001267550.2(TTN):c.104914G>A (p.Glu34972Lys) rs727504918
NM_001267550.2(TTN):c.104950del (p.Glu34984fs) rs727503533
NM_001267550.2(TTN):c.104952A>C (p.Glu34984Asp) rs1434654451
NM_001267550.2(TTN):c.104953A>G (p.Ser34985Gly) rs765030518
NM_001267550.2(TTN):c.104993C>A (p.Thr34998Asn) rs397517794
NM_001267550.2(TTN):c.1049A>G (p.Tyr350Cys) rs563369722
NM_001267550.2(TTN):c.105049A>G (p.Thr35017Ala) rs368779151
NM_001267550.2(TTN):c.105064G>A (p.Glu35022Lys) rs727504977
NM_001267550.2(TTN):c.105086T>G (p.Leu35029Trp) rs763437247
NM_001267550.2(TTN):c.105103G>T (p.Asp35035Tyr) rs794729567
NM_001267550.2(TTN):c.105128G>A (p.Arg35043His) rs370137295
NM_001267550.2(TTN):c.105136G>A (p.Glu35046Lys) rs540500017
NM_001267550.2(TTN):c.10523C>T (p.Thr3508Ile) rs397517823
NM_001267550.2(TTN):c.105260C>T (p.Thr35087Met) rs397517795
NM_001267550.2(TTN):c.105304G>A (p.Ala35102Thr) rs794729568
NM_001267550.2(TTN):c.105391A>G (p.Ile35131Val) rs779464128
NM_001267550.2(TTN):c.105416C>T (p.Thr35139Ile) rs200782068
NM_001267550.2(TTN):c.105430G>A (p.Glu35144Lys) rs568472002
NM_001267550.2(TTN):c.105466C>G (p.Pro35156Ala) rs876658100
NM_001267550.2(TTN):c.105490C>T (p.Arg35164Cys) rs200123047
NM_001267550.2(TTN):c.105491G>A (p.Arg35164His) rs768358201
NM_001267550.2(TTN):c.105512C>T (p.Thr35171Ile) rs774524898
NM_001267550.2(TTN):c.105521G>A (p.Arg35174His) rs756575734
NM_001267550.2(TTN):c.105562A>C (p.Ile35188Leu) rs727504491
NM_001267550.2(TTN):c.105590G>A (p.Gly35197Asp) rs397517796
NM_001267550.2(TTN):c.105601G>A (p.Val35201Met) rs397517797
NM_001267550.2(TTN):c.105625A>C (p.Lys35209Gln) rs56365812
NM_001267550.2(TTN):c.105630A>C (p.Gln35210His) rs397517798
NM_001267550.2(TTN):c.10564G>A (p.Ala3522Thr) rs794729587
NM_001267550.2(TTN):c.105755G>A (p.Arg35252Gln) rs368151146
NM_001267550.2(TTN):c.10577T>C (p.Ile3526Thr) rs727503677
NM_001267550.2(TTN):c.105818C>A (p.Pro35273Gln) rs1553484561
NM_001267550.2(TTN):c.105821C>T (p.Thr35274Ile) rs2857271
NM_001267550.2(TTN):c.105940G>A (p.Ala35314Thr) rs377171054
NM_001267550.2(TTN):c.106100C>T (p.Thr35367Met) rs377056111
NM_001267550.2(TTN):c.106121T>A (p.Phe35374Tyr) rs727504609
NM_001267550.2(TTN):c.106133C>G (p.Ala35378Gly) rs555476312
NM_001267550.2(TTN):c.106267G>T (p.Val35423Phe) rs763752622
NM_001267550.2(TTN):c.106445C>G (p.Thr35482Ser) rs397517799
NM_001267550.2(TTN):c.106468T>C (p.Tyr35490His) rs199663911
NM_001267550.2(TTN):c.106580A>T (p.Glu35527Val) rs55725279
NM_001267550.2(TTN):c.10658C>T (p.Thr3553Ile) rs770418018
NM_001267550.2(TTN):c.106668A>C (p.Lys35556Asn) rs763925635
NM_001267550.2(TTN):c.106675G>C (p.Glu35559Gln) rs199632397
NM_001267550.2(TTN):c.1066G>C (p.Glu356Gln) rs144531477
NM_001267550.2(TTN):c.106736C>T (p.Ser35579Leu) rs727504462
NM_001267550.2(TTN):c.10679-10G>C rs397517832
NM_001267550.2(TTN):c.106820C>T (p.Ala35607Val) rs377337528
NM_001267550.2(TTN):c.106827T>G (p.Ile35609Met) rs727504540
NM_001267550.2(TTN):c.10682A>G (p.Gln3561Arg) rs727503676
NM_001267550.2(TTN):c.106837T>G (p.Ser35613Ala) rs374405802
NM_001267550.2(TTN):c.106876T>G (p.Leu35626Val) rs373152640
NM_001267550.2(TTN):c.106927G>A (p.Val35643Ile) rs754459138
NM_001267550.2(TTN):c.106955G>A (p.Arg35652Gln) rs200497615
NM_001267550.2(TTN):c.106994A>G (p.Lys35665Arg) rs746841189
NM_001267550.2(TTN):c.107009G>C (p.Arg35670Thr) rs534961012
NM_001267550.2(TTN):c.107105C>T (p.Pro35702Leu) rs772957495
NM_001267550.2(TTN):c.107134A>C (p.Asn35712His) rs727504949
NM_001267550.2(TTN):c.107147del (p.Gly35716fs) rs876658101
NM_001267550.2(TTN):c.107200G>A (p.Glu35734Lys) rs374992991
NM_001267550.2(TTN):c.107223+1G>A rs876658102
NM_001267550.2(TTN):c.107230A>G (p.Ile35744Val) rs142336788
NM_001267550.2(TTN):c.107285G>A (p.Arg35762Gln) rs397517800
NM_001267550.2(TTN):c.107339G>A (p.Arg35780His) rs770904787
NM_001267550.2(TTN):c.107357C>T (p.Thr35786Ile) rs749086389
NM_001267550.2(TTN):c.107517T>G (p.Ser35839Arg) rs776981475
NM_001267550.2(TTN):c.107552T>C (p.Met35851Thr) rs1310904463
NM_001267550.2(TTN):c.107635C>T (p.Gln35879Ter) rs757082154
NM_001267550.2(TTN):c.107671G>A (p.Gly35891Ser) rs201298767
NM_001267550.2(TTN):c.107728G>A (p.Glu35910Lys) rs370649675
NM_001267550.2(TTN):c.107753G>A (p.Cys35918Tyr) rs193212275
NM_001267550.2(TTN):c.107773A>G (p.Thr35925Ala) rs781497669
NM_001267550.2(TTN):c.107858T>G (p.Leu35953Arg) rs794729572
NM_001267550.2(TTN):c.107897G>A (p.Gly35966Asp) rs727505008
NM_001267550.2(TTN):c.10844G>A (p.Ser3615Asn) rs794729588
NM_001267550.2(TTN):c.10922T>C (p.Ile3641Thr) rs141027782
NM_001267550.2(TTN):c.11008A>C (p.Thr3670Pro) rs794729589
NM_001267550.2(TTN):c.11117T>C (p.Leu3706Pro) rs748468365
NM_001267550.2(TTN):c.11140A>G (p.Ile3714Val) rs397517833
NM_001267550.2(TTN):c.11311+1177G>C rs727503675
NM_001267550.2(TTN):c.11311+1283C>A rs189445085
NM_001267550.2(TTN):c.11311+1283C>T rs189445085
NM_001267550.2(TTN):c.11311+1349G>A rs141926114
NM_001267550.2(TTN):c.11311+1357C>T rs373311410
NM_001267550.2(TTN):c.11311+1369C>T rs201047740
NM_001267550.2(TTN):c.11311+1370G>A rs148115514
NM_001267550.2(TTN):c.11311+1408T>G rs727503673
NM_001267550.2(TTN):c.11311+1561G>A rs144967245
NM_001267550.2(TTN):c.11311+1604G>C rs727503674
NM_001267550.2(TTN):c.11311+1790del rs727503671
NM_001267550.2(TTN):c.11311+1799G>C rs147314430
NM_001267550.2(TTN):c.11311+1892C>T rs397517803
NM_001267550.2(TTN):c.11311+1903A>G rs142723709
NM_001267550.2(TTN):c.11311+1949del rs727503670
NM_001267550.2(TTN):c.11311+1978T>A rs144209883
NM_001267550.2(TTN):c.11311+2002T>C rs377740664
NM_001267550.2(TTN):c.11311+2007G>C rs200816462
NM_001267550.2(TTN):c.11311+2236C>T rs756000739
NM_001267550.2(TTN):c.11311+2362A>G rs542259495
NM_001267550.2(TTN):c.11311+2373T>G rs148581002
NM_001267550.2(TTN):c.11311+2377A>C rs794729590
NM_001267550.2(TTN):c.11311+2481C>A rs369074426
NM_001267550.2(TTN):c.11311+2481C>G rs369074426
NM_001267550.2(TTN):c.11311+2533A>C rs562658562
NM_001267550.2(TTN):c.11311+2539C>T rs372301168
NM_001267550.2(TTN):c.11311+2545C>T rs397517804
NM_001267550.2(TTN):c.11311+2680C>T rs200935937
NM_001267550.2(TTN):c.11311+2774T>C rs794729591
NM_001267550.2(TTN):c.11311+2833C>T rs761974222
NM_001267550.2(TTN):c.11311+2950G>A rs144690298
NM_001267550.2(TTN):c.11311+3056C>T rs370317019
NM_001267550.2(TTN):c.11311+3061A>G rs794729592
NM_001267550.2(TTN):c.11311+3133G>C rs727504522
NM_001267550.2(TTN):c.11311+3208C>T rs727504521
NM_001267550.2(TTN):c.11311+3226G>A rs1367949983
NM_001267550.2(TTN):c.11311+3248C>A rs72647899
NM_001267550.2(TTN):c.11311+3260A>C rs568690706
NM_001267550.2(TTN):c.11311+3274G>T rs145460295
NM_001267550.2(TTN):c.11311+3377T>C rs397517805
NM_001267550.2(TTN):c.11311+3378T>G rs727503668
NM_001267550.2(TTN):c.11311+3440C>T rs72647901
NM_001267550.2(TTN):c.11311+3611C>T rs727504927
NM_001267550.2(TTN):c.11311+3670G>A rs727503667
NM_001267550.2(TTN):c.11311+3703A>G rs144226338
NM_001267550.2(TTN):c.11311+3716dup rs397517806
NM_001267550.2(TTN):c.11311+3737A>G rs140583865
NM_001267550.2(TTN):c.11311+3769C>A rs140064945
NM_001267550.2(TTN):c.11311+3799G>A rs876658103
NM_001267550.2(TTN):c.11311+3827A>G rs145803192
NM_001267550.2(TTN):c.11311+3847G>T rs72647902
NM_001267550.2(TTN):c.11311+3877G>T rs374639358
NM_001267550.2(TTN):c.11311+3928C>T rs370602665
NM_001267550.2(TTN):c.11311+3934A>G rs397517807
NM_001267550.2(TTN):c.11311+3976T>A rs876658104
NM_001267550.2(TTN):c.11311+4013G>A rs794729593
NM_001267550.2(TTN):c.11311+4019A>G rs397517808
NM_001267550.2(TTN):c.11311+4088A>G rs142304137
NM_001267550.2(TTN):c.11311+4154C>T rs151307968
NM_001267550.2(TTN):c.11311+4168A>G rs149169686
NM_001267550.2(TTN):c.11311+4199A>G rs794729594
NM_001267550.2(TTN):c.11311+4244T>C rs369419838
NM_001267550.2(TTN):c.11311+4310C>G rs138927584
NM_001267550.2(TTN):c.11311+4313T>G rs200066725
NM_001267550.2(TTN):c.11311+4346A>G rs147073497
NM_001267550.2(TTN):c.11311+4516C>T rs145996491
NM_001267550.2(TTN):c.11311+4523A>C rs200760091
NM_001267550.2(TTN):c.11311+4538T>C rs397517810
NM_001267550.2(TTN):c.11311+4612C>G rs139103966
NM_001267550.2(TTN):c.11311+4675A>G rs190193836
NM_001267550.2(TTN):c.11311+4708A>G rs374783099
NM_001267550.2(TTN):c.11311+4732G>A rs794729595
NM_001267550.2(TTN):c.11311+4750A>G rs397517811
NM_001267550.2(TTN):c.11311+4838G>A rs144127396
NM_001267550.2(TTN):c.11311+4846C>G rs372982398
NM_001267550.2(TTN):c.11311+4964A>T rs149586047
NM_001267550.2(TTN):c.11311+4982G>T rs397517812
NM_001267550.2(TTN):c.11311+5019T>G rs140366460
NM_001267550.2(TTN):c.11311+5051T>C rs142132973
NM_001267550.2(TTN):c.11311+5174A>C rs769450043
NM_001267550.2(TTN):c.11311+5250T>A rs776361113
NM_001267550.2(TTN):c.11311+5276T>C rs143310631
NM_001267550.2(TTN):c.11311+5339C>G rs876658105
NM_001267550.2(TTN):c.11311+5380A>G rs753546575
NM_001267550.2(TTN):c.11311+5491A>G rs773571719
NM_001267550.2(TTN):c.11311+5530A>T rs72648909
NM_001267550.2(TTN):c.11311+5536A>G rs145581345
NM_001267550.2(TTN):c.11312-3866G>A rs145932311
NM_001267550.2(TTN):c.11312-3963G>T rs148430495
NM_001267550.2(TTN):c.11312-4008A>C rs191751905
NM_001267550.2(TTN):c.11312-4043T>G rs142371552
NM_001267550.2(TTN):c.11312-4085G>A rs148147002
NM_001267550.2(TTN):c.11312-4086C>T rs794729599
NM_001267550.2(TTN):c.11312-4092_11312-4089del rs397517822
NM_001267550.2(TTN):c.11312-4095G>A rs876658106
NM_001267550.2(TTN):c.11312-4115C>T rs749371657
NM_001267550.2(TTN):c.11312-4126C>G rs397517821
NM_001267550.2(TTN):c.11312-4151T>C rs145183384
NM_001267550.2(TTN):c.11312-4193T>C rs753909665
NM_001267550.2(TTN):c.11312-4215C>G rs397517820
NM_001267550.2(TTN):c.11312-4305C>A rs397517818
NM_001267550.2(TTN):c.11312-4319G>A rs72648913
NM_001267550.2(TTN):c.11312-4381C>A rs764383815
NM_001267550.2(TTN):c.11312-4404A>G rs372044281
NM_001267550.2(TTN):c.11312-4463A>G rs372997814
NM_001267550.2(TTN):c.11312-4478C>T rs151253841
NM_001267550.2(TTN):c.11312-4518G>A rs397517817
NM_001267550.2(TTN):c.11312-4523A>G rs794729598
NM_001267550.2(TTN):c.11312-4531A>C rs794729597
NM_001267550.2(TTN):c.11312-4553A>G rs150017914
NM_001267550.2(TTN):c.11312-4697T>C rs375197115
NM_001267550.2(TTN):c.11312-4701A>G rs369214339
NM_001267550.2(TTN):c.11312-4711T>A rs138826545
NM_001267550.2(TTN):c.11312-4724A>G rs727503663
NM_001267550.2(TTN):c.11312-4755A>G rs757789476
NM_001267550.2(TTN):c.11312-4803G>C rs147492121
NM_001267550.2(TTN):c.11312-4826G>A rs727505032
NM_001267550.2(TTN):c.11312-4871T>C rs200376564
NM_001267550.2(TTN):c.11312-4877G>T rs794729596
NM_001267550.2(TTN):c.11312-4904G>A rs62179016
NM_001267550.2(TTN):c.11312-4959A>G rs727504853
NM_001267550.2(TTN):c.11312-4991G>A rs150492317
NM_001267550.2(TTN):c.11312-4992C>T rs727504760
NM_001267550.2(TTN):c.11312-5130T>G rs201308378
NM_001267550.2(TTN):c.11312-5141C>T rs397517816
NM_001267550.2(TTN):c.11312-5175A>G rs371168275
NM_001267550.2(TTN):c.11312-5177A>G rs142973956
NM_001267550.2(TTN):c.11312-5196T>C rs557767596
NM_001267550.2(TTN):c.11312-5199_11312-5167del rs397517814
NM_001267550.2(TTN):c.11312-5252C>T rs201137248
NM_001267550.2(TTN):c.11312-5286C>T rs200953966
NM_001267550.2(TTN):c.11312-5297G>A rs727503664
NM_001267550.2(TTN):c.11312-5310G>T rs727503665
NM_001267550.2(TTN):c.11312-5357C>G rs148791107
NM_001267550.2(TTN):c.11312-5477A>T rs727504519
NM_001267550.2(TTN):c.11312-5568A>G rs727504687
NM_001267550.2(TTN):c.11312-5577G>A rs371444691
NM_001267550.2(TTN):c.11312-5598C>T rs565101305
NM_001267550.2(TTN):c.11450G>A (p.Gly3817Asp) rs371056587
NM_001267550.2(TTN):c.11465T>C (p.Phe3822Ser) rs794729600
NM_001267550.2(TTN):c.11506G>A (p.Val3836Met) rs397517825
NM_001267550.2(TTN):c.11546C>T (p.Pro3849Leu) rs727503662
NM_001267550.2(TTN):c.11567A>G (p.Asn3856Ser) rs765523683
NM_001267550.2(TTN):c.11602T>C (p.Phe3868Leu) rs727504700
NM_001267550.2(TTN):c.11657del (p.Asp3886fs) rs397517826
NM_001267550.2(TTN):c.11672C>T (p.Thr3891Ile) rs148164929
NM_001267550.2(TTN):c.1168G>A (p.Gly390Ser) rs794729412
NM_001267550.2(TTN):c.11717A>G (p.Tyr3906Cys) rs375020177
NM_001267550.2(TTN):c.11745del (p.His3916fs) rs1553941674
NM_001267550.2(TTN):c.11756C>A (p.Thr3919Asn) rs727503661
NM_001267550.2(TTN):c.11756C>T (p.Thr3919Ile) rs727503661
NM_001267550.2(TTN):c.11842C>T (p.Arg3948Cys) rs397517827
NM_001267550.2(TTN):c.1186G>A (p.Ala396Thr) rs200052202
NM_001267550.2(TTN):c.11913G>A (p.Trp3971Ter) rs749961489
NM_001267550.2(TTN):c.12016_12019dup (p.Gly4007fs) rs1553940935
NM_001267550.2(TTN):c.12103A>G (p.Met4035Val) rs727503659
NM_001267550.2(TTN):c.1213G>A (p.Ala405Thr) rs112266780
NM_001267550.2(TTN):c.12145C>T (p.Pro4049Ser) rs201888760
NM_001267550.2(TTN):c.12167C>T (p.Pro4056Leu) rs794729601
NM_001267550.2(TTN):c.12175G>T (p.Gly4059Cys) rs377114166
NM_001267550.2(TTN):c.12181G>A (p.Ala4061Thr) rs397517829
NM_001267550.2(TTN):c.12218C>T (p.Thr4073Met) rs376998429
NM_001267550.2(TTN):c.12282T>G (p.Tyr4094Ter) rs1553940185
NM_001267550.2(TTN):c.12361G>C (p.Asp4121His) rs370209978
NM_001267550.2(TTN):c.12401T>A (p.Ile4134Asn) rs112009206
NM_001267550.2(TTN):c.12404A>G (p.Asn4135Ser) rs565638291
NM_001267550.2(TTN):c.12412A>G (p.Ile4138Val) rs377290301
NM_001267550.2(TTN):c.1246-5T>C rs727503707
NM_001267550.2(TTN):c.12547A>G (p.Lys4183Glu) rs201565932
NM_001267550.2(TTN):c.12587C>A (p.Ser4196Ter) rs370912401
NM_001267550.2(TTN):c.12653T>C (p.Ile4218Thr) rs374631591
NM_001267550.2(TTN):c.12734A>G (p.Asn4245Ser) rs879167134
NM_001267550.2(TTN):c.12742C>T (p.Gln4248Ter) rs794729308
NM_001267550.2(TTN):c.12821G>A (p.Ser4274Asn) rs200348414
NM_001267550.2(TTN):c.12844A>C (p.Ile4282Leu) rs56244420
NM_001267550.2(TTN):c.12851A>C (p.Gln4284Pro) rs876658107
NM_001267550.2(TTN):c.12887C>T (p.Ser4296Leu) rs727503657
NM_001267550.2(TTN):c.12889T>G (p.Cys4297Gly) rs377063950
NM_001267550.2(TTN):c.1297G>A (p.Val433Ile) rs146000949
NM_001267550.2(TTN):c.13006G>T (p.Glu4336Ter) rs1553938197
NM_001267550.2(TTN):c.13078A>C (p.Lys4360Gln) rs727504903
NM_001267550.2(TTN):c.1312G>A (p.Val438Met) rs727504795
NM_001267550.2(TTN):c.13205C>T (p.Ala4402Val) rs756976503
NM_001267550.2(TTN):c.13265T>G (p.Ile4422Ser) rs727503656
NM_001267550.2(TTN):c.1333G>A (p.Ala445Thr) rs142414432
NM_001267550.2(TTN):c.13376T>C (p.Ile4459Thr) rs763065439
NM_001267550.2(TTN):c.13499A>G (p.Lys4500Arg) rs727503655
NM_001267550.2(TTN):c.1349C>T (p.Ala450Val) rs727503706
NM_001267550.2(TTN):c.13520T>C (p.Met4507Thr) rs191968963
NM_001267550.2(TTN):c.13618G>A (p.Val4540Met) rs201046911
NM_001267550.2(TTN):c.13654G>A (p.Val4552Ile) rs374214280
NM_001267550.2(TTN):c.13690G>A (p.Glu4564Lys) rs746672079
NM_001267550.2(TTN):c.13793del (p.Gly4598fs) rs727503653
NM_001267550.2(TTN):c.13864A>G (p.Ile4622Val) rs397517831
NM_001267550.2(TTN):c.13883C>T (p.Ser4628Phe) rs794729602
NM_001267550.2(TTN):c.13897A>G (p.Lys4633Glu) rs773833776
NM_001267550.2(TTN):c.13969A>C (p.Asn4657His) rs200204761
NM_001267550.2(TTN):c.1398+4C>T rs368548209
NM_001267550.2(TTN):c.14050G>A (p.Gly4684Arg) rs377579941
NM_001267550.2(TTN):c.14152A>G (p.Lys4718Glu) rs757119133
NM_001267550.2(TTN):c.14189G>A (p.Arg4730Gln) rs202017278
NM_001267550.2(TTN):c.14232C>A (p.Asp4744Glu) rs55906845
NM_001267550.2(TTN):c.1429A>T (p.Thr477Ser) rs727503705
NM_001267550.2(TTN):c.14302G>A (p.Gly4768Ser) rs727503652
NM_001267550.2(TTN):c.14306A>T (p.Glu4769Val) rs763092484
NM_001267550.2(TTN):c.14309A>G (p.Tyr4770Cys) rs371552518
NM_001267550.2(TTN):c.14326A>G (p.Asn4776Asp) rs727505309
NM_001267550.2(TTN):c.14386A>G (p.Thr4796Ala) rs780971372
NM_001267550.2(TTN):c.14402dup (p.Pro4801_Lys4802insTer) rs876661397
NM_001267550.2(TTN):c.14472A>G (p.Ile4824Met) rs794729603
NM_001267550.2(TTN):c.14486A>C (p.Gln4829Pro) rs375177753
NM_001267550.2(TTN):c.14488A>G (p.Lys4830Glu) rs794729604
NM_001267550.2(TTN):c.14533G>A (p.Asp4845Asn) rs373378672
NM_001267550.2(TTN):c.14588G>A (p.Gly4863Glu) rs375680312
NM_001267550.2(TTN):c.14654T>C (p.Ile4885Thr) rs794729605
NM_001267550.2(TTN):c.14786C>A (p.Pro4929His) rs794729606
NM_001267550.2(TTN):c.14813T>C (p.Phe4938Ser) rs560537668
NM_001267550.2(TTN):c.14828C>A (p.Ala4943Glu) rs540497678
NM_001267550.2(TTN):c.14911T>G (p.Cys4971Gly) rs537312655
NM_001267550.2(TTN):c.14998C>T (p.Arg5000Cys) rs369933152
NM_001267550.2(TTN):c.1499C>T (p.Thr500Ile) rs727503704
NM_001267550.2(TTN):c.15040A>G (p.Thr5014Ala) rs143093473
NM_001267550.2(TTN):c.15040A>T (p.Thr5014Ser) rs143093473
NM_001267550.2(TTN):c.15063A>C (p.Glu5021Asp) rs727503651
NM_001267550.2(TTN):c.15130G>A (p.Val5044Ile) rs727503650
NM_001267550.2(TTN):c.15263G>A (p.Arg5088Lys) rs766300782
NM_001267550.2(TTN):c.15346C>T (p.Arg5116Ter) rs1057518470
NM_001267550.2(TTN):c.15369_15371del (p.Leu5123del) rs397517480
NM_001267550.2(TTN):c.15415A>G (p.Ser5139Gly) rs876658040
NM_001267550.2(TTN):c.15495A>C (p.Lys5165Asn) rs794729608
NM_001267550.2(TTN):c.15497-8T>C rs727505010
NM_001267550.2(TTN):c.15563A>C (p.Gln5188Pro) rs72648930
NM_001267550.2(TTN):c.15688G>A (p.Val5230Ile) rs369294144
NM_001267550.2(TTN):c.15778C>A (p.Pro5260Thr) rs727505108
NM_001267550.2(TTN):c.16010A>G (p.Asn5337Ser) rs752924679
NM_001267550.2(TTN):c.16091G>A (p.Arg5364His) rs200941841
NM_001267550.2(TTN):c.16096G>A (p.Val5366Met) rs372176136
NM_001267550.2(TTN):c.16136A>C (p.Lys5379Thr) rs752346935
NM_001267550.2(TTN):c.16156A>G (p.Met5386Val) rs567457007
NM_001267550.2(TTN):c.16157T>C (p.Met5386Thr) rs375417155
NM_001267550.2(TTN):c.16175A>G (p.Lys5392Arg) rs794729609
NM_001267550.2(TTN):c.1622A>C (p.Glu541Ala) rs794729422
NM_001267550.2(TTN):c.16234G>A (p.Ala5412Thr) rs727504442
NM_001267550.2(TTN):c.16313A>G (p.Lys5438Arg) rs190636272
NM_001267550.2(TTN):c.16351A>G (p.Ser5451Gly) rs760722200
NM_001267550.2(TTN):c.16367C>A (p.Pro5456His) rs876658041
NM_001267550.2(TTN):c.16492A>G (p.Ile5498Val) rs876658042
NM_001267550.2(TTN):c.16496C>T (p.Thr5499Ile) rs794729611
NM_001267550.2(TTN):c.16517C>T (p.Ser5506Phe) rs201125295
NM_001267550.2(TTN):c.16546G>T (p.Asp5516Tyr) rs72648940
NM_001267550.2(TTN):c.16549T>G (p.Ser5517Ala) rs200520316
NM_001267550.2(TTN):c.16574G>C (p.Ser5525Thr) rs727503649
NM_001267550.2(TTN):c.16577A>G (p.Asn5526Ser) rs767376352
NM_001267550.2(TTN):c.16751T>A (p.Ile5584Asn) rs779652311
NM_001267550.2(TTN):c.16839A>C (p.Glu5613Asp) rs397517483
NM_001267550.2(TTN):c.16875C>A (p.Asp5625Glu) rs794729612
NM_001267550.2(TTN):c.16895T>C (p.Ile5632Thr) rs727504971
NM_001267550.2(TTN):c.1691C>T (p.Ala564Val) rs727505068
NM_001267550.2(TTN):c.17009G>C (p.Trp5670Ser) rs794729613
NM_001267550.2(TTN):c.17075T>C (p.Val5692Ala) rs570039271
NM_001267550.2(TTN):c.17116G>A (p.Glu5706Lys) rs376593556
NM_001267550.2(TTN):c.17208C>G (p.Ile5736Met) rs397517484
NM_001267550.2(TTN):c.17222C>G (p.Ser5741Cys) rs794729614
NM_001267550.2(TTN):c.17224C>T (p.Leu5742Phe) rs72648943
NM_001267550.2(TTN):c.17386C>G (p.His5796Asp) rs397517485
NM_001267550.2(TTN):c.17393G>T (p.Gly5798Val) rs754818408
NM_001267550.2(TTN):c.17473A>G (p.Ile5825Val) rs778914141
NM_001267550.2(TTN):c.17500G>A (p.Val5834Ile) rs727505221
NM_001267550.2(TTN):c.1754A>G (p.Glu585Gly) rs794729425
NM_001267550.2(TTN):c.17669G>C (p.Ser5890Thr) rs775293848
NM_001267550.2(TTN):c.17752C>A (p.Pro5918Thr) rs727504480
NM_001267550.2(TTN):c.177C>A (p.Ser59Arg) rs191057824
NM_001267550.2(TTN):c.17806A>G (p.Ile5936Val) rs72648945
NM_001267550.2(TTN):c.17818T>C (p.Cys5940Arg) rs374882815
NM_001267550.2(TTN):c.17821A>G (p.Ile5941Val) rs397517487
NM_001267550.2(TTN):c.17C>T (p.Pro6Leu) rs201490999
NM_001267550.2(TTN):c.18037T>C (p.Tyr6013His) rs548015673
NM_001267550.2(TTN):c.18071A>G (p.Asn6024Ser) rs759852969
NM_001267550.2(TTN):c.1816A>G (p.Arg606Gly) rs397517498
NM_001267550.2(TTN):c.18172C>T (p.Arg6058Cys) rs189127014
NM_001267550.2(TTN):c.18173G>A (p.Arg6058His) rs376012117
NM_001267550.2(TTN):c.18250T>C (p.Cys6084Arg) rs794729615
NM_001267550.2(TTN):c.1828G>C (p.Val610Leu) rs397517499
NM_001267550.2(TTN):c.18292A>G (p.Thr6098Ala) rs727505140
NM_001267550.2(TTN):c.1834A>G (p.Lys612Glu) rs727505256
NM_001267550.2(TTN):c.18413C>A (p.Ser6138Tyr) rs727504477
NM_001267550.2(TTN):c.18653T>G (p.Leu6218Arg) rs727505193
NM_001267550.2(TTN):c.18655G>A (p.Glu6219Lys) rs72648948
NM_001267550.2(TTN):c.18663A>C (p.Glu6221Asp) rs369544339
NM_001267550.2(TTN):c.18680C>T (p.Pro6227Leu) rs376846228
NM_001267550.2(TTN):c.18770A>G (p.His6257Arg) rs371299041
NM_001267550.2(TTN):c.18778A>C (p.Lys6260Gln) rs375652574
NM_001267550.2(TTN):c.187G>A (p.Ala63Thr) rs764892312
NM_001267550.2(TTN):c.18802G>C (p.Glu6268Gln) rs794729616
NM_001267550.2(TTN):c.18832G>A (p.Gly6278Ser) rs397517488
NM_001267550.2(TTN):c.18943G>A (p.Val6315Met) rs770552574
NM_001267550.2(TTN):c.19015T>C (p.Tyr6339His) rs397517490
NM_001267550.2(TTN):c.19016A>G (p.Tyr6339Cys) rs192553687
NM_001267550.2(TTN):c.19030G>A (p.Asp6344Asn) rs794729617
NM_001267550.2(TTN):c.19054A>G (p.Arg6352Gly) rs569003242
NM_001267550.2(TTN):c.19063G>T (p.Asp6355Tyr) rs188878341
NM_001267550.2(TTN):c.19282A>T (p.Ser6428Cys) rs727505137
NM_001267550.2(TTN):c.19315G>A (p.Val6439Met) rs727505289
NM_001267550.2(TTN):c.19356C>A (p.Ser6452Arg) rs369275615
NM_001267550.2(TTN):c.19426+2T>A rs727505178
NM_001267550.2(TTN):c.19469T>G (p.Met6490Arg) rs769527897
NM_001267550.2(TTN):c.19483G>A (p.Gly6495Ser) rs397517491
NM_001267550.2(TTN):c.19528A>G (p.Ile6510Val) rs761041978
NM_001267550.2(TTN):c.19601G>T (p.Arg6534Ile) rs794729618
NM_001267550.2(TTN):c.19879T>G (p.Ser6627Ala) rs762585871
NM_001267550.2(TTN):c.19922C>A (p.Thr6641Asn) rs747240394
NM_001267550.2(TTN):c.19963G>A (p.Asp6655Asn) rs397517493
NM_001267550.2(TTN):c.20057G>A (p.Arg6686Gln) rs202022304
NM_001267550.2(TTN):c.20108G>A (p.Arg6703Gln) rs546821182
NM_001267550.2(TTN):c.20170G>A (p.Val6724Ile) rs140143513
NM_001267550.2(TTN):c.20170G>T (p.Val6724Phe) rs140143513
NM_001267550.2(TTN):c.20185A>C (p.Asn6729His) rs794729619
NM_001267550.2(TTN):c.20228A>G (p.Gln6743Arg) rs794729620
NM_001267550.2(TTN):c.20260A>G (p.Lys6754Glu) rs397517494
NM_001267550.2(TTN):c.202C>T (p.Pro68Ser) rs876658046
NM_001267550.2(TTN):c.20341G>A (p.Glu6781Lys) rs72648958
NM_001267550.2(TTN):c.20355G>A (p.Ser6785=) rs549470227
NM_001267550.2(TTN):c.20468T>G (p.Val6823Gly) rs529417675
NM_001267550.2(TTN):c.204C>T (p.Pro68=) rs201089861
NM_001267550.2(TTN):c.20633A>C (p.Glu6878Ala) rs752107739
NM_001267550.2(TTN):c.20707A>G (p.Ile6903Val) rs571675433
NM_001267550.2(TTN):c.20742T>A (p.Phe6914Leu) rs397517495
NM_001267550.2(TTN):c.20743G>T (p.Ala6915Ser) rs201728165
NM_001267550.2(TTN):c.20784A>C (p.Gln6928His) rs794729622
NM_001267550.2(TTN):c.2084T>C (p.Val695Ala) rs727503702
NM_001267550.2(TTN):c.20869A>T (p.Met6957Leu) rs375262781
NM_001267550.2(TTN):c.20971A>G (p.Ser6991Gly) rs397517496
NM_001267550.2(TTN):c.21157A>C (p.Thr7053Pro) rs727504741
NM_001267550.2(TTN):c.21197A>G (p.Lys7066Arg) rs553548392
NM_001267550.2(TTN):c.21227C>T (p.Ala7076Val) rs374625641
NM_001267550.2(TTN):c.21332T>C (p.Met7111Thr) rs374408615
NM_001267550.2(TTN):c.21364G>A (p.Ala7122Thr) rs201394117
NM_001267550.2(TTN):c.2137C>T (p.Arg713Ter) rs727505277
NM_001267550.2(TTN):c.21382C>G (p.Arg7128Gly) rs727505031
NM_001267550.2(TTN):c.2143A>G (p.Arg715Gly) rs727505258
NM_001267550.2(TTN):c.21521C>T (p.Ala7174Val) rs764832849
NM_001267550.2(TTN):c.21544C>T (p.Arg7182Trp) rs727504736
NM_001267550.2(TTN):c.21548G>A (p.Cys7183Tyr) rs189951108
NM_001267550.2(TTN):c.21553A>T (p.Ile7185Phe) rs552242411
NM_001267550.2(TTN):c.21605C>G (p.Ser7202Cys) rs747376234
NM_001267550.2(TTN):c.21638A>C (p.Asn7213Thr) rs794729623
NM_001267550.2(TTN):c.21656C>T (p.Ser7219Phe) rs201029552
NM_001267550.2(TTN):c.21721G>A (p.Val7241Ile) rs367854582
NM_001267550.2(TTN):c.21755C>T (p.Thr7252Ile) rs375714080
NM_001267550.2(TTN):c.21790A>C (p.Lys7264Gln) rs776072028
NM_001267550.2(TTN):c.21817T>C (p.Ser7273Pro) rs794729624
NM_001267550.2(TTN):c.21859C>G (p.Leu7287Val) rs754054875
NM_001267550.2(TTN):c.21944C>T (p.Ala7315Val) rs771646076
NM_001267550.2(TTN):c.21956C>T (p.Thr7319Ile) rs876658043
NM_001267550.2(TTN):c.21970T>G (p.Tyr7324Asp) rs765632650
NM_001267550.2(TTN):c.21976G>T (p.Val7326Phe) rs794729625
NM_001267550.2(TTN):c.2206G>A (p.Gly736Arg) rs876658047
NM_001267550.2(TTN):c.22090C>T (p.Arg7364Trp) rs397517500
NM_001267550.2(TTN):c.22112C>T (p.Thr7371Ile) rs794729626
NM_001267550.2(TTN):c.22214C>T (p.Ser7405Phe) rs794729627
NM_001267550.2(TTN):c.22241-14A>G rs371352901
NM_001267550.2(TTN):c.22241-5T>C rs397517501
NM_001267550.2(TTN):c.22243C>T (p.Arg7415Cys) rs756455602
NM_001267550.2(TTN):c.22312C>T (p.Leu7438Phe) rs371114946
NM_001267550.2(TTN):c.22361G>A (p.Arg7454Lys) rs727504464
NM_001267550.2(TTN):c.22386T>A (p.Asp7462Glu) rs183482849
NM_001267550.2(TTN):c.22386T>G (p.Asp7462Glu) rs183482849
NM_001267550.2(TTN):c.22412A>G (p.Asp7471Gly) rs760724710
NM_001267550.2(TTN):c.22420G>A (p.Ala7474Thr) rs759713604
NM_001267550.2(TTN):c.22513A>G (p.Arg7505Gly) rs372826489
NM_001267550.2(TTN):c.22531C>T (p.Pro7511Ser) rs727505333
NM_001267550.2(TTN):c.2255G>A (p.Arg752His) rs549724517
NM_001267550.2(TTN):c.22575T>A (p.Asp7525Glu) rs200061856
NM_001267550.2(TTN):c.22634G>A (p.Arg7545Gln) rs72648969
NM_001267550.2(TTN):c.2264C>T (p.Ser755Leu) rs533384820
NM_001267550.2(TTN):c.22666C>A (p.Arg7556Ser) rs754885396
NM_001267550.2(TTN):c.22667G>A (p.Arg7556His) rs374344734
NM_001267550.2(TTN):c.22798G>T (p.Ala7600Ser) rs757523256
NM_001267550.2(TTN):c.22817-15T>G rs727504821
NM_001267550.2(TTN):c.2283_2288del (p.Lys762_Ala763del) rs727503701
NM_001267550.2(TTN):c.22889G>C (p.Cys7630Ser) rs781175517
NM_001267550.2(TTN):c.22922C>T (p.Ser7641Leu) rs369508943
NM_001267550.2(TTN):c.22942G>A (p.Glu7648Lys) rs397517502
NM_001267550.2(TTN):c.23029G>A (p.Gly7677Arg) rs367826445
NM_001267550.2(TTN):c.23065G>A (p.Asp7689Asn) rs727505052
NM_001267550.2(TTN):c.23068G>A (p.Ala7690Thr) rs763029699
NM_001267550.2(TTN):c.230G>A (p.Arg77Gln) rs727503709
NM_001267550.2(TTN):c.23302G>A (p.Asp7768Asn) rs72648973
NM_001267550.2(TTN):c.23357C>A (p.Ser7786Tyr) rs794729628
NM_001267550.2(TTN):c.23371T>C (p.Phe7791Leu) rs727505045
NM_001267550.2(TTN):c.23392G>A (p.Val7798Met) rs144032104
NM_001267550.2(TTN):c.23429A>G (p.Asp7810Gly) rs375392021
NM_001267550.2(TTN):c.23444G>A (p.Arg7815Gln) rs372804810
NM_001267550.2(TTN):c.23455G>C (p.Glu7819Gln) rs201420077
NM_001267550.2(TTN):c.23493_23494del (p.Asp7831fs) rs1057518145
NM_001267550.2(TTN):c.23537T>A (p.Phe7846Tyr) rs397517504
NM_001267550.2(TTN):c.23578G>A (p.Ala7860Thr) rs138076523
NM_001267550.2(TTN):c.2359A>G (p.Ile787Val) rs397517522
NM_001267550.2(TTN):c.23747C>G (p.Pro7916Arg) rs764130233
NM_001267550.2(TTN):c.2386G>A (p.Asp796Asn) rs766935265
NM_001267550.2(TTN):c.23894A>G (p.Asn7965Ser) rs794729630
NM_001267550.2(TTN):c.23939-13C>A rs876658045
NM_001267550.2(TTN):c.23965C>T (p.Arg7989Cys) rs201653851
NM_001267550.2(TTN):c.2396C>T (p.Thr799Met) rs149061352
NM_001267550.2(TTN):c.24017G>A (p.Cys8006Tyr) rs764282358
NM_001267550.2(TTN):c.24107C>T (p.Ser8036Leu) rs200598509
NM_001267550.2(TTN):c.24229C>A (p.Pro8077Thr) rs758548104
NM_001267550.2(TTN):c.2422C>T (p.Arg808Cys) rs149155733
NM_001267550.2(TTN):c.24344G>A (p.Ser8115Asn) rs397517506
NM_001267550.2(TTN):c.24358C>T (p.Pro8120Ser) rs745913661
NM_001267550.2(TTN):c.24454G>A (p.Val8152Ile) rs397517507
NM_001267550.2(TTN):c.24520G>A (p.Val8174Met) rs727504961
NM_001267550.2(TTN):c.24619G>A (p.Asp8207Asn) rs756813056
NM_001267550.2(TTN):c.24622G>A (p.Glu8208Lys) rs190192954
NM_001267550.2(TTN):c.24639A>C (p.Gln8213His) rs397517510
NM_001267550.2(TTN):c.24677C>G (p.Thr8226Ser) rs1391244402
NM_001267550.2(TTN):c.24706G>A (p.Glu8236Lys) rs377762626
NM_001267550.2(TTN):c.24769C>G (p.Leu8257Val) rs371322658
NM_001267550.2(TTN):c.2477C>T (p.Thr826Ile) rs794729478
NM_001267550.2(TTN):c.24823G>A (p.Ala8275Thr) rs771947778
NM_001267550.2(TTN):c.24839C>T (p.Pro8280Leu) rs375219172
NM_001267550.2(TTN):c.24905C>A (p.Thr8302Lys) rs549604128
NM_001267550.2(TTN):c.24922C>T (p.Pro8308Ser) rs373770383
NM_001267550.2(TTN):c.24928T>A (p.Tyr8310Asn) rs397517511
NM_001267550.2(TTN):c.24952G>A (p.Val8318Ile) rs200103997
NM_001267550.2(TTN):c.25046C>G (p.Ala8349Gly) rs397517513
NM_001267550.2(TTN):c.25066C>T (p.Arg8356Cys) rs201810836
NM_001267550.2(TTN):c.25087G>T (p.Ala8363Ser) rs200972189
NM_001267550.2(TTN):c.25126C>T (p.Pro8376Ser) rs375209098
NM_001267550.2(TTN):c.25145G>A (p.Arg8382His) rs199598066
NM_001267550.2(TTN):c.25162C>T (p.Pro8388Ser) rs727503647
NM_001267550.2(TTN):c.25235A>G (p.His8412Arg) rs775392484
NM_001267550.2(TTN):c.25247C>T (p.Thr8416Ile) rs794729631
NM_001267550.2(TTN):c.25476T>A (p.Asp8492Glu) rs777349143
NM_001267550.2(TTN):c.25481G>A (p.Arg8494Gln) rs201418615
NM_001267550.2(TTN):c.25510A>C (p.Met8504Leu) rs761929830
NM_001267550.2(TTN):c.25535C>T (p.Thr8512Ile) rs764620561
NM_001267550.2(TTN):c.25564G>A (p.Asp8522Asn) rs199619070
NM_001267550.2(TTN):c.25619C>T (p.Ser8540Phe) rs201523784
NM_001267550.2(TTN):c.25699A>G (p.Thr8567Ala) rs777832511
NM_001267550.2(TTN):c.25706A>G (p.Tyr8569Cys) rs397517516
NM_001267550.2(TTN):c.25723G>A (p.Gly8575Arg) rs397517517
NM_001267550.2(TTN):c.25853G>A (p.Gly8618Glu) rs369947439
NM_001267550.2(TTN):c.25877A>G (p.Asn8626Ser) rs200355367
NM_001267550.2(TTN):c.25942A>G (p.Lys8648Glu) rs188234466
NM_001267550.2(TTN):c.26020G>A (p.Val8674Ile) rs375710902
NM_001267550.2(TTN):c.2605A>T (p.Thr869Ser) rs370962244
NM_001267550.2(TTN):c.26144G>A (p.Cys8715Tyr) rs183499397
NM_001267550.2(TTN):c.26146A>G (p.Lys8716Glu) rs794729632
NM_001267550.2(TTN):c.26161G>A (p.Val8721Met) rs777730788
NM_001267550.2(TTN):c.26179G>A (p.Val8727Ile) rs544958705
NM_001267550.2(TTN):c.26200G>A (p.Ala8734Thr) rs727503646
NM_001267550.2(TTN):c.26201-11dup rs727503644
NM_001267550.2(TTN):c.26329G>A (p.Val8777Ile) rs376823283
NM_001267550.2(TTN):c.26345A>G (p.Asn8782Ser) rs727504895
NM_001267550.2(TTN):c.26494A>G (p.Ile8832Val) rs72648989
NM_001267550.2(TTN):c.26528C>T (p.Thr8843Met) rs72648990
NM_001267550.2(TTN):c.26557G>C (p.Val8853Leu) rs757381520
NM_001267550.2(TTN):c.26639T>G (p.Phe8880Cys) rs397517518
NM_001267550.2(TTN):c.266C>G (p.Ala89Gly) rs200165636
NM_001267550.2(TTN):c.26744C>G (p.Ala8915Gly) rs536974988
NM_001267550.2(TTN):c.26762-9A>G rs200821070
NM_001267550.2(TTN):c.26765G>A (p.Arg8922Gln) rs397517520
NM_001267550.2(TTN):c.2679A>C (p.Glu893Asp) rs770287129
NM_001267550.2(TTN):c.26804C>G (p.Thr8935Arg) rs571245328
NM_001267550.2(TTN):c.26849A>G (p.Tyr8950Cys) rs199557654
NM_001267550.2(TTN):c.26893G>A (p.Glu8965Lys) rs200325324
NM_001267550.2(TTN):c.2691G>C (p.Glu897Asp) rs778905342
NM_001267550.2(TTN):c.26935A>C (p.Asn8979His) rs376982715
NM_001267550.2(TTN):c.26C>T (p.Thr9Met) rs146123323
NM_001267550.2(TTN):c.27155G>C (p.Trp9052Ser) rs769663130
NM_001267550.2(TTN):c.27217G>C (p.Val9073Leu) rs756400799
NM_001267550.2(TTN):c.27265T>C (p.Tyr9089His) rs794729633
NM_001267550.2(TTN):c.27328+4T>G rs876658048
NM_001267550.2(TTN):c.27328+5G>A rs397517521
NM_001267550.2(TTN):c.2734C>T (p.Arg912Cys) rs371156190
NM_001267550.2(TTN):c.27368T>C (p.Ile9123Thr) rs879134187
NM_001267550.2(TTN):c.2742G>T (p.Glu914Asp) rs145735907
NM_001267550.2(TTN):c.27593A>G (p.Gln9198Arg) rs368297438
NM_001267550.2(TTN):c.27676T>C (p.Cys9226Arg) rs372820178
NM_001267550.2(TTN):c.27709T>G (p.Ser9237Ala) rs766638714
NM_001267550.2(TTN):c.27713G>T (p.Trp9238Leu) rs794729634
NM_001267550.2(TTN):c.27743C>A (p.Thr9248Asn) rs397517523
NM_001267550.2(TTN):c.2776-14T>C rs201611946
NM_001267550.2(TTN):c.2776G>A (p.Val926Ile) rs876658052
NM_001267550.2(TTN):c.27793A>C (p.Asn9265His) rs397517524
NM_001267550.2(TTN):c.27847G>A (p.Val9283Met) rs727504515
NM_001267550.2(TTN):c.27886+5T>C rs876658050
NM_001267550.2(TTN):c.27914G>A (p.Arg9305Gln) rs397517527
NM_001267550.2(TTN):c.27928G>A (p.Val9310Ile) rs200207722
NM_001267550.2(TTN):c.27941T>A (p.Val9314Asp) rs727505348
NM_001267550.2(TTN):c.27994G>A (p.Val9332Met) rs367734747
NM_001267550.2(TTN):c.28093C>T (p.Arg9365Trp) rs190600127
NM_001267550.2(TTN):c.28094G>A (p.Arg9365Gln) rs570608843
NM_001267550.2(TTN):c.28098C>G (p.Ser9366Arg) rs374930292
NM_001267550.2(TTN):c.28139G>T (p.Gly9380Val) rs397517528
NM_001267550.2(TTN):c.28187C>T (p.Pro9396Leu) rs373065549
NM_001267550.2(TTN):c.28220A>G (p.Asp9407Gly) rs1553888340
NM_001267550.2(TTN):c.28240G>T (p.Ala9414Ser) rs794729635
NM_001267550.2(TTN):c.28251G>C (p.Glu9417Asp) rs773169301
NM_001267550.2(TTN):c.28321G>A (p.Gly9441Arg) rs397517529
NM_001267550.2(TTN):c.28463-14G>A rs200917885
NM_001267550.2(TTN):c.28465C>T (p.Arg9489Trp) rs200489972
NM_001267550.2(TTN):c.28466G>A (p.Arg9489Gln) rs189431308
NM_001267550.2(TTN):c.28577C>T (p.Ala9526Val) rs794729636
NM_001267550.2(TTN):c.28587A>C (p.Lys9529Asn) rs876658049
NM_001267550.2(TTN):c.28606C>A (p.Pro9536Thr) rs201121983
NM_001267550.2(TTN):c.28628C>T (p.Thr9543Ile) rs752853962
NM_001267550.2(TTN):c.28678G>A (p.Asp9560Asn) rs771843862
NM_001267550.2(TTN):c.28709A>G (p.Asn9570Ser) rs727503641
NM_001267550.2(TTN):c.28733C>T (p.Thr9578Met) rs184923756
NM_001267550.2(TTN):c.28754-9C>T rs797046061
NM_001267550.2(TTN):c.28754A>C (p.Glu9585Ala) rs200856239
NM_001267550.2(TTN):c.28849G>A (p.Glu9617Lys) rs144025230
NM_001267550.2(TTN):c.28877C>A (p.Ala9626Asp) rs397517530
NM_001267550.2(TTN):c.28889T>G (p.Ile9630Arg) rs794729386
NM_001267550.2(TTN):c.28903A>G (p.Arg9635Gly) rs397517531
NM_001267550.2(TTN):c.29026A>C (p.Lys9676Gln) rs1553883243
NM_001267550.2(TTN):c.29048C>T (p.Pro9683Leu) rs794729399
NM_001267550.2(TTN):c.29182A>G (p.Asn9728Asp) rs794729400
NM_001267550.2(TTN):c.29230C>T (p.Arg9744Cys) rs375266859
NM_001267550.2(TTN):c.29231G>A (p.Arg9744His) rs760305440
NM_001267550.2(TTN):c.29278G>A (p.Asp9760Asn) rs372537023
NM_001267550.2(TTN):c.29397C>T (p.Gly9799=) rs770084292
NM_001267550.2(TTN):c.29429T>C (p.Ile9810Thr) rs781737736
NM_001267550.2(TTN):c.29448_29450AGA[2] (p.Glu9820del) rs377232641
NM_001267550.2(TTN):c.29525A>G (p.Tyr9842Cys) rs1553879661
NM_001267550.2(TTN):c.296-14T>C rs199951296
NM_001267550.2(TTN):c.29762T>C (p.Ile9921Thr) rs373651676
NM_001267550.2(TTN):c.29938G>A (p.Ala9980Thr) rs189286381
NM_001267550.2(TTN):c.3002T>G (p.Met1001Arg) rs148269839
NM_001267550.2(TTN):c.3003G>A (p.Met1001Ile) rs794729522
NM_001267550.2(TTN):c.30055T>G (p.Ser10019Ala) rs754368714
NM_001267550.2(TTN):c.30088C>T (p.Pro10030Ser) rs368531555
NM_001267550.2(TTN):c.30166G>T (p.Gly10056Cys) rs794729401
NM_001267550.2(TTN):c.30181A>C (p.Lys10061Gln) rs184153985
NM_001267550.2(TTN):c.30274C>T (p.His10092Tyr) rs72650011
NM_001267550.2(TTN):c.3027C>A (p.Asp1009Glu) rs794729523
NM_001267550.2(TTN):c.30296G>A (p.Cys10099Tyr) rs1253569310
NM_001267550.2(TTN):c.3031G>A (p.Gly1011Arg) rs397517546
NM_001267550.2(TTN):c.30389G>A (p.Arg10130His) rs373355159
NM_001267550.2(TTN):c.30434-15G>A rs373562293
NM_001267550.2(TTN):c.30437T>A (p.Val10146Asp) rs372185371
NM_001267550.2(TTN):c.30485C>T (p.Thr10162Met) rs200593368
NM_001267550.2(TTN):c.30487G>T (p.Ala10163Ser) rs794729404
NM_001267550.2(TTN):c.30513A>T (p.Glu10171Asp) rs577066020
NM_001267550.2(TTN):c.30598G>C (p.Glu10200Gln) rs779015756
NM_001267550.2(TTN):c.30707A>C (p.Asp10236Ala) rs539986891
NM_001267550.2(TTN):c.3070G>A (p.Val1024Ile) rs368770038
NM_001267550.2(TTN):c.30718G>T (p.Val10240Phe) rs111671438
NM_001267550.2(TTN):c.30725C>T (p.Ala10242Val) rs397517534
NM_001267550.2(TTN):c.30754+1G>T rs914288774
NM_001267550.2(TTN):c.30803-15C>T rs397517535
NM_001267550.2(TTN):c.30857T>C (p.Ile10286Thr) rs369094355
NM_001267550.2(TTN):c.30893C>T (p.Ala10298Val) rs727504902
NM_001267550.2(TTN):c.3089T>C (p.Leu1030Pro) rs727504809
NM_001267550.2(TTN):c.30925_30927del (p.Glu10309del) rs531755049
NM_001267550.2(TTN):c.30932G>C (p.Arg10311Thr) rs376271601
NM_001267550.2(TTN):c.30994C>G (p.Pro10332Ala) rs757869762
NM_001267550.2(TTN):c.3100G>A (p.Val1034Met) rs142951505
NM_001267550.2(TTN):c.31014T>G (p.Tyr10338Ter) rs397517536
NM_001267550.2(TTN):c.31114G>C (p.Glu10372Gln) rs200831060
NM_001267550.2(TTN):c.31181T>C (p.Ile10394Thr) rs1219872673
NM_001267550.2(TTN):c.31207+5G>A rs876658051
NM_001267550.2(TTN):c.31238T>C (p.Val10413Ala) rs794729405
NM_001267550.2(TTN):c.31255C>T (p.Pro10419Ser) rs397517537
NM_001267550.2(TTN):c.3133G>A (p.Val1045Met) rs72647868
NM_001267550.2(TTN):c.31391G>A (p.Arg10464Gln) rs727504757
NM_001267550.2(TTN):c.31426+1G>C rs6749719
NM_001267550.2(TTN):c.31472T>C (p.Met10491Thr) rs769226745
NM_001267550.2(TTN):c.3170T>C (p.Val1057Ala) rs145940356
NM_001267550.2(TTN):c.31720C>G (p.Pro10574Ala) rs794729406
NM_001267550.2(TTN):c.31735A>C (p.Lys10579Gln) rs376287951
NM_001267550.2(TTN):c.31757C>A (p.Pro10586Gln) rs200459347
NM_001267550.2(TTN):c.31763-1G>A rs202234172
NM_001267550.2(TTN):c.31807G>A (p.Val10603Ile) rs139790668
NM_001267550.2(TTN):c.31832C>G (p.Ala10611Gly) rs727503637
NM_001267550.2(TTN):c.31837C>G (p.Pro10613Ala) rs200213832
NM_001267550.2(TTN):c.31892T>C (p.Ile10631Thr) rs752797889
NM_001267550.2(TTN):c.31978C>T (p.Arg10660Trp) rs537107089
NM_001267550.2(TTN):c.32026A>G (p.Lys10676Glu) rs200952728
NM_001267550.2(TTN):c.32035G>A (p.Val10679Ile) rs369932282
NM_001267550.2(TTN):c.32054C>T (p.Ala10685Val) rs794729407
NM_001267550.2(TTN):c.32093G>A (p.Arg10698Gln) rs200161147
NM_001267550.2(TTN):c.32095+1G>A rs727503636
NM_001267550.2(TTN):c.32198-10T>C rs371121439
NM_001267550.2(TTN):c.32254G>T (p.Val10752Phe) rs72650028
NM_001267550.2(TTN):c.32311G>A (p.Val10771Met) rs549877654
NM_001267550.2(TTN):c.3241G>A (p.Ala1081Thr) rs55914517
NM_001267550.2(TTN):c.32449G>A (p.Glu10817Lys) rs876658053
NM_001267550.2(TTN):c.32462C>T (p.Pro10821Leu) rs146400809
NM_001267550.2(TTN):c.32555-12G>T rs397517540
NM_001267550.2(TTN):c.32569A>G (p.Lys10857Glu) rs372878566
NM_001267550.2(TTN):c.32660T>C (p.Ile10887Thr) rs371538856
NM_001267550.2(TTN):c.32683G>T (p.Val10895Phe) rs794729408
NM_001267550.2(TTN):c.32699A>C (p.Lys10900Thr) rs794729409
NM_001267550.2(TTN):c.32705C>T (p.Ala10902Val) rs778076110
NM_001267550.2(TTN):c.3271C>G (p.Gln1091Glu) rs794729528
NM_001267550.2(TTN):c.32767A>C (p.Lys10923Gln) rs367720439
NM_001267550.2(TTN):c.32803A>G (p.Lys10935Glu) rs397517543
NM_001267550.2(TTN):c.32821A>G (p.Lys10941Glu) rs794729410
NM_001267550.2(TTN):c.32858C>T (p.Ala10953Val) rs773225325
NM_001267550.2(TTN):c.32866del (p.Arg10956fs) rs876658054
NM_001267550.2(TTN):c.32888-3C>A rs397517544
NM_001267550.2(TTN):c.32953C>T (p.Arg10985Trp) rs201991864
NM_001267550.2(TTN):c.3295G>A (p.Val1099Met) rs368282893
NM_001267550.2(TTN):c.32971G>A (p.Glu10991Lys) rs201081803
NM_001267550.2(TTN):c.33059A>G (p.Tyr11020Cys) rs72650035
NM_001267550.2(TTN):c.33152C>G (p.Pro11051Arg) rs794729411
NM_001267550.2(TTN):c.33172+4G>A rs756475184
NM_001267550.2(TTN):c.33248-8C>G rs766957102
NM_001267550.2(TTN):c.33305G>A (p.Arg11102His) rs368777046
NM_001267550.2(TTN):c.33404C>A (p.Ala11135Glu) rs577901623
NM_001267550.2(TTN):c.33427G>T (p.Val11143Leu) rs370968669
NM_001267550.2(TTN):c.33445C>T (p.Pro11149Ser) rs377760800
NM_001267550.2(TTN):c.33479C>T (p.Thr11160Ile) rs876658055
NM_001267550.2(TTN):c.33501_33503AGA[6] (p.Glu11172dup) rs368327166
NM_001267550.2(TTN):c.33580+6T>C rs368442571
NM_001267550.2(TTN):c.33754C>A (p.Pro11252Thr) rs886055283
NM_001267550.2(TTN):c.33796C>T (p.Pro11266Ser) rs201120871
NM_001267550.2(TTN):c.33838C>T (p.Pro11280Ser) rs374449452
NM_001267550.2(TTN):c.33856G>A (p.Glu11286Lys) rs376874956
NM_001267550.2(TTN):c.33856G>C (p.Glu11286Gln) rs376874956
NM_001267550.2(TTN):c.33911-6_33911-5insG rs765503214
NM_001267550.2(TTN):c.33911-7T>C rs397517545
NM_001267550.2(TTN):c.33971A>G (p.Lys11324Arg) rs727504880
NM_001267550.2(TTN):c.34037C>T (p.Pro11346Leu) rs794729413
NM_001267550.2(TTN):c.34054C>G (p.Leu11352Val) rs794729414
NM_001267550.2(TTN):c.34058T>C (p.Phe11353Ser) rs752527275
NM_001267550.2(TTN):c.34098_34118GGAAGAGGAAGTTCTACCTGA[3] (p.11363_11369VLPEEEE[5]) rs397517548
NM_001267550.2(TTN):c.3410G>A (p.Gly1137Asp) rs864309575
NM_001267550.2(TTN):c.34129G>T (p.Val11377Phe) rs745521516
NM_001267550.2(TTN):c.3445G>A (p.Asp1149Asn) rs368967197
NM_001267550.2(TTN):c.3469G>A (p.Val1157Ile) rs397517566
NM_001267550.2(TTN):c.34709-1G>A rs727503634
NM_001267550.2(TTN):c.34721T>C (p.Ile11574Thr) rs368157806
NM_001267550.2(TTN):c.34753G>C (p.Val11585Leu) rs780132207
NM_001267550.2(TTN):c.3475C>A (p.Arg1159Ser) rs797046063
NM_001267550.2(TTN):c.3476G>A (p.Arg1159His) rs149883066
NM_001267550.2(TTN):c.34786G>A (p.Val11596Met) rs794729415
NM_001267550.2(TTN):c.34812A>C (p.Lys11604Asn) rs797046062
NM_001267550.2(TTN):c.34843C>T (p.Pro11615Ser) rs727504775
NM_001267550.2(TTN):c.34894C>A (p.Leu11632Ile) rs727503633
NM_001267550.2(TTN):c.3490G>T (p.Glu1164Ter) rs878854391
NM_001267550.2(TTN):c.34982T>C (p.Val11661Ala) rs199561793
NM_001267550.2(TTN):c.3514C>A (p.Leu1172Ile) rs375735354
NM_001267550.2(TTN):c.3523G>A (p.Ala1175Thr) rs397517570
NM_001267550.2(TTN):c.35314G>A (p.Glu11772Lys) rs727505263
NM_001267550.2(TTN):c.3533A>C (p.Glu1178Ala) rs112277159
NM_001267550.2(TTN):c.36044C>T (p.Thr12015Met) rs199868380
NM_001267550.2(TTN):c.3605T>C (p.Val1202Ala) rs150667217
NM_001267550.2(TTN):c.3625T>C (p.Phe1209Leu) rs727503698
NM_001267550.2(TTN):c.36655T>G (p.Leu12219Val) rs12994774
NM_001267550.2(TTN):c.36776C>T (p.Ala12259Val) rs755562550
NM_001267550.2(TTN):c.3716A>C (p.Tyr1239Ser) rs794729569
NM_001267550.2(TTN):c.37397C>T (p.Pro12466Leu) rs727503632
NM_001267550.2(TTN):c.38131G>T (p.Val12711Leu) rs202075225
NM_001267550.2(TTN):c.38214A>T (p.Glu12738Asp) rs794729417
NM_001267550.2(TTN):c.38305G>A (p.Ala12769Thr) rs1553776621
NM_001267550.2(TTN):c.385G>A (p.Gly129Arg) rs727503708
NM_001267550.2(TTN):c.38902C>T (p.Pro12968Ser) rs192528655
NM_001267550.2(TTN):c.39071C>A (p.Pro13024His) rs794729420
NM_001267550.2(TTN):c.39115A>C (p.Thr13039Pro) rs766921440
NM_001267550.2(TTN):c.39139C>T (p.Pro13047Ser) rs761682559
NM_001267550.2(TTN):c.39163A>G (p.Lys13055Glu) rs397517555
NM_001267550.2(TTN):c.39250G>T (p.Val13084Leu) rs72650062
NM_001267550.2(TTN):c.39274C>T (p.Pro13092Ser) rs794729421
NM_001267550.2(TTN):c.39282_39284TCC[1] (p.Pro13097del) rs727503631
NM_001267550.2(TTN):c.39284C>A (p.Pro13095His) rs770419196
NM_001267550.2(TTN):c.39301G>A (p.Glu13101Lys) rs201035457
NM_001267550.2(TTN):c.39325G>C (p.Glu13109Gln) rs727504920
NM_001267550.2(TTN):c.39344T>C (p.Val13115Ala) rs762713897
NM_001267550.2(TTN):c.39385G>A (p.Val13129Ile) rs774557269
NM_001267550.2(TTN):c.39419C>T (p.Ala13140Val) rs397517556
NM_001267550.2(TTN):c.39457G>A (p.Val13153Met) rs377259883
NM_001267550.2(TTN):c.39463+1G>A rs1553770003
NM_001267550.2(TTN):c.39466C>A (p.Pro13156Thr) rs72650064
NM_001267550.2(TTN):c.39472G>A (p.Val13158Met) rs876658056
NM_001267550.2(TTN):c.39548-8A>G rs369594816
NM_001267550.2(TTN):c.39578A>G (p.Glu13193Gly) rs190461403
NM_001267550.2(TTN):c.39616C>G (p.Pro13206Ala) rs186404793
NM_001267550.2(TTN):c.39649G>T (p.Val13217Phe) rs371284928
NM_001267550.2(TTN):c.39819_39820delinsTT (p.Pro13274Ser) rs727503630
NM_001267550.2(TTN):c.39883C>A (p.Pro13295Thr) rs749860520
NM_001267550.2(TTN):c.39895G>A (p.Glu13299Lys) rs758166967
NM_001267550.2(TTN):c.40315G>T (p.Val13439Phe) rs397517559
NM_001267550.2(TTN):c.40352C>A (p.Pro13451His) rs370048456
NM_001267550.2(TTN):c.40502G>A (p.Arg13501His) rs571348685
NM_001267550.2(TTN):c.40543G>A (p.Val13515Ile) rs727504200
NM_001267550.2(TTN):c.40576_40578GAA[3] (p.Glu13529del) rs727504199
NM_001267550.2(TTN):c.40600C>T (p.Pro13534Ser) rs770091359
NM_001267550.2(TTN):c.40634-15_40634-11del rs375561641
NM_001267550.2(TTN):c.40688C>T (p.Thr13563Ile) rs780572853
NM_001267550.2(TTN):c.40723+1del rs876658058
NM_001267550.2(TTN):c.40796C>T (p.Thr13599Ile) rs370418677
NM_001267550.2(TTN):c.40877-14T>C rs397517561
NM_001267550.2(TTN):c.40877-7A>G rs727505201
NM_001267550.2(TTN):c.40903G>A (p.Ala13635Thr) rs191699632
NM_001267550.2(TTN):c.40956A>G (p.Ile13652Met) rs397517562
NM_001267550.2(TTN):c.40973A>G (p.Lys13658Arg) rs184713215
NM_001267550.2(TTN):c.41041G>A (p.Val13681Met) rs794729423
NM_001267550.2(TTN):c.41104T>C (p.Ser13702Pro) rs72650078
NM_001267550.2(TTN):c.41124T>G (p.Cys13708Trp) rs794729424
NM_001267550.2(TTN):c.41140A>G (p.Thr13714Ala) rs876658057
NM_001267550.2(TTN):c.41179C>G (p.Arg13727Gly) rs397517563
NM_001267550.2(TTN):c.41342G>A (p.Arg13781His) rs370878642
NM_001267550.2(TTN):c.41407G>A (p.Glu13803Lys) rs727504780
NM_001267550.2(TTN):c.41428G>A (p.Val13810Met) rs763668057
NM_001267550.2(TTN):c.41474G>A (p.Arg13825Gln) rs727504774
NM_001267550.2(TTN):c.41504G>A (p.Arg13835Gln) rs727504539
NM_001267550.2(TTN):c.41521G>A (p.Asp13841Asn) rs201257644
NM_001267550.2(TTN):c.41548T>C (p.Tyr13850His) rs774281208
NM_001267550.2(TTN):c.416G>A (p.Arg139Gln) rs780003580
NM_001267550.2(TTN):c.41G>T (p.Ser14Ile) rs771027745
NM_001267550.2(TTN):c.42046G>A (p.Gly14016Ser) rs367751077
NM_001267550.2(TTN):c.42055C>T (p.Arg14019Cys) rs763499817
NM_001267550.2(TTN):c.42056G>A (p.Arg14019His) rs374683153
NM_001267550.2(TTN):c.42085G>A (p.Asp14029Asn) rs794729426
NM_001267550.2(TTN):c.42190A>G (p.Thr14064Ala) rs769719800
NM_001267550.2(TTN):c.42214C>T (p.Arg14072Ter) rs794729258
NM_001267550.2(TTN):c.42278A>G (p.Lys14093Arg) rs1553743733
NM_001267550.2(TTN):c.42329T>C (p.Val14110Ala) rs34706299
NM_001267550.2(TTN):c.42421A>G (p.Arg14141Gly) rs397517567
NM_001267550.2(TTN):c.42473C>T (p.Thr14158Ile) rs373227762
NM_001267550.2(TTN):c.42509T>C (p.Met14170Thr) rs369623392
NM_001267550.2(TTN):c.42545A>C (p.His14182Pro) rs794729428
NM_001267550.2(TTN):c.42649G>A (p.Glu14217Lys) rs727503629
NM_001267550.2(TTN):c.42829A>T (p.Ile14277Phe) rs397517568
NM_001267550.2(TTN):c.42934G>A (p.Val14312Ile) rs794729429
NM_001267550.2(TTN):c.42947-2A>G rs1553741357
NM_001267550.2(TTN):c.42950G>A (p.Arg14317Gln) rs727505144
NM_001267550.2(TTN):c.42950G>C (p.Arg14317Pro) rs727505144
NM_001267550.2(TTN):c.43019T>C (p.Ile14340Thr) rs397517571
NM_001267550.2(TTN):c.43051T>G (p.Trp14351Gly) rs794729430
NM_001267550.2(TTN):c.43069C>G (p.Pro14357Ala) rs750958593
NM_001267550.2(TTN):c.43100T>C (p.Ile14367Thr) rs397517572
NM_001267550.2(TTN):c.43138T>C (p.Cys14380Arg) rs557125278
NM_001267550.2(TTN):c.43244G>A (p.Ser14415Asn) rs370342831
NM_001267550.2(TTN):c.43315C>T (p.Arg14439Cys) rs200914097
NM_001267550.2(TTN):c.43372delinsAA (p.Asp14458fs) rs1553739374
NM_001267550.2(TTN):c.43417G>C (p.Asp14473His) rs397517573
NM_001267550.2(TTN):c.43577G>A (p.Arg14526Gln) rs373491468
NM_001267550.2(TTN):c.43600C>T (p.Gln14534Ter) rs727504499
NM_001267550.2(TTN):c.43604G>A (p.Arg14535His) rs764250397
NM_001267550.2(TTN):c.43669G>A (p.Asp14557Asn) rs794729431
NM_001267550.2(TTN):c.43702G>A (p.Val14568Ile) rs372384272
NM_001267550.2(TTN):c.43717A>G (p.Met14573Val) rs755610701
NM_001267550.2(TTN):c.43727_43728del (p.Glu14576fs) rs794729316
NM_001267550.2(TTN):c.43747+2T>C rs878854384
NM_001267550.2(TTN):c.43978G>A (p.Gly14660Arg) rs762795774
NM_001267550.2(TTN):c.43984G>C (p.Asp14662His) rs876658059
NM_001267550.2(TTN):c.43G>A (p.Val15Ile) rs201857541
NM_001267550.2(TTN):c.44020G>A (p.Glu14674Lys) rs794729432
NM_001267550.2(TTN):c.44077C>T (p.Arg14693Cys) rs200445568
NM_001267550.2(TTN):c.44104G>C (p.Asp14702His) rs727503627
NM_001267550.2(TTN):c.44284C>T (p.Arg14762Ter) rs770767998
NM_001267550.2(TTN):c.44285G>A (p.Arg14762Gln) rs727505019
NM_001267550.2(TTN):c.44350G>A (p.Asp14784Asn) rs72677216
NM_001267550.2(TTN):c.44366A>G (p.Tyr14789Cys) rs397517577
NM_001267550.2(TTN):c.44390A>G (p.Tyr14797Cys) rs876658060
NM_001267550.2(TTN):c.44400del (p.Lys14801fs) rs727503628
NM_001267550.2(TTN):c.44423A>C (p.Lys14808Thr) rs374419129
NM_001267550.2(TTN):c.44481_44483AGA[1] (p.Glu14828del) rs727505315
NM_001267550.2(TTN):c.44531C>G (p.Ala14844Gly) rs1053826157
NM_001267550.2(TTN):c.44593G>A (p.Glu14865Lys) rs543102139
NM_001267550.2(TTN):c.44734C>T (p.His14912Tyr) rs766391823
NM_001267550.2(TTN):c.44882T>C (p.Phe14961Ser) rs794729433
NM_001267550.2(TTN):c.44899C>T (p.Arg14967Ter) rs727505350
NM_001267550.2(TTN):c.44970A>G (p.Ile14990Met) rs766807618
NM_001267550.2(TTN):c.44978G>A (p.Gly14993Glu) rs200931793
NM_001267550.2(TTN):c.44987G>A (p.Arg14996His) rs762128685
NM_001267550.2(TTN):c.45001A>C (p.Asn15001His) rs373109469
NM_001267550.2(TTN):c.45059C>A (p.Thr15020Asn) rs755201448
NM_001267550.2(TTN):c.45082+6A>G rs876658061
NM_001267550.2(TTN):c.45088G>C (p.Glu15030Gln) rs794729434
NM_001267550.2(TTN):c.45143T>C (p.Ile15048Thr) rs727505261
NM_001267550.2(TTN):c.45192del (p.Trp15063_Tyr15064insTer) rs1553718908
NM_001267550.2(TTN):c.45212T>C (p.Ile15071Thr) rs184078045
NM_001267550.2(TTN):c.45247C>T (p.Arg15083Trp) rs199834143
NM_001267550.2(TTN):c.45268C>A (p.Gln15090Lys) rs397517579
NM_001267550.2(TTN):c.45329A>G (p.Asp15110Gly) rs794729436
NM_001267550.2(TTN):c.45338T>C (p.Val15113Ala) rs794729437
NM_001267550.2(TTN):c.45510_45519delinsC (p.Gly15171_Lys15173del) rs1553717747
NM_001267550.2(TTN):c.45601C>G (p.His15201Asp) rs794729438
NM_001267550.2(TTN):c.45724A>G (p.Arg15242Gly) rs373778707
NM_001267550.2(TTN):c.45725G>A (p.Arg15242Lys) rs140795503
NM_001267550.2(TTN):c.45855A>T (p.Arg15285Ser) rs794729439
NM_001267550.2(TTN):c.45895G>A (p.Glu15299Lys) rs397517582
NM_001267550.2(TTN):c.46065G>C (p.Lys15355Asn) rs397517583
NM_001267550.2(TTN):c.46078_46092del (p.Ile15360_Gly15364del) rs727505075
NM_001267550.2(TTN):c.46150C>G (p.Leu15384Val) rs727505078
NM_001267550.2(TTN):c.46160T>C (p.Ile15387Thr) rs397517585
NM_001267550.2(TTN):c.46306T>C (p.Tyr15436His) rs748548136
NM_001267550.2(TTN):c.46363G>A (p.Asp15455Asn) rs370813526
NM_001267550.2(TTN):c.46369G>A (p.Glu15457Lys) rs753664074
NM_001267550.2(TTN):c.46451G>A (p.Arg15484Lys) rs72677229
NM_001267550.2(TTN):c.46489G>T (p.Val15497Phe) rs371299188
NM_001267550.2(TTN):c.46521_46601del (p.Lys15507_His15534delinsAsn) rs1553713878
NM_001267550.2(TTN):c.46611G>T (p.Gln15537His) rs727503625
NM_001267550.2(TTN):c.46647C>G (p.Tyr15549Ter) rs1553713779
NM_001267550.2(TTN):c.46667_46669AAG[1] (p.Glu15557del) rs876658062
NM_001267550.2(TTN):c.46823T>C (p.Leu15608Ser) rs397517588
NM_001267550.2(TTN):c.46847C>T (p.Thr15616Met) rs368057764
NM_001267550.2(TTN):c.46928A>G (p.His15643Arg) rs368502650
NM_001267550.2(TTN):c.46951A>G (p.Asn15651Asp) rs727505035
NM_001267550.2(TTN):c.46966G>A (p.Asp15656Asn) rs727504572
NM_001267550.2(TTN):c.46973C>T (p.Pro15658Leu) rs794729440
NM_001267550.2(TTN):c.47089C>T (p.Arg15697Cys) rs780334981
NM_001267550.2(TTN):c.47211A>C (p.Arg15737Ser) rs727503624
NM_001267550.2(TTN):c.47242A>C (p.Asn15748His) rs368988689
NM_001267550.2(TTN):c.47278G>A (p.Gly15760Ser) rs372404266
NM_001267550.2(TTN):c.47407A>G (p.Ile15803Val) rs794729441
NM_001267550.2(TTN):c.47513G>A (p.Arg15838Gln) rs199640194
NM_001267550.2(TTN):c.47516T>C (p.Ile15839Thr) rs764388462
NM_001267550.2(TTN):c.47550C>G (p.Phe15850Leu) rs113350914
NM_001267550.2(TTN):c.47758A>C (p.Lys15920Gln) rs775513269
NM_001267550.2(TTN):c.47767G>A (p.Gly15923Arg) rs371943746
NM_001267550.2(TTN):c.47836T>C (p.Ser15946Pro) rs369663023
NM_001267550.2(TTN):c.47860G>A (p.Ala15954Thr) rs377037421
NM_001267550.2(TTN):c.47887A>G (p.Met15963Val) rs397517590
NM_001267550.2(TTN):c.47892T>G (p.Asp15964Glu) rs727503623
NM_001267550.2(TTN):c.47978C>A (p.Thr15993Asn) rs727503622
NM_001267550.2(TTN):c.47998G>C (p.Asp16000His) rs201388509
NM_001267550.2(TTN):c.48074G>A (p.Ser16025Asn) rs727504720
NM_001267550.2(TTN):c.48094A>G (p.Ile16032Val) rs794729443
NM_001267550.2(TTN):c.48161-11dup rs730880371
NM_001267550.2(TTN):c.48164G>A (p.Arg16055His) rs72677238
NM_001267550.2(TTN):c.48334C>G (p.Leu16112Val) rs747917712
NM_001267550.2(TTN):c.48353A>G (p.Asp16118Gly) rs376273101
NM_001267550.2(TTN):c.48359T>C (p.Val16120Ala) rs745999025
NM_001267550.2(TTN):c.48395G>A (p.Arg16132His) rs397517593
NM_001267550.2(TTN):c.48451A>C (p.Thr16151Pro) rs186497293
NM_001267550.2(TTN):c.48457G>T (p.Ala16153Ser) rs876658063
NM_001267550.2(TTN):c.48500G>C (p.Arg16167Pro) rs778774812
NM_001267550.2(TTN):c.48557G>T (p.Arg16186Leu) rs769784536
NM_001267550.2(TTN):c.48590G>A (p.Arg16197His) rs369826752
NM_001267550.2(TTN):c.485T>A (p.Leu162Gln) rs145438758
NM_001267550.2(TTN):c.48638+5G>T rs397517594
NM_001267550.2(TTN):c.48682C>T (p.Arg16228Cys) rs371305932
NM_001267550.2(TTN):c.48766C>A (p.Pro16256Thr) rs750232795
NM_001267550.2(TTN):c.48845T>C (p.Val16282Ala) rs878854396
NM_001267550.2(TTN):c.48851G>A (p.Gly16284Glu) rs794729444
NM_001267550.2(TTN):c.48953T>C (p.Ile16318Thr) rs72677243
NM_001267550.2(TTN):c.49016G>A (p.Arg16339Gln) rs558487304
NM_001267550.2(TTN):c.49070C>T (p.Ala16357Val) rs199768159
NM_001267550.2(TTN):c.49114T>C (p.Trp16372Arg) rs794729445
NM_001267550.2(TTN):c.49126C>T (p.Arg16376Cys) rs772152172
NM_001267550.2(TTN):c.49172G>A (p.Arg16391Gln) rs200944827
NM_001267550.2(TTN):c.49174G>A (p.Ala16392Thr) rs794729446
NM_001267550.2(TTN):c.49189G>A (p.Val16397Met) rs397517595
NM_001267550.2(TTN):c.49201C>G (p.Leu16401Val) rs794729447
NM_001267550.2(TTN):c.49258G>A (p.Glu16420Lys) rs764682084
NM_001267550.2(TTN):c.49366C>T (p.Arg16456Cys) rs727504986
NM_001267550.2(TTN):c.49379C>G (p.Ser16460Cys) rs397517596
NM_001267550.2(TTN):c.49396G>A (p.Ala16466Thr) rs755998484
NM_001267550.2(TTN):c.49413G>T (p.Trp16471Cys) rs202094100
NM_001267550.2(TTN):c.4960C>G (p.Pro1654Ala) rs876658070
NM_001267550.2(TTN):c.49649-11T>C rs727504474
NM_001267550.2(TTN):c.49732G>T (p.Asp16578Tyr) rs727505143
NM_001267550.2(TTN):c.49814T>G (p.Val16605Gly) rs781195013
NM_001267550.2(TTN):c.4990C>T (p.Arg1664Trp) rs147695336
NM_001267550.2(TTN):c.49936C>T (p.Arg16646Trp) rs794729448
NM_001267550.2(TTN):c.49942A>G (p.Lys16648Glu) rs727505156
NM_001267550.2(TTN):c.49955C>T (p.Pro16652Leu) rs727504966
NM_001267550.2(TTN):c.49963C>T (p.Pro16655Ser) rs794729449
NM_001267550.2(TTN):c.49971G>T (p.Trp16657Cys) rs794729450
NM_001267550.2(TTN):c.49978G>A (p.Val16660Ile) rs757016105
NM_001267550.2(TTN):c.50084G>A (p.Arg16695Gln) rs794729451
NM_001267550.2(TTN):c.50249-15T>G rs727504732
NM_001267550.2(TTN):c.50355-5A>G rs1553697218
NM_001267550.2(TTN):c.50355A>G (p.Arg16785=) rs192143556
NM_001267550.2(TTN):c.50363T>C (p.Ile16788Thr) rs397517599
NM_001267550.2(TTN):c.50390G>A (p.Arg16797His) rs200835354
NM_001267550.2(TTN):c.50452G>A (p.Glu16818Lys) rs397517600
NM_001267550.2(TTN):c.50479C>T (p.Arg16827Trp) rs727503620
NM_001267550.2(TTN):c.50480G>A (p.Arg16827Gln) rs138896856
NM_001267550.2(TTN):c.50494G>A (p.Ala16832Thr) rs1465354124
NM_001267550.2(TTN):c.50614G>C (p.Ala16872Pro) rs727503619
NM_001267550.2(TTN):c.50642G>C (p.Gly16881Ala) rs201302681
NM_001267550.2(TTN):c.50647C>T (p.Pro16883Ser) rs397517602
NM_001267550.2(TTN):c.50669A>C (p.Glu16890Ala) rs752204728
NM_001267550.2(TTN):c.50714G>A (p.Arg16905His) rs191539637
NM_001267550.2(TTN):c.50758C>G (p.Pro16920Ala) rs377289817
NM_001267550.2(TTN):c.50774T>C (p.Val16925Ala) rs370067597
NM_001267550.2(TTN):c.50797G>A (p.Ala16933Thr) rs794729452
NM_001267550.2(TTN):c.50812G>C (p.Glu16938Gln) rs72677250
NM_001267550.2(TTN):c.50869A>G (p.Ile16957Val) rs372013419
NM_001267550.2(TTN):c.51067G>A (p.Gly17023Arg) rs745424139
NM_001267550.2(TTN):c.51134T>C (p.Ile17045Thr) rs111933113
NM_001267550.2(TTN):c.51142C>T (p.Pro17048Ser) rs769444545
NM_001267550.2(TTN):c.51185G>A (p.Ser17062Asn) rs876658064
NM_001267550.2(TTN):c.51187T>C (p.Ser17063Pro) rs758563428
NM_001267550.2(TTN):c.51221A>G (p.Asp17074Gly) rs1553693510
NM_001267550.2(TTN):c.51247G>T (p.Val17083Phe) rs746817480
NM_001267550.2(TTN):c.5132C>T (p.Ser1711Phe) rs397517641
NM_001267550.2(TTN):c.51338C>T (p.Pro17113Leu) rs763635220
NM_001267550.2(TTN):c.51379G>T (p.Val17127Phe) rs397517603
NM_001267550.2(TTN):c.51437-9G>A rs183060991
NM_001267550.2(TTN):c.51439C>A (p.Pro17147Thr) rs876658065
NM_001267550.2(TTN):c.51547A>T (p.Ile17183Phe) rs397517605
NM_001267550.2(TTN):c.51565A>G (p.Lys17189Glu) rs727503618
NM_001267550.2(TTN):c.51579G>C (p.Arg17193Ser) rs759285989
NM_001267550.2(TTN):c.51668G>A (p.Arg17223Gln) rs142395261
NM_001267550.2(TTN):c.51711_51713TCC[1] (p.Pro17239del) rs776868393
NM_001267550.2(TTN):c.51768C>A (p.Ser17256Arg) rs794729454
NM_001267550.2(TTN):c.51782G>A (p.Arg17261Gln) rs201825412
NM_001267550.2(TTN):c.51841T>C (p.Trp17281Arg) rs368846015
NM_001267550.2(TTN):c.51887G>A (p.Arg17296His) rs200456782
NM_001267550.2(TTN):c.51896C>T (p.Pro17299Leu) rs369648778
NM_001267550.2(TTN):c.5192A>G (p.Asp1731Gly) rs876658072
NM_001267550.2(TTN):c.51961C>T (p.Arg17321Cys) rs752764827
NM_001267550.2(TTN):c.5198C>T (p.Thr1733Met) rs367700246
NM_001267550.2(TTN):c.52004G>A (p.Arg17335His) rs367603302
NM_001267550.2(TTN):c.52042A>G (p.Met17348Val) rs780570190
NM_001267550.2(TTN):c.52061A>T (p.Asp17354Val) rs397517606
NM_001267550.2(TTN):c.52112G>A (p.Gly17371Glu) rs794729455
NM_001267550.2(TTN):c.52139A>T (p.Asp17380Val) rs373305248
NM_001267550.2(TTN):c.52144A>G (p.Arg17382Gly) rs397517607
NM_001267550.2(TTN):c.52181T>C (p.Leu17394Pro) rs727503616
NM_001267550.2(TTN):c.52199A>C (p.Glu17400Ala) rs773027240
NM_001267550.2(TTN):c.52223A>C (p.Lys17408Thr) rs876658066
NM_001267550.2(TTN):c.52243G>A (p.Asp17415Asn) rs397517609
NM_001267550.2(TTN):c.52330C>T (p.Arg17444Cys) rs778094750
NM_001267550.2(TTN):c.52406-6T>A rs727504767
NM_001267550.2(TTN):c.52414G>A (p.Asp17472Asn) rs727503614
NM_001267550.2(TTN):c.52448C>T (p.Thr17483Ile) rs1553688779
NM_001267550.2(TTN):c.52561A>G (p.Lys17521Glu) rs794729456
NM_001267550.2(TTN):c.52589A>G (p.Asn17530Ser) rs762214300
NM_001267550.2(TTN):c.5264A>G (p.Asn1755Ser) rs201904897
NM_001267550.2(TTN):c.52656_52684delinsCAGATCCCAAAACAGATCCC (p.Gly17553_Lys17562delinsArgSerGlnAsnArgSerGln) rs727503613
NM_001267550.2(TTN):c.52667G>A (p.Ser17556Asn) rs750715335
NM_001267550.2(TTN):c.52681C>A (p.Pro17561Thr) rs727503612
NM_001267550.2(TTN):c.52693C>G (p.His17565Asp) rs370126872
NM_001267550.2(TTN):c.52702A>G (p.Ile17568Val) rs377571654
NM_001267550.2(TTN):c.52792G>C (p.Gly17598Arg) rs771936047
NM_001267550.2(TTN):c.52826A>T (p.Gln17609Leu) rs368820294
NM_001267550.2(TTN):c.52831G>A (p.Val17611Ile) rs748265704
NM_001267550.2(TTN):c.52852C>T (p.Arg17618Cys) rs201213901
NM_001267550.2(TTN):c.52853G>A (p.Arg17618His) rs371538664
NM_001267550.2(TTN):c.52927C>T (p.Arg17643Trp) rs375944265
NM_001267550.2(TTN):c.52948G>A (p.Ala17650Thr) rs535008556
NM_001267550.2(TTN):c.53012C>T (p.Ala17671Val) rs549478203
NM_001267550.2(TTN):c.53055G>A (p.Met17685Ile) rs200387466
NM_001267550.2(TTN):c.53060G>T (p.Gly17687Val) rs780672348
NM_001267550.2(TTN):c.53080G>C (p.Ala17694Pro) rs727503611
NM_001267550.2(TTN):c.53096G>C (p.Arg17699Pro) rs72646808
NM_001267550.2(TTN):c.53149C>T (p.Arg17717Cys) rs369001587
NM_001267550.2(TTN):c.5314A>G (p.Ser1772Gly) rs150725992
NM_001267550.2(TTN):c.53180C>G (p.Ser17727Cys) rs369262757
NM_001267550.2(TTN):c.53213A>T (p.Asp17738Val) rs773447539
NM_001267550.2(TTN):c.53260T>C (p.Phe17754Leu) rs397517612
NM_001267550.2(TTN):c.53287+1G>A
NM_001267550.2(TTN):c.53390C>T (p.Thr17797Ile) rs727503610
NM_001267550.2(TTN):c.53517_53519del (p.Lys17840del) rs727504701
NM_001267550.2(TTN):c.5354C>G (p.Thr1785Arg) rs397517649
NM_001267550.2(TTN):c.53558C>G (p.Pro17853Arg) rs727503609
NM_001267550.2(TTN):c.53582-6C>G rs727503608
NM_001267550.2(TTN):c.53594C>T (p.Ser17865Phe) rs753095229
NM_001267550.2(TTN):c.53659C>T (p.Arg17887Cys) rs771307468
NM_001267550.2(TTN):c.53696T>C (p.Ile17899Thr) rs369723141
NM_001267550.2(TTN):c.53717A>G (p.Lys17906Arg) rs727503606
NM_001267550.2(TTN):c.53807G>A (p.Arg17936His) rs727503604
NM_001267550.2(TTN):c.53903G>A (p.Arg17968His) rs200100660
NM_001267550.2(TTN):c.53915G>A (p.Arg17972Gln) rs377169251
NM_001267550.2(TTN):c.53924C>G (p.Thr17975Ser) rs727503605
NM_001267550.2(TTN):c.5397T>G (p.Ser1799Arg) rs797046065
NM_001267550.2(TTN):c.54057A>C (p.Glu18019Asp) rs397517614
NM_001267550.2(TTN):c.54068G>A (p.Arg18023Gln) rs727503603
NM_001267550.2(TTN):c.54091A>G (p.Ser18031Gly) rs397517615
NM_001267550.2(TTN):c.54104C>T (p.Ala18035Val) rs182445366
NM_001267550.2(TTN):c.54109C>T (p.Arg18037Trp) rs201623791
NM_001267550.2(TTN):c.54130A>G (p.Thr18044Ala) rs397517616
NM_001267550.2(TTN):c.54160G>C (p.Val18054Leu) rs200968679
NM_001267550.2(TTN):c.54166C>T (p.Arg18056Ter) rs768431507
NM_001267550.2(TTN):c.54167G>A (p.Arg18056Gln) rs376932266
NM_001267550.2(TTN):c.54178G>A (p.Val18060Ile) rs190574498
NM_001267550.2(TTN):c.54188A>G (p.Tyr18063Cys) rs397517617
NM_001267550.2(TTN):c.5418G>T (p.Leu1806Phe) rs397517650
NM_001267550.2(TTN):c.54193C>T (p.Arg18065Cys) rs369438623
NM_001267550.2(TTN):c.5423A>C (p.Glu1808Ala) rs746238242
NM_001267550.2(TTN):c.54320C>G (p.Ala18107Gly) rs794729457
NM_001267550.2(TTN):c.54380G>C (p.Gly18127Ala) rs371971395
NM_001267550.2(TTN):c.54381+6C>G rs368265962
NM_001267550.2(TTN):c.54419G>A (p.Arg18140Gln) rs547224785
NM_001267550.2(TTN):c.54490T>C (p.Tyr18164His) rs370135374
NM_001267550.2(TTN):c.54493C>T (p.Arg18165Cys) rs377575788
NM_001267550.2(TTN):c.54517C>T (p.Pro18173Ser) rs766074604
NM_001267550.2(TTN):c.54518C>A (p.Pro18173Gln) rs794729458
NM_001267550.2(TTN):c.54541G>C (p.Gly18181Arg) rs761810379
NM_001267550.2(TTN):c.54632C>G (p.Pro18211Arg) rs764772164
NM_001267550.2(TTN):c.54685G>A (p.Val18229Met) rs116142642
NM_001267550.2(TTN):c.54710T>C (p.Leu18237Pro) rs201412693
NM_001267550.2(TTN):c.54740T>C (p.Met18247Thr) rs200585270
NM_001267550.2(TTN):c.54796G>T (p.Ala18266Ser) rs199837769
NM_001267550.2(TTN):c.54812T>G (p.Phe18271Cys) rs727503601
NM_001267550.2(TTN):c.54813T>G (p.Phe18271Leu) rs370583314
NM_001267550.2(TTN):c.54818C>T (p.Pro18273Leu) rs201035511
NM_001267550.2(TTN):c.54854C>T (p.Thr18285Met) rs761825854
NM_001267550.2(TTN):c.54874G>C (p.Gly18292Arg) rs377512675
NM_001267550.2(TTN):c.55015C>A (p.Leu18339Met) rs773396552
NM_001267550.2(TTN):c.5503C>A (p.Gln1835Lys) rs537070177
NM_001267550.2(TTN):c.55139T>C (p.Ile18380Thr) rs72646819
NM_001267550.2(TTN):c.55269G>C (p.Lys18423Asn) rs367799017
NM_001267550.2(TTN):c.55270-3T>C rs749109513
NM_001267550.2(TTN):c.55270-8T>G rs770659997
NM_001267550.2(TTN):c.55306G>A (p.Glu18436Lys) rs201510986
NM_001267550.2(TTN):c.55315G>A (p.Glu18439Lys) rs866683190
NM_001267550.2(TTN):c.55340C>T (p.Pro18447Leu) rs397517622
NM_001267550.2(TTN):c.55346G>A (p.Cys18449Tyr) rs794729459
NM_001267550.2(TTN):c.5534T>G (p.Leu1845Trp) rs794729576
NM_001267550.2(TTN):c.55374C>G (p.Ser18458Arg) rs200550947
NM_001267550.2(TTN):c.55378A>G (p.Thr18460Ala) rs727503600
NM_001267550.2(TTN):c.55379C>T (p.Thr18460Ile) rs372778818
NM_001267550.2(TTN):c.55396G>A (p.Gly18466Arg) rs772677752
NM_001267550.2(TTN):c.55417A>G (p.Arg18473Gly) rs72646822
NM_001267550.2(TTN):c.55418del (p.Arg18473fs) rs878854380
NM_001267550.2(TTN):c.55598G>A (p.Cys18533Tyr) rs727503599
NM_001267550.2(TTN):c.55673G>A (p.Arg18558His) rs115867512
NM_001267550.2(TTN):c.55745C>T (p.Pro18582Leu) rs201194435
NM_001267550.2(TTN):c.55804C>T (p.Pro18602Ser) rs781300931
NM_001267550.2(TTN):c.55805C>A (p.Pro18602His) rs559554374
NM_001267550.2(TTN):c.5582G>A (p.Arg1861His) rs140914855
NM_001267550.2(TTN):c.55880A>C (p.Lys18627Thr) rs727503597
NM_001267550.2(TTN):c.55915G>A (p.Val18639Met) rs727503596
NM_001267550.2(TTN):c.55925T>A (p.Leu18642Gln) rs140714512
NM_001267550.2(TTN):c.55952A>G (p.Glu18651Gly) rs876658067
NM_001267550.2(TTN):c.55973G>A (p.Arg18658Gln) rs370888932
NM_001267550.2(TTN):c.56150C>T (p.Thr18717Ile) rs794729460
NM_001267550.2(TTN):c.56234A>T (p.Asp18745Val) rs794729461
NM_001267550.2(TTN):c.56255C>T (p.Pro18752Leu) rs200132226
NM_001267550.2(TTN):c.56296G>C (p.Ala18766Pro) rs727505268
NM_001267550.2(TTN):c.5644C>T (p.Arg1882Cys) rs397517658
NM_001267550.2(TTN):c.56533A>C (p.Thr18845Pro) rs375000725
NM_001267550.2(TTN):c.56535G>A (p.Thr18845=) rs529480368
NM_001267550.2(TTN):c.56557C>T (p.His18853Tyr) rs397517623
NM_001267550.2(TTN):c.565G>T (p.Ala189Ser) rs794729610
NM_001267550.2(TTN):c.56619T>G (p.Ser18873Arg) rs794729462
NM_001267550.2(TTN):c.5665G>T (p.Val1889Phe) rs141105443
NM_001267550.2(TTN):c.5668C>T (p.Arg1890Cys) rs146496197
NM_001267550.2(TTN):c.56747T>A (p.Val18916Glu) rs1296926879
NM_001267550.2(TTN):c.56788A>G (p.Arg18930Gly) rs727503595
NM_001267550.2(TTN):c.56801T>A (p.Val18934Asp) rs1553663624
NM_001267550.2(TTN):c.5683C>T (p.His1895Tyr) rs794729577
NM_001267550.2(TTN):c.56872G>A (p.Asp18958Asn) rs576158850
NM_001267550.2(TTN):c.56900A>G (p.Asn18967Ser) rs727503594
NM_001267550.2(TTN):c.56942C>T (p.Ala18981Val) rs397517627
NM_001267550.2(TTN):c.56947G>A (p.Ala18983Thr) rs377000174
NM_001267550.2(TTN):c.56956C>A (p.Pro18986Thr) rs568015697
NM_001267550.2(TTN):c.56963-3C>T rs375979145
NM_001267550.2(TTN):c.5698G>A (p.Val1900Met) rs750823043
NM_001267550.2(TTN):c.57017A>G (p.Asp19006Gly) rs747343924
NM_001267550.2(TTN):c.57070A>G (p.Ile19024Val) rs876658068
NM_001267550.2(TTN):c.57073G>A (p.Val19025Ile) rs181957743
NM_001267550.2(TTN):c.57212T>C (p.Ile19071Thr) rs200001206
NM_001267550.2(TTN):c.57232A>G (p.Thr19078Ala) rs727503593
NM_001267550.2(TTN):c.57262G>T (p.Val19088Phe) rs727505347
NM_001267550.2(TTN):c.57292G>A (p.Val19098Ile) rs727503592
NM_001267550.2(TTN):c.57300T>G (p.Asp19100Glu) rs876658069
NM_001267550.2(TTN):c.57331C>T (p.Arg19111Ter) rs72646831
NM_001267550.2(TTN):c.57367A>G (p.Thr19123Ala) rs587782985
NM_001267550.2(TTN):c.57415A>C (p.Ile19139Leu) rs397517629
NM_001267550.2(TTN):c.57416T>C (p.Ile19139Thr) rs727503591
NM_001267550.2(TTN):c.5741C>T (p.Ala1914Val) rs374203813
NM_001267550.2(TTN):c.57442A>G (p.Met19148Val) rs188185141
NM_001267550.2(TTN):c.57586C>G (p.Leu19196Val) rs397517630
NM_001267550.2(TTN):c.57656A>T (p.Tyr19219Phe) rs201541213
NM_001267550.2(TTN):c.57686G>A (p.Arg19229Lys) rs778237029
NM_001267550.2(TTN):c.57693G>T (p.Trp19231Cys) rs876658071
NM_001267550.2(TTN):c.57769C>T (p.Arg19257Ter) rs794729275
NM_001267550.2(TTN):c.57844A>G (p.Ile19282Val) rs779849364
NM_001267550.2(TTN):c.57847+1G>A rs397517631
NM_001267550.2(TTN):c.57860G>A (p.Arg19287His) rs371422299
NM_001267550.2(TTN):c.57971G>A (p.Arg19324Gln) rs186809500
NM_001267550.2(TTN):c.5797G>A (p.Glu1933Lys) rs769734824
NM_001267550.2(TTN):c.58017G>C (p.Leu19339Phe) rs368025965
NM_001267550.2(TTN):c.58049_58051AAG[1] (p.Glu19351del) rs397517634
NM_001267550.2(TTN):c.58072C>T (p.Arg19358Cys) rs371973579
NM_001267550.2(TTN):c.58121C>G (p.Thr19374Ser) rs794729463
NM_001267550.2(TTN):c.58190C>T (p.Thr19397Met) rs373527448
NM_001267550.2(TTN):c.58208C>G (p.Ala19403Gly) rs573503792
NM_001267550.2(TTN):c.58274C>G (p.Ala19425Gly) rs727504525
NM_001267550.2(TTN):c.58363G>A (p.Gly19455Ser) rs191927501
NM_001267550.2(TTN):c.58394C>G (p.Thr19465Arg) rs571477228
NM_001267550.2(TTN):c.58426G>A (p.Val19476Ile) rs397517636
NM_001267550.2(TTN):c.58470T>G (p.Asp19490Glu) rs374118468
NM_001267550.2(TTN):c.5851G>A (p.Val1951Ile) rs765382880
NM_001267550.2(TTN):c.58576G>A (p.Val19526Ile) rs377682563
NM_001267550.2(TTN):c.58601G>A (p.Ser19534Asn) rs563833549
NM_001267550.2(TTN):c.58613C>A (p.Thr19538Lys) rs370686112
NM_001267550.2(TTN):c.58684A>G (p.Ile19562Val) rs397517637
NM_001267550.2(TTN):c.58705G>A (p.Asp19569Asn) rs397517638
NM_001267550.2(TTN):c.58711A>G (p.Met19571Val) rs770228515
NM_001267550.2(TTN):c.58775C>A (p.Thr19592Asn) rs745441183
NM_001267550.2(TTN):c.58796C>T (p.Thr19599Ile) rs367816473
NM_001267550.2(TTN):c.58897A>G (p.Ile19633Val) rs727505028
NM_001267550.2(TTN):c.58927G>A (p.Asp19643Asn) rs794729464
NM_001267550.2(TTN):c.58944T>G (p.Cys19648Trp) rs764728016
NM_001267550.2(TTN):c.58982G>A (p.Gly19661Asp) rs397517640
NM_001267550.2(TTN):c.59003C>T (p.Pro19668Leu) rs794729465
NM_001267550.2(TTN):c.59081G>A (p.Cys19694Tyr) rs727505276
NM_001267550.2(TTN):c.59092G>T (p.Asp19698Tyr) rs397517642
NM_001267550.2(TTN):c.59113C>T (p.Arg19705Cys) rs72646839
NM_001267550.2(TTN):c.59114G>A (p.Arg19705His) rs727503590
NM_001267550.2(TTN):c.5917A>G (p.Thr1973Ala) rs397517666
NM_001267550.2(TTN):c.59236G>A (p.Gly19746Ser) rs372802352
NM_001267550.2(TTN):c.59248G>A (p.Gly19750Ser) rs200732032
NM_001267550.2(TTN):c.59282A>G (p.Asn19761Ser) rs563969986
NM_001267550.2(TTN):c.5929G>A (p.Val1977Met) rs876658075
NM_001267550.2(TTN):c.59318A>G (p.Glu19773Gly) rs371719028
NM_001267550.2(TTN):c.59360T>A (p.Ile19787Asn) rs768765076
NM_001267550.2(TTN):c.59504T>G (p.Val19835Gly) rs727504511
NM_001267550.2(TTN):c.59570T>C (p.Leu19857Ser) rs547180437
NM_001267550.2(TTN):c.59618T>C (p.Leu19873Pro) rs727503589
NM_001267550.2(TTN):c.59632C>T (p.Pro19878Ser) rs752854931
NM_001267550.2(TTN):c.59657T>G (p.Val19886Gly) rs755949982
NM_001267550.2(TTN):c.59707G>A (p.Asp19903Asn) rs374163882
NM_001267550.2(TTN):c.59729C>T (p.Thr19910Ile) rs369476725
NM_001267550.2(TTN):c.59894C>T (p.Thr19965Ile) rs372266703
NM_001267550.2(TTN):c.59902C>T (p.Pro19968Ser) rs758407490
NM_001267550.2(TTN):c.59926C>T (p.His19976Tyr) rs727503588
NM_001267550.2(TTN):c.5992C>T (p.Arg1998Cys) rs727503692
NM_001267550.2(TTN):c.59966T>C (p.Val19989Ala) rs778982581
NM_001267550.2(TTN):c.60002C>T (p.Pro20001Leu) rs727505345
NM_001267550.2(TTN):c.60023C>T (p.Pro20008Leu) rs199839492
NM_001267550.2(TTN):c.60140G>A (p.Arg20047Lys) rs371060708
NM_001267550.2(TTN):c.60146G>A (p.Arg20049His) rs200455644
NM_001267550.2(TTN):c.60197C>T (p.Pro20066Leu) rs750217838
NM_001267550.2(TTN):c.60253A>T (p.Ile20085Phe) rs794729466
NM_001267550.2(TTN):c.6029A>G (p.Tyr2010Cys) rs397517672
NM_001267550.2(TTN):c.60314T>G (p.Val20105Gly) rs727504490
NM_001267550.2(TTN):c.60345T>A (p.Asp20115Glu) rs376618165
NM_001267550.2(TTN):c.60491T>A (p.Val20164Glu) rs794729467
NM_001267550.2(TTN):c.60524C>T (p.Pro20175Leu) rs771358314
NM_001267550.2(TTN):c.60571A>C (p.Ile20191Leu) rs745806239
NM_001267550.2(TTN):c.60721G>C (p.Glu20241Gln) rs200212521
NM_001267550.2(TTN):c.60746A>C (p.Glu20249Ala) rs397517646
NM_001267550.2(TTN):c.60876G>C (p.Trp20292Cys) rs397517647
NM_001267550.2(TTN):c.60932G>A (p.Arg20311Gln) rs373062007
NM_001267550.2(TTN):c.609G>C (p.Lys203Asn) rs1554042109
NM_001267550.2(TTN):c.61096T>A (p.Cys20366Ser) rs200101317
NM_001267550.2(TTN):c.61099C>T (p.Arg20367Trp) rs727504479
NM_001267550.2(TTN):c.61149G>C (p.Lys20383Asn) rs727504968
NM_001267550.2(TTN):c.61163C>G (p.Ala20388Gly) rs397517648
NM_001267550.2(TTN):c.61289G>A (p.Cys20430Tyr) rs527704660
NM_001267550.2(TTN):c.61366G>A (p.Gly20456Ser) rs756873840
NM_001267550.2(TTN):c.61409T>C (p.Ile20470Thr) rs202012910
NM_001267550.2(TTN):c.61456A>G (p.Ile20486Val) rs794729469
NM_001267550.2(TTN):c.61484G>A (p.Arg20495His) rs775137607
NM_001267550.2(TTN):c.61615G>A (p.Ala20539Thr) rs754756569
NM_001267550.2(TTN):c.61631A>G (p.His20544Arg) rs876658073
NM_001267550.2(TTN):c.61742T>G (p.Val20581Gly) rs727504849
NM_001267550.2(TTN):c.61776C>A (p.Asn20592Lys) rs554308191
NM_001267550.2(TTN):c.61915T>C (p.Tyr20639His) rs727503587
NM_001267550.2(TTN):c.61992C>G (p.Asn20664Lys) rs376455983
NM_001267550.2(TTN):c.62030T>C (p.Ile20677Thr) rs558670891
NM_001267550.2(TTN):c.62096C>T (p.Pro20699Leu) rs1553641061
NM_001267550.2(TTN):c.62272G>A (p.Glu20758Lys) rs794729470
NM_001267550.2(TTN):c.62275G>A (p.Glu20759Lys) rs562680371
NM_001267550.2(TTN):c.6227A>G (p.Glu2076Gly) rs397517680
NM_001267550.2(TTN):c.62290G>C (p.Glu20764Gln) rs397517651
NM_001267550.2(TTN):c.62459T>C (p.Ile20820Thr) rs369446270
NM_001267550.2(TTN):c.6250A>G (p.Ile2084Val) rs369388581
NM_001267550.2(TTN):c.62534C>G (p.Thr20845Arg) rs727505316
NM_001267550.2(TTN):c.62546C>T (p.Thr20849Met) rs372685222
NM_001267550.2(TTN):c.62572A>G (p.Thr20858Ala) rs200689750
NM_001267550.2(TTN):c.62644A>G (p.Thr20882Ala) rs538308579
NM_001267550.2(TTN):c.62723G>A (p.Arg20908Gln) rs377203669
NM_001267550.2(TTN):c.62761C>A (p.Pro20921Thr) rs935268567
NM_001267550.2(TTN):c.62780G>A (p.Arg20927His) rs397517652
NM_001267550.2(TTN):c.62786T>C (p.Ile20929Thr) rs794729471
NM_001267550.2(TTN):c.62931_62933AGA[1] (p.Glu20979del) rs727505236
NM_001267550.2(TTN):c.62995T>G (p.Phe20999Val) rs568886353
NM_001267550.2(TTN):c.63009G>C (p.Lys21003Asn) rs794729472
NM_001267550.2(TTN):c.63035C>T (p.Pro21012Leu) rs1476856667
NM_001267550.2(TTN):c.63065G>A (p.Arg21022His) rs727503585
NM_001267550.2(TTN):c.63065G>T (p.Arg21022Leu) rs727503585
NM_001267550.2(TTN):c.63131T>C (p.Ile21044Thr) rs529879601
NM_001267550.2(TTN):c.63181C>T (p.Pro21061Ser) rs375401971
NM_001267550.2(TTN):c.63185T>C (p.Ile21062Thr) rs575313522
NM_001267550.2(TTN):c.63185T>G (p.Ile21062Arg) rs575313522
NM_001267550.2(TTN):c.63187+5G>C rs1292388582
NM_001267550.2(TTN):c.63241A>T (p.Ile21081Leu) rs876658074
NM_001267550.2(TTN):c.63269A>T (p.Tyr21090Phe) rs377480514
NM_001267550.2(TTN):c.63272_63298dup (p.Asp21091_Tyr21099dup) rs750904641
NM_001267550.2(TTN):c.63352C>T (p.Arg21118Trp) rs200726948
NM_001267550.2(TTN):c.63353G>A (p.Arg21118Gln) rs755796313
NM_001267550.2(TTN):c.63463C>T (p.Arg21155Cys) rs374727686
NM_001267550.2(TTN):c.63554T>C (p.Ile21185Thr) rs794729473
NM_001267550.2(TTN):c.63577C>T (p.Arg21193Cys) rs376800688
NM_001267550.2(TTN):c.63578G>A (p.Arg21193His) rs372267046
NM_001267550.2(TTN):c.63581T>C (p.Leu21194Pro) rs367838375
NM_001267550.2(TTN):c.63589A>G (p.Ile21197Val) rs72646855
NM_001267550.2(TTN):c.63632T>C (p.Val21211Ala) rs397517654
NM_001267550.2(TTN):c.63641A>C (p.Asp21214Ala) rs779686062
NM_001267550.2(TTN):c.6368G>A (p.Arg2123Gln) rs530807674
NM_001267550.2(TTN):c.63743T>C (p.Leu21248Pro) rs745323281
NM_001267550.2(TTN):c.63800C>T (p.Pro21267Leu) rs200365508
NM_001267550.2(TTN):c.6380A>G (p.Tyr2127Cys) rs397517688
NM_001267550.2(TTN):c.63877G>A (p.Asp21293Asn) rs199505416
NM_001267550.2(TTN):c.63887G>A (p.Ser21296Asn) rs727503583
NM_001267550.2(TTN):c.64123G>A (p.Val21375Met) rs371670651
NM_001267550.2(TTN):c.64147G>A (p.Ala21383Thr) rs727503582
NM_001267550.2(TTN):c.64174C>T (p.Arg21392Cys) rs72646859
NM_001267550.2(TTN):c.64184G>C (p.Gly21395Ala) rs769161359
NM_001267550.2(TTN):c.64193T>G (p.Ile21398Ser) rs727504754
NM_001267550.2(TTN):c.64195G>A (p.Asp21399Asn) rs749018114
NM_001267550.2(TTN):c.6420T>A (p.Asp2140Glu) rs777009984
NM_001267550.2(TTN):c.64241G>A (p.Arg21414His) rs727504690
NM_001267550.2(TTN):c.64327G>A (p.Ala21443Thr) rs794729475
NM_001267550.2(TTN):c.64333A>G (p.Asn21445Asp) rs794729476
NM_001267550.2(TTN):c.64454G>A (p.Arg21485Gln) rs746903647
NM_001267550.2(TTN):c.64589C>T (p.Thr21530Ile) rs397517659
NM_001267550.2(TTN):c.64594A>G (p.Lys21532Glu) rs794729477
NM_001267550.2(TTN):c.64681G>A (p.Gly21561Ser) rs200355808
NM_001267550.2(TTN):c.64682G>T (p.Gly21561Val) rs111829923
NM_001267550.2(TTN):c.64688del (p.Pro21563fs) rs774395395
NM_001267550.2(TTN):c.64774A>G (p.Ile21592Val) rs727503581
NM_001267550.2(TTN):c.6478A>G (p.Thr2160Ala) rs397517693
NM_001267550.2(TTN):c.64826C>T (p.Thr21609Met) rs765913263
NM_001267550.2(TTN):c.64903C>T (p.Arg21635Cys) rs201614524
NM_001267550.2(TTN):c.65047C>A (p.Pro21683Thr) rs528707403
NM_001267550.2(TTN):c.65093G>T (p.Arg21698Leu) rs371581072
NM_001267550.2(TTN):c.65126C>T (p.Ala21709Val) rs794729479
NM_001267550.2(TTN):c.65144G>T (p.Arg21715Leu) rs368450785
NM_001267550.2(TTN):c.65158C>A (p.Pro21720Thr) rs776953525
NM_001267550.2(TTN):c.65161T>C (p.Cys21721Arg) rs745497694
NM_001267550.2(TTN):c.65179G>A (p.Gly21727Ser) rs756099303
NM_001267550.2(TTN):c.65182C>G (p.Leu21728Val) rs781121273
NM_001267550.2(TTN):c.65187G>A (p.Glu21729=) rs397517660
NM_001267550.2(TTN):c.65194T>C (p.Phe21732Leu) rs397517661
NM_001267550.2(TTN):c.65243C>T (p.Pro21748Leu) rs1419714561
NM_001267550.2(TTN):c.65369T>C (p.Ile21790Thr) rs727503580
NM_001267550.2(TTN):c.65371G>A (p.Gly21791Ser) rs370878527
NM_001267550.2(TTN):c.65459C>T (p.Thr21820Ile) rs56130023
NM_001267550.2(TTN):c.65515G>A (p.Ala21839Thr) rs56378177
NM_001267550.2(TTN):c.65534C>T (p.Pro21845Leu) rs201662134
NM_001267550.2(TTN):c.6555_6556insTGTAAGGAAACAGACA (p.Lys2186fs) rs587780494
NM_001267550.2(TTN):c.65574T>C (p.Asn21858=) rs374858668
NM_001267550.2(TTN):c.65649G>T (p.Leu21883Phe) rs374736305
NM_001267550.2(TTN):c.65672C>T (p.Pro21891Leu) rs397517662
NM_001267550.2(TTN):c.65746C>T (p.Arg21916Trp) rs200155485
NM_001267550.2(TTN):c.65782C>T (p.Arg21928Trp) rs371856109
NM_001267550.2(TTN):c.65794G>A (p.Gly21932Arg) rs373636513
NM_001267550.2(TTN):c.65819A>G (p.Asn21940Ser) rs762866554
NM_001267550.2(TTN):c.659G>A (p.Arg220Gln) rs794729621
NM_001267550.2(TTN):c.66086G>A (p.Arg22029His) rs72646868
NM_001267550.2(TTN):c.66172C>T (p.Arg22058Cys) rs199643269
NM_001267550.2(TTN):c.66275T>G (p.Leu22092Arg) rs1553627146
NM_001267550.2(TTN):c.66391A>G (p.Thr22131Ala) rs140842479
NM_001267550.2(TTN):c.66392C>T (p.Thr22131Ile) rs1553626919
NM_001267550.2(TTN):c.66430G>A (p.Ala22144Thr) rs183276016
NM_001267550.2(TTN):c.66479C>T (p.Pro22160Leu) rs777364605
NM_001267550.2(TTN):c.66491A>T (p.Lys22164Ile) rs371081043
NM_001267550.2(TTN):c.66568G>C (p.Gly22190Arg) rs757537780
NM_001267550.2(TTN):c.66589C>T (p.Arg22197Trp) rs774696610
NM_001267550.2(TTN):c.66590G>A (p.Arg22197Gln) rs374656017
NM_001267550.2(TTN):c.66610G>A (p.Val22204Met) rs376238023
NM_001267550.2(TTN):c.66616T>C (p.Cys22206Arg) rs794729480
NM_001267550.2(TTN):c.66650T>G (p.Phe22217Cys) rs764330098
NM_001267550.2(TTN):c.6668A>T (p.His2223Leu) rs372979075
NM_001267550.2(TTN):c.66707A>G (p.Asn22236Ser) rs771424887
NM_001267550.2(TTN):c.66778G>A (p.Glu22260Lys) rs553988103
NM_001267550.2(TTN):c.66877A>G (p.Ile22293Val) rs1241263120
NM_001267550.2(TTN):c.66917T>C (p.Ile22306Thr) rs397517667
NM_001267550.2(TTN):c.66959G>A (p.Arg22320His) rs771424865
NM_001267550.2(TTN):c.67063C>T (p.Pro22355Ser) rs794729481
NM_001267550.2(TTN):c.67097T>C (p.Ile22366Thr) rs794729482
NM_001267550.2(TTN):c.67104A>C (p.Lys22368Asn) rs727503577
NM_001267550.2(TTN):c.67147G>A (p.Gly22383Arg) rs372388682
NM_001267550.2(TTN):c.67153C>T (p.Pro22385Ser) rs781562260
NM_001267550.2(TTN):c.67318G>A (p.Gly22440Ser) rs727503576
NM_001267550.2(TTN):c.67357G>A (p.Gly22453Arg) rs373706642
NM_001267550.2(TTN):c.67409T>C (p.Ile22470Thr) rs746559118
NM_001267550.2(TTN):c.67445G>A (p.Arg22482Gln) rs200146608
NM_001267550.2(TTN):c.67487A>G (p.Lys22496Arg) rs397517669
NM_001267550.2(TTN):c.67571G>A (p.Ser22524Asn) rs397517670
NM_001267550.2(TTN):c.67574C>T (p.Ala22525Val) rs781320550
NM_001267550.2(TTN):c.67683G>C (p.Leu22561Phe) rs876658076
NM_001267550.2(TTN):c.67706G>A (p.Arg22569Gln) rs185620750
NM_001267550.2(TTN):c.67792A>C (p.Ser22598Arg) rs775579156
NM_001267550.2(TTN):c.67808C>T (p.Ala22603Val) rs199583938
NM_001267550.2(TTN):c.67960G>C (p.Asp22654His) rs144295295
NM_001267550.2(TTN):c.68097G>C (p.Gln22699His) rs727504520
NM_001267550.2(TTN):c.68161G>A (p.Glu22721Lys) rs374492812
NM_001267550.2(TTN):c.68165A>G (p.Asn22722Ser) rs200493270
NM_001267550.2(TTN):c.68251A>C (p.Asn22751His) rs727504970
NM_001267550.2(TTN):c.6826A>G (p.Ile2276Val) rs794729578
NM_001267550.2(TTN):c.68272G>A (p.Asp22758Asn) rs397517675
NM_001267550.2(TTN):c.68282C>T (p.Ser22761Phe) rs397517676
NM_001267550.2(TTN):c.68335C>A (p.His22779Asn) rs727504702
NM_001267550.2(TTN):c.68363T>C (p.Leu22788Pro) rs745626806
NM_001267550.2(TTN):c.68410A>G (p.Lys22804Glu) rs397517677
NM_001267550.2(TTN):c.68417C>T (p.Thr22806Ile) rs727503573
NM_001267550.2(TTN):c.6844T>C (p.Tyr2282His) rs727503691
NM_001267550.2(TTN):c.68498C>T (p.Ser22833Leu) rs876658077
NM_001267550.2(TTN):c.6851G>C (p.Gly2284Ala) rs751111175
NM_001267550.2(TTN):c.68525T>C (p.Ile22842Thr) rs368301580
NM_001267550.2(TTN):c.68605G>A (p.Gly22869Ser) rs876658078
NM_001267550.2(TTN):c.68612A>C (p.His22871Pro) rs761622490
NM_001267550.2(TTN):c.68654C>T (p.Ser22885Leu) rs376574861
NM_001267550.2(TTN):c.68762C>T (p.Thr22921Ile) rs534567766
NM_001267550.2(TTN):c.68791A>C (p.Ser22931Arg) rs794729484
NM_001267550.2(TTN):c.68823C>T (p.Tyr22941=) rs200717463
NM_001267550.2(TTN):c.68824G>A (p.Glu22942Lys) rs199506676
NM_001267550.2(TTN):c.68864G>C (p.Gly22955Ala) rs201381085
NM_001267550.2(TTN):c.6899A>G (p.Tyr2300Cys) rs772093035
NM_001267550.2(TTN):c.69117T>A (p.Asp23039Glu) rs727503572
NM_001267550.2(TTN):c.6913G>A (p.Glu2305Lys) rs367761468
NM_001267550.2(TTN):c.69172A>G (p.Thr23058Ala) rs752304059
NM_001267550.2(TTN):c.69199G>T (p.Asp23067Tyr) rs794729485
NM_001267550.2(TTN):c.69227T>C (p.Ile23076Thr) rs765930349
NM_001267550.2(TTN):c.69325G>A (p.Glu23109Lys) rs727503571
NM_001267550.2(TTN):c.69338G>A (p.Arg23113Gln) rs370890454
NM_001267550.2(TTN):c.6938C>G (p.Thr2313Arg) rs794729579
NM_001267550.2(TTN):c.6941T>C (p.Ile2314Thr) rs397517708
NM_001267550.2(TTN):c.6949C>T (p.Arg2317Cys) rs750101152
NM_001267550.2(TTN):c.69517G>A (p.Gly23173Arg) rs773592810
NM_001267550.2(TTN):c.69533G>T (p.Arg23178Met) rs376978126
NM_001267550.2(TTN):c.69821G>A (p.Gly23274Asp) rs201043950
NM_001267550.2(TTN):c.69841_69843dup (p.Lys23281dup) rs869312075
NM_001267550.2(TTN):c.69844G>A (p.Val23282Ile) rs876658079
NM_001267550.2(TTN):c.69853G>A (p.Glu23285Lys) rs376870149
NM_001267550.2(TTN):c.69864A>G (p.Ile23288Met) rs368867993
NM_001267550.2(TTN):c.69903C>A (p.Phe23301Leu) rs372799151
NM_001267550.2(TTN):c.69904G>A (p.Val23302Ile) rs190421400
NM_001267550.2(TTN):c.70006G>A (p.Val23336Ile) rs781015638
NM_001267550.2(TTN):c.70045G>A (p.Glu23349Lys) rs397517682
NM_001267550.2(TTN):c.70102A>G (p.Ile23368Val) rs367914610
NM_001267550.2(TTN):c.70163G>A (p.Arg23388Gln) rs55853138
NM_001267550.2(TTN):c.70172T>C (p.Ile23391Thr) rs375202101
NM_001267550.2(TTN):c.70181C>T (p.Thr23394Met) rs397517683
NM_001267550.2(TTN):c.70282G>T (p.Val23428Leu) rs794729486
NM_001267550.2(TTN):c.70288G>A (p.Val23430Ile) rs549709481
NM_001267550.2(TTN):c.70391G>T (p.Gly23464Val) rs549938348
NM_001267550.2(TTN):c.70477A>T (p.Thr23493Ser) rs375675901
NM_001267550.2(TTN):c.70485A>T (p.Lys23495Asn) rs1482776876
NM_001267550.2(TTN):c.70492G>A (p.Gly23498Ser) rs370771532
NM_001267550.2(TTN):c.70507T>G (p.Cys23503Gly) rs778748283
NM_001267550.2(TTN):c.70530G>A (p.Met23510Ile) rs727503569
NM_001267550.2(TTN):c.70570A>G (p.Thr23524Ala) rs369526268
NM_001267550.2(TTN):c.70600T>A (p.Ser23534Thr) rs397517686
NM_001267550.2(TTN):c.7060C>T (p.Arg2354Cys) rs145039979
NM_001267550.2(TTN):c.70625T>C (p.Met23542Thr) rs727503570
NM_001267550.2(TTN):c.70650C>A (p.Ser23550Arg) rs794729487
NM_001267550.2(TTN):c.70748C>A (p.Thr23583Lys) rs397517687
NM_001267550.2(TTN):c.70796A>T (p.Glu23599Val) rs727503568
NM_001267550.2(TTN):c.70817T>C (p.Met23606Thr) rs371030086
NM_001267550.2(TTN):c.70906C>T (p.Arg23636Cys) rs189208539
NM_001267550.2(TTN):c.70964T>C (p.Ile23655Thr) rs794729488
NM_001267550.2(TTN):c.70967C>T (p.Pro23656Leu) rs368938701
NM_001267550.2(TTN):c.71036G>A (p.Arg23679Lys) rs200144345
NM_001267550.2(TTN):c.71152G>A (p.Val23718Ile) rs794729489
NM_001267550.2(TTN):c.71279G>T (p.Ser23760Ile) rs765988593
NM_001267550.2(TTN):c.71326G>A (p.Glu23776Lys) rs746336948
NM_001267550.2(TTN):c.71332G>A (p.Ala23778Thr) rs727503566
NM_001267550.2(TTN):c.7133A>G (p.Lys2378Arg) rs727503690
NM_001267550.2(TTN):c.7156G>A (p.Gly2386Ser) rs777101912
NM_001267550.2(TTN):c.7157G>A (p.Gly2386Asp) rs142926566
NM_001267550.2(TTN):c.71624C>A (p.Thr23875Asn) rs771783837
NM_001267550.2(TTN):c.71705T>C (p.Ile23902Thr) rs55837610
NM_001267550.2(TTN):c.71723G>A (p.Gly23908Asp) rs540161344
NM_001267550.2(TTN):c.71789A>T (p.Lys23930Ile) rs752648041
NM_001267550.2(TTN):c.71841G>C (p.Lys23947Asn) rs56019808
NM_001267550.2(TTN):c.71881G>A (p.Val23961Ile) rs397517690
NM_001267550.2(TTN):c.71909G>A (p.Arg23970Gln) rs727503563
NM_001267550.2(TTN):c.71981C>T (p.Ala23994Val) rs772886864
NM_001267550.2(TTN):c.72076G>A (p.Ala24026Thr) rs794729490
NM_001267550.2(TTN):c.72131G>A (p.Gly24044Asp) rs794729491
NM_001267550.2(TTN):c.72181A>G (p.Met24061Val) rs201482015
NM_001267550.2(TTN):c.72182T>C (p.Met24061Thr) rs200471370
NM_001267550.2(TTN):c.72232A>G (p.Ile24078Val) rs876658080
NM_001267550.2(TTN):c.72236A>G (p.Lys24079Arg) rs775482499
NM_001267550.2(TTN):c.72295G>T (p.Ala24099Ser) rs748236500
NM_001267550.2(TTN):c.72296C>T (p.Ala24099Val) rs781721483
NM_001267550.2(TTN):c.72331G>C (p.Ala24111Pro) rs369671334
NM_001267550.2(TTN):c.72379G>A (p.Glu24127Lys) rs149763294
NM_001267550.2(TTN):c.72488G>A (p.Arg24163His) rs374712231
NM_001267550.2(TTN):c.72556A>G (p.Lys24186Glu) rs768699380
NM_001267550.2(TTN):c.72586C>T (p.Arg24196Cys) rs185626486
NM_001267550.2(TTN):c.72652A>C (p.Asn24218His) rs727505243
NM_001267550.2(TTN):c.72716T>C (p.Met24239Thr) rs750298083
NM_001267550.2(TTN):c.72824A>T (p.Lys24275Ile) rs199860952
NM_001267550.2(TTN):c.72874G>A (p.Glu24292Lys) rs727505240
NM_001267550.2(TTN):c.72943T>C (p.Tyr24315His) rs794729492
NM_001267550.2(TTN):c.72985A>G (p.Asn24329Asp) rs397517694
NM_001267550.2(TTN):c.72994G>T (p.Val24332Phe) rs876658081
NM_001267550.2(TTN):c.73110_73111delinsCA (p.Trp24370_Gln24371delinsCysLys) rs1553608093
NM_001267550.2(TTN):c.73124C>T (p.Pro24375Leu) rs376041680
NM_001267550.2(TTN):c.73185T>A (p.Tyr24395Ter) rs794729283
NM_001267550.2(TTN):c.73303C>T (p.Arg24435Cys) rs200028088
NM_001267550.2(TTN):c.73340G>A (p.Arg24447Lys) rs377190830
NM_001267550.2(TTN):c.73385G>C (p.Trp24462Ser) rs1553607435
NM_001267550.2(TTN):c.73390C>T (p.Arg24464Trp) rs369098292
NM_001267550.2(TTN):c.73426G>A (p.Glu24476Lys) rs760487688
NM_001267550.2(TTN):c.73517G>A (p.Gly24506Asp) rs567446185
NM_001267550.2(TTN):c.73540G>T (p.Val24514Phe) rs1553607188
NM_001267550.2(TTN):c.73604C>A (p.Ser24535Tyr) rs201804005
NM_001267550.2(TTN):c.73675C>T (p.Arg24559Trp) rs367904757
NM_001267550.2(TTN):c.73823C>T (p.Ala24608Val) rs794729493
NM_001267550.2(TTN):c.73873T>C (p.Leu24625=) rs545556079
NM_001267550.2(TTN):c.73879G>A (p.Asp24627Asn) rs794729494
NM_001267550.2(TTN):c.73994C>T (p.Thr24665Met) rs144398602
NM_001267550.2(TTN):c.74057C>G (p.Ser24686Cys) rs727504921
NM_001267550.2(TTN):c.74144C>T (p.Pro24715Leu) rs55713856
NM_001267550.2(TTN):c.74249A>G (p.His24750Arg) rs1553605597
NM_001267550.2(TTN):c.74305A>G (p.Asn24769Asp) rs372787601
NM_001267550.2(TTN):c.74416C>T (p.Leu24806Phe) rs866687107
NM_001267550.2(TTN):c.74527A>G (p.Asn24843Asp) rs373527654
NM_001267550.2(TTN):c.74533A>C (p.Ile24845Leu) rs1214451388
NM_001267550.2(TTN):c.74545C>T (p.Arg24849Trp) rs727503562
NM_001267550.2(TTN):c.74546G>A (p.Arg24849Gln) rs745488276
NM_001267550.2(TTN):c.74549A>G (p.Asp24850Gly) rs573415766
NM_001267550.2(TTN):c.74564C>T (p.Thr24855Ile) rs759432194
NM_001267550.2(TTN):c.74653G>A (p.Ala24885Thr) rs748083856
NM_001267550.2(TTN):c.74673G>C (p.Lys24891Asn) rs727504855
NM_001267550.2(TTN):c.74691A>G (p.Ser24897=) rs797046066
NM_001267550.2(TTN):c.74968G>A (p.Gly24990Ser) rs727503561
NM_001267550.2(TTN):c.74981C>T (p.Pro24994Leu) rs531281558
NM_001267550.2(TTN):c.75041A>G (p.Glu25014Gly) rs794729495
NM_001267550.2(TTN):c.75044C>T (p.Ala25015Val) rs397517699
NM_001267550.2(TTN):c.75104G>A (p.Gly25035Glu) rs727503560
NM_001267550.2(TTN):c.75127G>T (p.Val25043Phe) rs559907766
NM_001267550.2(TTN):c.75155G>A (p.Arg25052His) rs542720402
NM_001267550.2(TTN):c.7523A>G (p.His2508Arg) rs146970027
NM_001267550.2(TTN):c.75251G>A (p.Arg25084Gln) rs794729496
NM_001267550.2(TTN):c.75274G>A (p.Glu25092Lys) rs397517700
NM_001267550.2(TTN):c.75329G>A (p.Arg25110Gln) rs757674072
NM_001267550.2(TTN):c.75364G>A (p.Val25122Met) rs376821762
NM_001267550.2(TTN):c.75458C>T (p.Ser25153Leu) rs368058280
NM_001267550.2(TTN):c.75490G>A (p.Asp25164Asn) rs192468365
NM_001267550.2(TTN):c.75504T>G (p.Ser25168Arg) rs375204371
NM_001267550.2(TTN):c.75548T>C (p.Ile25183Thr) rs794729497
NM_001267550.2(TTN):c.7556T>C (p.Val2519Ala) rs372361514
NM_001267550.2(TTN):c.7556T>G (p.Val2519Gly) rs372361514
NM_001267550.2(TTN):c.7570A>T (p.Thr2524Ser) rs797046067
NM_001267550.2(TTN):c.75734G>A (p.Arg25245Lys) rs397517701
NM_001267550.2(TTN):c.75745C>T (p.Arg25249Cys) rs397517702
NM_001267550.2(TTN):c.75833G>A (p.Arg25278His) rs769729114
NM_001267550.2(TTN):c.76027A>G (p.Lys25343Glu) rs727504596
NM_001267550.2(TTN):c.76070G>A (p.Arg25357His) rs397517703
NM_001267550.2(TTN):c.76124A>T (p.Tyr25375Phe) rs374494927
NM_001267550.2(TTN):c.76199G>C (p.Cys25400Ser) rs397517704
NM_001267550.2(TTN):c.76229A>T (p.Asn25410Ile) rs397517706
NM_001267550.2(TTN):c.7642C>T (p.Gln2548Ter) rs727503688
NM_001267550.2(TTN):c.76492C>G (p.Pro25498Ala) rs377754701
NM_001267550.2(TTN):c.76559T>C (p.Ile25520Thr) rs1553601714
NM_001267550.2(TTN):c.76565T>C (p.Ile25522Thr) rs372963832
NM_001267550.2(TTN):c.76673A>T (p.Asp25558Val) rs201095164
NM_001267550.2(TTN):c.76693T>C (p.Ser25565Pro) rs753679035
NM_001267550.2(TTN):c.76739C>A (p.Thr25580Lys) rs56372592
NM_001267550.2(TTN):c.76765A>G (p.Thr25589Ala) rs794729499
NM_001267550.2(TTN):c.76778T>A (p.Phe25593Tyr) rs547186080
NM_001267550.2(TTN):c.76796T>C (p.Leu25599Pro) rs794729500
NM_001267550.2(TTN):c.7682T>C (p.Ile2561Thr) rs747031357
NM_001267550.2(TTN):c.77035A>C (p.Asn25679His) rs770512378
NM_001267550.2(TTN):c.7711G>A (p.Glu2571Lys) rs149660690
NM_001267550.2(TTN):c.77171A>T (p.His25724Leu) rs768382014
NM_001267550.2(TTN):c.77182A>G (p.Ser25728Gly) rs1306199809
NM_001267550.2(TTN):c.77188A>G (p.Ile25730Val) rs745981754
NM_001267550.2(TTN):c.77216C>G (p.Ala25739Gly) rs56391938
NM_001267550.2(TTN):c.77329A>G (p.Lys25777Glu) rs778484596
NM_001267550.2(TTN):c.77356G>A (p.Ala25786Thr) rs794729502
NM_001267550.2(TTN):c.77357C>T (p.Ala25786Val) rs794729504
NM_001267550.2(TTN):c.7739T>C (p.Ile2580Thr) rs1554000030
NM_001267550.2(TTN):c.77564T>A (p.Leu25855His) rs397517710
NM_001267550.2(TTN):c.77618C>G (p.Ala25873Gly) rs751402631
NM_001267550.2(TTN):c.7762A>T (p.Lys2588Ter) rs1553999955
NM_001267550.2(TTN):c.77716G>A (p.Glu25906Lys) rs56341835
NM_001267550.2(TTN):c.77764C>T (p.Gln25922Ter) rs794729288
NM_001267550.2(TTN):c.77789A>C (p.Lys25930Thr) rs397517711
NM_001267550.2(TTN):c.77816A>C (p.Asp25939Ala) rs397517712
NM_001267550.2(TTN):c.7783A>G (p.Met2595Val) rs760786665
NM_001267550.2(TTN):c.77848C>T (p.Leu25950Phe) rs376814602
NM_001267550.2(TTN):c.77999C>T (p.Thr26000Ile) rs794729506
NM_001267550.2(TTN):c.78020T>C (p.Met26007Thr) rs372188921
NM_001267550.2(TTN):c.78062C>G (p.Pro26021Arg) rs727504982
NM_001267550.2(TTN):c.78095G>T (p.Arg26032Ile) rs794729507
NM_001267550.2(TTN):c.78142A>C (p.Thr26048Pro) rs794729508
NM_001267550.2(TTN):c.7816G>A (p.Ala2606Thr) rs375286376
NM_001267550.2(TTN):c.78323A>G (p.Gln26108Arg) rs370963021
NM_001267550.2(TTN):c.78370A>T (p.Ile26124Phe) rs397517713
NM_001267550.2(TTN):c.78385G>T (p.Asp26129Tyr) rs199814673
NM_001267550.2(TTN):c.78446C>G (p.Thr26149Ser) rs191263181
NM_001267550.2(TTN):c.78481T>A (p.Phe26161Ile) rs876658082
NM_001267550.2(TTN):c.78577A>C (p.Ile26193Leu) rs727505241
NM_001267550.2(TTN):c.7864A>G (p.Ile2622Val) rs148394362
NM_001267550.2(TTN):c.78892G>A (p.Gly26298Arg) rs72648205
NM_001267550.2(TTN):c.78896T>A (p.Val26299Asp) rs73036377
NM_001267550.2(TTN):c.78906A>C (p.Glu26302Asp) rs534003014
NM_001267550.2(TTN):c.78925T>A (p.Ser26309Thr) rs113597171
NM_001267550.2(TTN):c.78980G>A (p.Arg26327Gln) rs370367786
NM_001267550.2(TTN):c.79109G>A (p.Gly26370Glu) rs727505061
NM_001267550.2(TTN):c.79127C>A (p.Ala26376Glu) rs397517714
NM_001267550.2(TTN):c.79145A>C (p.Asn26382Thr) rs727505049
NM_001267550.2(TTN):c.7916T>G (p.Phe2639Cys) rs794729580
NM_001267550.2(TTN):c.79207A>G (p.Met26403Val) rs876658083
NM_001267550.2(TTN):c.79217G>C (p.Cys26406Ser) rs727505223
NM_001267550.2(TTN):c.79225C>T (p.Arg26409Cys) rs748258568
NM_001267550.2(TTN):c.79226G>A (p.Arg26409His) rs72648206
NM_001267550.2(TTN):c.79281C>G (p.Asp26427Glu) rs766994654
NM_001267550.2(TTN):c.79342G>A (p.Val26448Met) rs1380054566
NM_001267550.2(TTN):c.79343T>G (p.Val26448Gly) rs1553590427
NM_001267550.2(TTN):c.79410G>A (p.Gly26470=) rs140942979
NM_001267550.2(TTN):c.79827del (p.Ala26610fs) rs397517715
NM_001267550.2(TTN):c.79855C>T (p.Arg26619Cys) rs757229467
NM_001267550.2(TTN):c.79881dup (p.Arg26628fs) rs876661400
NM_001267550.2(TTN):c.79885G>C (p.Glu26629Gln) rs727504673
NM_001267550.2(TTN):c.79909G>A (p.Val26637Ile) rs375605062
NM_001267550.2(TTN):c.80006G>A (p.Ser26669Asn) rs727505214
NM_001267550.2(TTN):c.80174C>T (p.Ser26725Leu) rs772603198
NM_001267550.2(TTN):c.80263T>C (p.Phe26755Leu) rs200181804
NM_001267550.2(TTN):c.80290G>A (p.Gly26764Arg) rs727505213
NM_001267550.2(TTN):c.80323G>A (p.Val26775Met) rs370589806
NM_001267550.2(TTN):c.80338C>A (p.Pro26780Thr) rs775149188
NM_001267550.2(TTN):c.80414A>C (p.Glu26805Ala) rs370095455
NM_001267550.2(TTN):c.80425G>A (p.Gly26809Ser) rs369941201
NM_001267550.2(TTN):c.80542G>C (p.Glu26848Gln) rs898433512
NM_001267550.2(TTN):c.80608C>A (p.Pro26870Thr) rs397517718
NM_001267550.2(TTN):c.80692_80697del (p.Lys26898_Ile26899del) rs1385301438
NM_001267550.2(TTN):c.8069C>T (p.Thr2690Ile) rs374620001
NM_001267550.2(TTN):c.80701A>G (p.Ile26901Val) rs201562505
NM_001267550.2(TTN):c.80713G>A (p.Gly26905Ser) rs772844758
NM_001267550.2(TTN):c.80717G>A (p.Arg26906Gln) rs536183519
NM_001267550.2(TTN):c.80720C>A (p.Pro26907Gln) rs375693686
NM_001267550.2(TTN):c.80774G>A (p.Arg26925Lys) rs748215561
NM_001267550.2(TTN):c.80858C>T (p.Thr26953Met) rs377506142
NM_001267550.2(TTN):c.80983G>A (p.Glu26995Lys) rs397517719
NM_001267550.2(TTN):c.81005_81028del (p.Gly27002_Ile27009del) rs727504756
NM_001267550.2(TTN):c.81086G>A (p.Arg27029Lys) rs794729510
NM_001267550.2(TTN):c.81178G>T (p.Asp27060Tyr) rs372875889
NM_001267550.2(TTN):c.81247T>C (p.Ser27083Pro) rs186273940
NM_001267550.2(TTN):c.81289G>C (p.Val27097Leu) rs794729511
NM_001267550.2(TTN):c.8131A>C (p.Lys2711Gln) rs727504735
NM_001267550.2(TTN):c.81431A>G (p.Glu27144Gly) rs794729512
NM_001267550.2(TTN):c.81464T>C (p.Ile27155Thr) rs397517720
NM_001267550.2(TTN):c.81485C>T (p.Ser27162Leu) rs763903239
NM_001267550.2(TTN):c.81511T>C (p.Cys27171Arg) rs727504678
NM_001267550.2(TTN):c.81565C>G (p.Leu27189Val) rs142391957
NM_001267550.2(TTN):c.81671A>G (p.Asn27224Ser) rs368443217
NM_001267550.2(TTN):c.81673G>A (p.Val27225Ile) rs375211424
NM_001267550.2(TTN):c.81701G>A (p.Gly27234Glu) rs372189553
NM_001267550.2(TTN):c.81758A>G (p.Asn27253Ser) rs529055709
NM_001267550.2(TTN):c.81856G>A (p.Val27286Ile) rs372784067
NM_001267550.2(TTN):c.81881T>G (p.Val27294Gly) rs876658084
NM_001267550.2(TTN):c.81901G>A (p.Gly27301Ser) rs727504650
NM_001267550.2(TTN):c.81923T>C (p.Val27308Ala) rs794729513
NM_001267550.2(TTN):c.82021C>T (p.Arg27341Trp) rs746488250
NM_001267550.2(TTN):c.82022G>A (p.Arg27341Gln) rs555414240
NM_001267550.2(TTN):c.82061T>G (p.Val27354Gly) rs368023868
NM_001267550.2(TTN):c.82091T>C (p.Val27364Ala) rs981687121
NM_001267550.2(TTN):c.82103A>G (p.Asp27368Gly) rs145373396
NM_001267550.2(TTN):c.82220T>C (p.Ile27407Thr) rs376037252
NM_001267550.2(TTN):c.82385C>T (p.Thr27462Met) rs55933739
NM_001267550.2(TTN):c.82402A>C (p.Lys27468Gln) rs201958805
NM_001267550.2(TTN):c.82524A>T (p.Lys27508Asn) rs766900644
NM_001267550.2(TTN):c.82582C>T (p.Arg27528Trp) rs749852593
NM_001267550.2(TTN):c.82616C>G (p.Ser27539Cys) rs727503556
NM_001267550.2(TTN):c.82691C>T (p.Ala27564Val) rs55634791
NM_001267550.2(TTN):c.82754C>A (p.Ser27585Tyr) rs72648215
NM_001267550.2(TTN):c.82759G>A (p.Val27587Ile) rs876658085
NM_001267550.2(TTN):c.82810G>A (p.Gly27604Ser) rs199929362
NM_001267550.2(TTN):c.82859G>T (p.Cys27620Phe) rs762472521
NM_001267550.2(TTN):c.82864C>A (p.Pro27622Thr) rs769189431
NM_001267550.2(TTN):c.83006G>T (p.Arg27669Met) rs766268272
NM_001267550.2(TTN):c.83013G>C (p.Glu27671Asp) rs794729514
NM_001267550.2(TTN):c.83165T>G (p.Ile27722Arg) rs794729515
NM_001267550.2(TTN):c.83171T>G (p.Val27724Gly) rs201896662
NM_001267550.2(TTN):c.83252A>G (p.Asn27751Ser) rs775527437
NM_001267550.2(TTN):c.83281G>A (p.Val27761Ile) rs371788070
NM_001267550.2(TTN):c.83293G>A (p.Asp27765Asn) rs752054849
NM_001267550.2(TTN):c.83299C>A (p.Pro27767Thr) rs184643087
NM_001267550.2(TTN):c.83404A>G (p.Ile27802Val) rs727504723
NM_001267550.2(TTN):c.83543T>C (p.Ile27848Thr) rs397517723
NM_001267550.2(TTN):c.83560A>G (p.Thr27854Ala) rs876658086
NM_001267550.2(TTN):c.83575A>G (p.Lys27859Glu) rs761633407
NM_001267550.2(TTN):c.83611A>T (p.Thr27871Ser) rs397517724
NM_001267550.2(TTN):c.83618T>C (p.Val27873Ala) rs200775919
NM_001267550.2(TTN):c.83870G>C (p.Arg27957Thr) rs148067743
NM_001267550.2(TTN):c.83978C>A (p.Thr27993Asn) rs377614000
NM_001267550.2(TTN):c.84095C>A (p.Thr28032Asn) rs876658087
NM_001267550.2(TTN):c.8434G>C (p.Val2812Leu) rs146636599
NM_001267550.2(TTN):c.84362C>A (p.Thr28121Lys) rs397517726
NM_001267550.2(TTN):c.84385G>T (p.Val28129Phe) rs752974639
NM_001267550.2(TTN):c.84398A>G (p.Asn28133Ser) rs727505053
NM_001267550.2(TTN):c.84448T>C (p.Tyr28150His) rs397517727
NM_001267550.2(TTN):c.84451C>A (p.Pro28151Thr) rs727504873
NM_001267550.2(TTN):c.84466G>C (p.Gly28156Arg) rs763560084
NM_001267550.2(TTN):c.84494A>G (p.His28165Arg) rs876658088
NM_001267550.2(TTN):c.84523T>C (p.Trp28175Arg) rs397517728
NM_001267550.2(TTN):c.84553C>T (p.Arg28185Ter) rs397517729
NM_001267550.2(TTN):c.8459A>G (p.His2820Arg) rs794729581
NM_001267550.2(TTN):c.84625A>G (p.Ile28209Val) rs753472730
NM_001267550.2(TTN):c.84652G>A (p.Gly28218Ser) rs727504693
NM_001267550.2(TTN):c.84696A>C (p.Glu28232Asp) rs397517730
NM_001267550.2(TTN):c.84872G>A (p.Arg28291His) rs774924903
NM_001267550.2(TTN):c.84922C>A (p.Gln28308Lys) rs794729516
NM_001267550.2(TTN):c.84962A>G (p.Gln28321Arg) rs760149145
NM_001267550.2(TTN):c.84964C>T (p.Arg28322Cys) rs774978209
NM_001267550.2(TTN):c.84965G>A (p.Arg28322His) rs373532064
NM_001267550.2(TTN):c.84977G>A (p.Arg28326Gln) rs200843338
NM_001267550.2(TTN):c.85091G>A (p.Arg28364Gln) rs376283153
NM_001267550.2(TTN):c.85130T>C (p.Ile28377Thr) rs876658089
NM_001267550.2(TTN):c.85195G>A (p.Glu28399Lys) rs397517732
NM_001267550.2(TTN):c.85351C>T (p.Pro28451Ser) rs727503554
NM_001267550.2(TTN):c.8539A>G (p.Lys2847Glu) rs794729582
NM_001267550.2(TTN):c.85406C>G (p.Ser28469Cys) rs202040332
NM_001267550.2(TTN):c.85439del (p.Gly28480fs) rs876661401
NM_001267550.2(TTN):c.85450G>A (p.Asp28484Asn) rs56330345
NM_001267550.2(TTN):c.85477A>G (p.Thr28493Ala) rs369907507
NM_001267550.2(TTN):c.85577C>G (p.Thr28526Ser) rs1553562806
NM_001267550.2(TTN):c.85582G>A (p.Val28528Ile) rs753861250
NM_001267550.2(TTN):c.85598_85603del (p.Val28533_Gly28534del) rs727503553
NM_001267550.2(TTN):c.85649T>A (p.Val28550Asp) rs727505194
NM_001267550.2(TTN):c.85745T>A (p.Ile28582Lys) rs201688358
NM_001267550.2(TTN):c.85769G>A (p.Arg28590Gln) rs375667028
NM_001267550.2(TTN):c.85846C>T (p.Arg28616Trp) rs754025981
NM_001267550.2(TTN):c.85895G>C (p.Gly28632Ala) rs794729517
NM_001267550.2(TTN):c.8596G>A (p.Ala2866Thr) rs147174853
NM_001267550.2(TTN):c.85979T>C (p.Ile28660Thr) rs397517733
NM_001267550.2(TTN):c.86003T>A (p.Ile28668Lys) rs374022393
NM_001267550.2(TTN):c.86003T>C (p.Ile28668Thr) rs374022393
NM_001267550.2(TTN):c.8609A>T (p.Gln2870Leu) rs372008728
NM_001267550.2(TTN):c.86117G>A (p.Arg28706Gln) rs199788826
NM_001267550.2(TTN):c.86140G>A (p.Gly28714Arg) rs532818379
NM_001267550.2(TTN):c.8633_8636del (p.Phe2878fs) rs727503686
NM_001267550.2(TTN):c.86377A>G (p.Thr28793Ala) rs727505234
NM_001267550.2(TTN):c.86393G>A (p.Arg28798Lys) rs781458689
NM_001267550.2(TTN):c.86420G>A (p.Arg28807His) rs375800916
NM_001267550.2(TTN):c.86429T>C (p.Leu28810Pro) rs397517734
NM_001267550.2(TTN):c.86435T>C (p.Ile28812Thr) rs727504959
NM_001267550.2(TTN):c.86471C>T (p.Thr28824Ile) rs200709344
NM_001267550.2(TTN):c.8660C>A (p.Thr2887Asn) rs752697997
NM_001267550.2(TTN):c.86701C>T (p.Arg28901Cys) rs757848764
NM_001267550.2(TTN):c.86729_86731AAG[1] (p.Glu28911del) rs727504797
NM_001267550.2(TTN):c.8685G>C (p.Glu2895Asp) rs727503685
NM_001267550.2(TTN):c.8685G>T (p.Glu2895Asp) rs727503685
NM_001267550.2(TTN):c.86903A>G (p.His28968Arg) rs754679595
NM_001267550.2(TTN):c.87010G>A (p.Gly29004Ser) rs761251825
NM_001267550.2(TTN):c.87049G>A (p.Ala29017Thr) rs727505050
NM_001267550.2(TTN):c.87077C>T (p.Pro29026Leu) rs876658090
NM_001267550.2(TTN):c.8710G>A (p.Glu2904Lys) rs794729583
NM_001267550.2(TTN):c.87119-12C>G rs1057518267
NM_001267550.2(TTN):c.87251C>A (p.Pro29084His) rs370776552
NM_001267550.2(TTN):c.87253C>T (p.Leu29085Phe) rs376026291
NM_001267550.2(TTN):c.87280G>A (p.Glu29094Lys) rs199501185
NM_001267550.2(TTN):c.87367A>C (p.Ser29123Arg) rs375198596
NM_001267550.2(TTN):c.87377C>G (p.Thr29126Ser) rs559269036
NM_001267550.2(TTN):c.87412C>A (p.Pro29138Thr) rs72648227
NM_001267550.2(TTN):c.87436G>T (p.Val29146Phe) rs794729520
NM_001267550.2(TTN):c.87488A>G (p.Lys29163Arg) rs794729521
NM_001267550.2(TTN):c.87611C>G (p.Thr29204Arg) rs72648228
NM_001267550.2(TTN):c.87616_87618GAA[1] (p.Glu29207del) rs753636173
NM_001267550.2(TTN):c.87623A>T (p.Tyr29208Phe) rs201831707
NM_001267550.2(TTN):c.87730C>T (p.Pro29244Ser) rs779810701
NM_001267550.2(TTN):c.87805G>A (p.Val29269Ile) rs727503551
NM_001267550.2(TTN):c.87878G>A (p.Arg29293His) rs202001776
NM_001267550.2(TTN):c.87998T>C (p.Ile29333Thr) rs764532002
NM_001267550.2(TTN):c.88012C>A (p.Pro29338Thr) rs774162189
NM_001267550.2(TTN):c.88090G>A (p.Gly29364Ser) rs183013408
NM_001267550.2(TTN):c.88123C>T (p.Arg29375Cys) rs368439674
NM_001267550.2(TTN):c.88156A>T (p.Ser29386Cys) rs727505102
NM_001267550.2(TTN):c.88183T>C (p.Phe29395Leu) rs55940667
NM_001267550.2(TTN):c.88246G>T (p.Val29416Phe) rs755325663
NM_001267550.2(TTN):c.88297G>C (p.Asp29433His) rs189202799
NM_001267550.2(TTN):c.88306+1G>C rs727503550
NM_001267550.2(TTN):c.88406C>T (p.Ala29469Val) rs397517740
NM_001267550.2(TTN):c.8843C>T (p.Ser2948Leu) rs397517763
NM_001267550.2(TTN):c.88459G>A (p.Val29487Met) rs200899806
NM_001267550.2(TTN):c.88496T>G (p.Leu29499Arg) rs72648234
NM_001267550.2(TTN):c.88589T>A (p.Ile29530Asn) rs794729524
NM_001267550.2(TTN):c.88591C>T (p.Leu29531Phe) rs371483198
NM_001267550.2(TTN):c.88622T>C (p.Ile29541Thr) rs768292510
NM_001267550.2(TTN):c.88685G>A (p.Gly29562Asp) rs72648235
NM_001267550.2(TTN):c.88688G>A (p.Gly29563Asp) rs1335432771
NM_001267550.2(TTN):c.88720C>T (p.Arg29574Cys) rs200513274
NM_001267550.2(TTN):c.88721G>A (p.Arg29574His) rs111727915
NM_001267550.2(TTN):c.88733G>A (p.Arg29578His) rs374147064
NM_001267550.2(TTN):c.88826G>A (p.Arg29609Gln) rs758876816
NM_001267550.2(TTN):c.88831G>A (p.Val29611Met) rs79299277
NM_001267550.2(TTN):c.88946C>T (p.Ser29649Leu) rs764695663
NM_001267550.2(TTN):c.88984G>A (p.Gly29662Ser) rs187460377
NM_001267550.2(TTN):c.89018G>A (p.Arg29673Gln) rs200639218
NM_001267550.2(TTN):c.89072C>A (p.Thr29691Asn) rs794729525
NM_001267550.2(TTN):c.890G>A (p.Arg297Gln) rs367974490
NM_001267550.2(TTN):c.89111A>G (p.Tyr29704Cys) rs727504503
NM_001267550.2(TTN):c.89252T>C (p.Ile29751Thr) rs397517742
NM_001267550.2(TTN):c.89258T>A (p.Leu29753His) rs369279892
NM_001267550.2(TTN):c.89314G>A (p.Glu29772Lys) rs200503016
NM_001267550.2(TTN):c.89357C>T (p.Thr29786Ile) rs753966916
NM_001267550.2(TTN):c.89375C>T (p.Thr29792Ile) rs876658091
NM_001267550.2(TTN):c.89411T>G (p.Val29804Gly) rs776305807
NM_001267550.2(TTN):c.89491A>G (p.Lys29831Glu) rs774632104
NM_001267550.2(TTN):c.89498T>A (p.Ile29833Lys) rs794729526
NM_001267550.2(TTN):c.89515A>G (p.Ile29839Val) rs750806089
NM_001267550.2(TTN):c.8953A>T (p.Thr2985Ser) rs727503684
NM_001267550.2(TTN):c.89545G>T (p.Val29849Phe) rs727504493
NM_001267550.2(TTN):c.89628T>G (p.Asp29876Glu) rs397517743
NM_001267550.2(TTN):c.89689C>T (p.Leu29897Phe) rs180798672
NM_001267550.2(TTN):c.89708C>G (p.Thr29903Ser) rs72648240
NM_001267550.2(TTN):c.89711G>A (p.Arg29904His) rs397517744
NM_001267550.2(TTN):c.89716G>A (p.Asp29906Asn) rs770892973
NM_001267550.2(TTN):c.89766G>C (p.Lys29922Asn) rs397517745
NM_001267550.2(TTN):c.89893A>G (p.Ile29965Val) rs370135800
NM_001267550.2(TTN):c.89947G>A (p.Val29983Met) rs397517746
NM_001267550.2(TTN):c.89993C>T (p.Ser29998Leu) rs376543931
NM_001267550.2(TTN):c.90103C>T (p.Arg30035Cys) rs397517747
NM_001267550.2(TTN):c.90181G>A (p.Val30061Ile) rs138958733
NM_001267550.2(TTN):c.90227C>T (p.Thr30076Met) rs201998913
NM_001267550.2(TTN):c.90250A>G (p.Lys30084Glu) rs376597164
NM_001267550.2(TTN):c.90265G>A (p.Glu30089Lys) rs377281790
NM_001267550.2(TTN):c.9031A>G (p.Thr3011Ala) rs727504682
NM_001267550.2(TTN):c.90392T>C (p.Val30131Ala) rs781135448
NM_001267550.2(TTN):c.90409C>T (p.Pro30137Ser) rs727505150
NM_001267550.2(TTN):c.90415G>A (p.Ala30139Thr) rs397517748
NM_001267550.2(TTN):c.90628G>A (p.Val30210Met) rs753025017
NM_001267550.2(TTN):c.90745C>G (p.Pro30249Ala) rs751971702
NM_001267550.2(TTN):c.90834T>A (p.Ser30278Arg) rs397517751
NM_001267550.2(TTN):c.90870C>T (p.Val30290=) rs794729527
NM_001267550.2(TTN):c.90904G>A (p.Glu30302Lys) rs1553538924
NM_001267550.2(TTN):c.90913T>C (p.Tyr30305His) rs544353741
NM_001267550.2(TTN):c.90950T>C (p.Val30317Ala) rs759474127
NM_001267550.2(TTN):c.90968G>C (p.Arg30323Thr) rs11887722
NM_001267550.2(TTN):c.91105A>C (p.Ile30369Leu) rs768987204
NM_001267550.2(TTN):c.91108C>G (p.Leu30370Val) rs876658092
NM_001267550.2(TTN):c.91173A>C (p.Glu30391Asp) rs199505541
NM_001267550.2(TTN):c.91199A>T (p.Tyr30400Phe) rs376494747
NM_001267550.2(TTN):c.91307G>A (p.Arg30436Gln) rs770081431
NM_001267550.2(TTN):c.91352G>A (p.Gly30451Asp) rs751610164
NM_001267550.2(TTN):c.91363G>A (p.Val30455Met)
NM_001267550.2(TTN):c.91366G>A (p.Gly30456Ser) rs773655064
NM_001267550.2(TTN):c.91385G>A (p.Arg30462Gln) rs794729529
NM_001267550.2(TTN):c.91399C>T (p.Arg30467Cys) rs775591945
NM_001267550.2(TTN):c.91414A>T (p.Asn30472Tyr) rs794729530
NM_001267550.2(TTN):c.91433A>T (p.Glu30478Val) rs794729531
NM_001267550.2(TTN):c.91440G>C (p.Gln30480His) rs794729532
NM_001267550.2(TTN):c.91475A>G (p.Tyr30492Cys) rs769678577
NM_001267550.2(TTN):c.91478A>G (p.Glu30493Gly) rs397517754
NM_001267550.2(TTN):c.915-7dup rs730880351
NM_001267550.2(TTN):c.9154T>C (p.Tyr3052His) rs763833161
NM_001267550.2(TTN):c.91601A>T (p.Asp30534Val) rs182549226
NM_001267550.2(TTN):c.9160G>A (p.Glu3054Lys) rs397517779
NM_001267550.2(TTN):c.91621G>A (p.Gly30541Arg) rs200854704
NM_001267550.2(TTN):c.91643C>T (p.Ala30548Val) rs553668520
NM_001267550.2(TTN):c.91690G>T (p.Gly30564Ter) rs878854390
NM_001267550.2(TTN):c.91732G>A (p.Val30578Ile) rs727504672
NM_001267550.2(TTN):c.9176A>T (p.Glu3059Val) rs727504501
NM_001267550.2(TTN):c.91808A>G (p.Asn30603Ser) rs794729533
NM_001267550.2(TTN):c.91879A>G (p.Ile30627Val) rs535151633
NM_001267550.2(TTN):c.91883G>A (p.Arg30628Lys) rs780476250
NM_001267550.2(TTN):c.92042C>A (p.Ala30681Asp) rs201400267
NM_001267550.2(TTN):c.92137G>C (p.Ala30713Pro) rs367807708
NM_001267550.2(TTN):c.92187C>A (p.Ser30729Arg) rs778827102
NM_001267550.2(TTN):c.92226G>A (p.Arg30742=) rs759484932
NM_001267550.2(TTN):c.92294G>C (p.Arg30765Thr) rs373099440
NM_001267550.2(TTN):c.92333C>G (p.Thr30778Arg) rs201019681
NM_001267550.2(TTN):c.92383G>A (p.Val30795Ile) rs369025866
NM_001267550.2(TTN):c.92402C>T (p.Ala30801Val) rs372570504
NM_001267550.2(TTN):c.92451G>T (p.Glu30817Asp) rs397517755
NM_001267550.2(TTN):c.92455G>A (p.Val30819Ile) rs368511235
NM_001267550.2(TTN):c.92498C>T (p.Thr30833Ile) rs727505334
NM_001267550.2(TTN):c.92513T>A (p.Val30838Glu) rs727505344
NM_001267550.2(TTN):c.92561T>C (p.Ile30854Thr) rs368427408
NM_001267550.2(TTN):c.92590G>A (p.Asp30864Asn) rs200621611
NM_001267550.2(TTN):c.92666G>A (p.Gly30889Asp) rs727505280
NM_001267550.2(TTN):c.92677A>G (p.Lys30893Glu) rs370541682
NM_001267550.2(TTN):c.92684G>A (p.Arg30895Gln) rs200141081
NM_001267550.2(TTN):c.92696T>C (p.Ile30899Thr) rs373727636
NM_001267550.2(TTN):c.92780T>A (p.Ile30927Lys) rs531432790
NM_001267550.2(TTN):c.92782G>C (p.Asp30928His) rs397517756
NM_001267550.2(TTN):c.92806G>A (p.Val30936Ile) rs200476500
NM_001267550.2(TTN):c.9290T>C (p.Leu3097Pro) rs373366126
NM_001267550.2(TTN):c.93005G>T (p.Ser31002Ile) rs180975448
NM_001267550.2(TTN):c.93011G>A (p.Ser31004Asn) rs762024916
NM_001267550.2(TTN):c.93101C>A (p.Thr31034Lys) rs727504875
NM_001267550.2(TTN):c.93107T>C (p.Met31036Thr) rs376942948
NM_001267550.2(TTN):c.93130G>A (p.Gly31044Ser) rs750213547
NM_001267550.2(TTN):c.93130G>T (p.Gly31044Cys) rs750213547
NM_001267550.2(TTN):c.93131G>T (p.Gly31044Val) rs570464905
NM_001267550.2(TTN):c.93178C>T (p.Arg31060Cys) rs750303653
NM_001267550.2(TTN):c.93179G>A (p.Arg31060His) rs776018262
NM_001267550.2(TTN):c.93182G>A (p.Arg31061His) rs727504923
NM_001267550.2(TTN):c.93266G>A (p.Arg31089His) rs367993101
NM_001267550.2(TTN):c.93322A>G (p.Ile31108Val) rs727504787
NM_001267550.2(TTN):c.93367G>C (p.Val31123Leu) rs202096200
NM_001267550.2(TTN):c.9343C>G (p.Leu3115Val) rs794729584
NM_001267550.2(TTN):c.93472G>C (p.Asp31158His) rs397517757
NM_001267550.2(TTN):c.9358C>T (p.Arg3120Trp) rs149492487
NM_001267550.2(TTN):c.9359G>A (p.Arg3120Gln) rs72647894
NM_001267550.2(TTN):c.9359G>C (p.Arg3120Pro) rs72647894
NM_001267550.2(TTN):c.9363G>A (p.Met3121Ile) rs200413367
NM_001267550.2(TTN):c.93674T>C (p.Ile31225Thr) rs727505175
NM_001267550.2(TTN):c.9369T>G (p.Asp3123Glu) rs397517785
NM_001267550.2(TTN):c.93725G>A (p.Arg31242His) rs369899675
NM_001267550.2(TTN):c.93730G>A (p.Ala31244Thr) rs753663596
NM_001267550.2(TTN):c.93841G>A (p.Gly31281Ser) rs1352252944
NM_001267550.2(TTN):c.9384dup (p.Val3129fs) rs727503683
NM_001267550.2(TTN):c.93886G>A (p.Val31296Ile) rs794729534
NM_001267550.2(TTN):c.93961G>A (p.Val31321Ile) rs794729535
NM_001267550.2(TTN):c.93968C>T (p.Ala31323Val) rs200345129
NM_001267550.2(TTN):c.94045C>T (p.Arg31349Cys) rs727503549
NM_001267550.2(TTN):c.94052C>T (p.Ser31351Leu) rs794729536
NM_001267550.2(TTN):c.94057A>T (p.Thr31353Ser) rs727503548
NM_001267550.2(TTN):c.94075G>A (p.Val31359Ile) rs780436747
NM_001267550.2(TTN):c.94157A>C (p.Glu31386Ala) rs772833696
NM_001267550.2(TTN):c.94204G>A (p.Ala31402Thr) rs794729537
NM_001267550.2(TTN):c.94282C>A (p.Arg31428Ser) rs190282707
NM_001267550.2(TTN):c.94295C>T (p.Pro31432Leu) rs759415579
NM_001267550.2(TTN):c.9434G>A (p.Arg3145Lys) rs727503682
NM_001267550.2(TTN):c.94373A>G (p.Glu31458Gly) rs763832963
NM_001267550.2(TTN):c.9443G>A (p.Arg3148His) rs368786036
NM_001267550.2(TTN):c.9449G>A (p.Arg3150Gln) rs141093658
NM_001267550.2(TTN):c.94502T>C (p.Ile31501Thr) rs758756316
NM_001267550.2(TTN):c.94553T>C (p.Val31518Ala) rs377016580
NM_001267550.2(TTN):c.94627A>G (p.Ile31543Val) rs771491701
NM_001267550.2(TTN):c.94629A>G (p.Ile31543Met) rs397517759
NM_001267550.2(TTN):c.94664G>A (p.Arg31555His) rs727503545
NM_001267550.2(TTN):c.94748G>A (p.Arg31583His) rs727503544
NM_001267550.2(TTN):c.94774G>A (p.Val31592Ile) rs370918800
NM_001267550.2(TTN):c.94828G>A (p.Ala31610Thr) rs141357723
NM_001267550.2(TTN):c.94856G>A (p.Arg31619Gln) rs527976757
NM_001267550.2(TTN):c.9487C>T (p.Arg3163Cys) rs140664731
NM_001267550.2(TTN):c.9488G>A (p.Arg3163His) rs149755500
NM_001267550.2(TTN):c.95063T>C (p.Leu31688Ser) rs794729538
NM_001267550.2(TTN):c.95068G>A (p.Val31690Met) rs727503543
NM_001267550.2(TTN):c.95083G>A (p.Gly31695Arg) rs376403373
NM_001267550.2(TTN):c.95119G>C (p.Asp31707His) rs1360232560
NM_001267550.2(TTN):c.95242C>T (p.Arg31748Cys) rs142525903
NM_001267550.2(TTN):c.95270T>C (p.Ile31757Thr) rs72648259
NM_001267550.2(TTN):c.95281G>A (p.Glu31761Lys) rs727505342
NM_001267550.2(TTN):c.95312G>A (p.Arg31771Lys) rs397517760
NM_001267550.2(TTN):c.95342G>A (p.Arg31781Gln) rs748984928
NM_001267550.2(TTN):c.95344G>A (p.Val31782Met) rs377076423
NM_001267550.2(TTN):c.95363A>G (p.Tyr31788Cys) rs397517761
NM_001267550.2(TTN):c.95450T>C (p.Val31817Ala) rs758207460
NM_001267550.2(TTN):c.95468A>G (p.His31823Arg) rs794729539
NM_001267550.2(TTN):c.95521A>G (p.Asn31841Asp) rs794729540
NM_001267550.2(TTN):c.95543_95545AGA[2] (p.Lys31850del) rs727504556
NM_001267550.2(TTN):c.95557C>T (p.Arg31853Cys) rs727503542
NM_001267550.2(TTN):c.95566C>T (p.Arg31856Cys) rs72648261
NM_001267550.2(TTN):c.95567G>A (p.Arg31856His) rs876658093
NM_001267550.2(TTN):c.95594A>T (p.Asp31865Val) rs876658094
NM_001267550.2(TTN):c.95617C>A (p.Leu31873Met) rs748974241
NM_001267550.2(TTN):c.95653G>A (p.Ala31885Thr) rs72648263
NM_001267550.2(TTN):c.9571C>G (p.Gln3191Glu) rs33997263
NM_001267550.2(TTN):c.95732G>A (p.Gly31911Glu) rs778837156
NM_001267550.2(TTN):c.95744C>T (p.Ala31915Val) rs1553519431
NM_001267550.2(TTN):c.95798C>T (p.Pro31933Leu) rs769829272
NM_001267550.2(TTN):c.95806G>A (p.Asp31936Asn) rs267599025
NM_001267550.2(TTN):c.95848G>A (p.Glu31950Lys) rs727505199
NM_001267550.2(TTN):c.95864A>T (p.Gln31955Leu) rs552683796
NM_001267550.2(TTN):c.95873G>A (p.Arg31958Gln) rs763270971
NM_001267550.2(TTN):c.95923C>T (p.Leu31975Phe) rs757718784
NM_001267550.2(TTN):c.95962G>A (p.Val31988Met) rs756469423
NM_001267550.2(TTN):c.95968G>A (p.Val31990Met) rs727503541
NM_001267550.2(TTN):c.96112G>A (p.Val32038Ile) rs753330318
NM_001267550.2(TTN):c.9611G>A (p.Arg3204Gln) rs775137389
NM_001267550.2(TTN):c.96140C>T (p.Thr32047Met) rs375640847
NM_001267550.2(TTN):c.96173G>A (p.Arg32058Gln) rs374063064
NM_001267550.2(TTN):c.961G>A (p.Val321Ile) rs876658099
NM_001267550.2(TTN):c.96212T>G (p.Ile32071Arg) rs755545981
NM_001267550.2(TTN):c.96229C>T (p.Arg32077Trp) rs751316145
NM_001267550.2(TTN):c.96235G>A (p.Asp32079Asn) rs200540781
NM_001267550.2(TTN):c.96286G>A (p.Ala32096Thr) rs376039623
NM_001267550.2(TTN):c.96299T>C (p.Val32100Ala) rs794729541
NM_001267550.2(TTN):c.96378G>C (p.Trp32126Cys) rs794729542
NM_001267550.2(TTN):c.96478A>G (p.Ser32160Gly) rs727504907
NM_001267550.2(TTN):c.96499T>C (p.Ser32167Pro) rs727504889
NM_001267550.2(TTN):c.96526T>A (p.Tyr32176Asn) rs377291343
NM_001267550.2(TTN):c.96535G>A (p.Val32179Met) rs727505082
NM_001267550.2(TTN):c.96604G>T (p.Val32202Leu) rs755717335
NM_001267550.2(TTN):c.96637G>A (p.Asp32213Asn) rs764561909
NM_001267550.2(TTN):c.96659C>T (p.Thr32220Ile) rs727505204
NM_001267550.2(TTN):c.96807A>T (p.Glu32269Asp) rs876658095
NM_001267550.2(TTN):c.9683C>G (p.Ser3228Cys) rs371249764
NM_001267550.2(TTN):c.96931A>G (p.Met32311Val) rs727504981
NM_001267550.2(TTN):c.9701A>G (p.Asn3234Ser) rs397517791
NM_001267550.2(TTN):c.97051G>A (p.Glu32351Lys) rs727504879
NM_001267550.2(TTN):c.97055G>A (p.Arg32352His) rs575939045
NM_001267550.2(TTN):c.9707C>T (p.Pro3236Leu) rs146199720
NM_001267550.2(TTN):c.97099C>T (p.Arg32367Cys) rs202064385
NM_001267550.2(TTN):c.97111A>G (p.Ile32371Val) rs397517766
NM_001267550.2(TTN):c.9713C>T (p.Pro3238Leu) rs397517792
NM_001267550.2(TTN):c.97151T>C (p.Val32384Ala) rs794729543
NM_001267550.2(TTN):c.97177A>G (p.Lys32393Glu) rs374081110
NM_001267550.2(TTN):c.97198C>A (p.Pro32400Thr) rs373876117
NM_001267550.2(TTN):c.97204_97205delinsAG (p.Pro32402Arg) rs864622675
NM_001267550.2(TTN):c.97247C>T (p.Ser32416Leu) rs377412567
NM_001267550.2(TTN):c.97285G>A (p.Gly32429Ser) rs397517768
NM_001267550.2(TTN):c.97319G>A (p.Arg32440His) rs750047570
NM_001267550.2(TTN):c.97331G>A (p.Arg32444His) rs184922462
NM_001267550.2(TTN):c.97348G>A (p.Val32450Ile) rs397517769
NM_001267550.2(TTN):c.97396G>A (p.Glu32466Lys) rs55915651
NM_001267550.2(TTN):c.97418G>A (p.Arg32473His) rs397517770
NM_001267550.2(TTN):c.97433A>C (p.Asn32478Thr) rs876658096
NM_001267550.2(TTN):c.97436G>A (p.Arg32479His) rs369845358
NM_001267550.2(TTN):c.97442G>A (p.Gly32481Glu) rs201364164
NM_001267550.2(TTN):c.97445T>C (p.Ile32482Thr) rs773555433
NM_001267550.2(TTN):c.97472T>C (p.Ile32491Thr) rs781572378
NM_001267550.2(TTN):c.97480C>T (p.Arg32494Cys) rs727503539
NM_001267550.2(TTN):c.9749T>G (p.Val3250Gly) rs55634230
NM_001267550.2(TTN):c.974T>C (p.Leu325Ser) rs755076118
NM_001267550.2(TTN):c.97534T>A (p.Ser32512Thr) rs794729544
NM_001267550.2(TTN):c.97538G>A (p.Arg32513His) rs201080904
NM_001267550.2(TTN):c.97546A>T (p.Met32516Leu) rs794729545
NM_001267550.2(TTN):c.97606G>T (p.Val32536Leu) rs794729546
NM_001267550.2(TTN):c.97642C>T (p.Arg32548Cys) rs377599569
NM_001267550.2(TTN):c.97672C>T (p.Arg32558Trp) rs727505090
NM_001267550.2(TTN):c.9769C>A (p.Arg3257Ser) rs374521620
NM_001267550.2(TTN):c.97742G>T (p.Gly32581Val) rs397517771
NM_001267550.2(TTN):c.9776G>A (p.Cys3259Tyr) rs794729585
NM_001267550.2(TTN):c.97859C>T (p.Ala32620Val) rs397517772
NM_001267550.2(TTN):c.97910T>C (p.Ile32637Thr) rs794729547
NM_001267550.2(TTN):c.97952A>C (p.Asn32651Thr) rs794729548
NM_001267550.2(TTN):c.97973G>A (p.Arg32658Gln) rs769581585
NM_001267550.2(TTN):c.97992C>A (p.His32664Gln) rs794729549
NM_001267550.2(TTN):c.98000A>G (p.Gln32667Arg) rs397517773
NM_001267550.2(TTN):c.98021G>A (p.Arg32674His) rs750969198
NM_001267550.2(TTN):c.98075C>G (p.Thr32692Arg) rs727505311
NM_001267550.2(TTN):c.98095C>T (p.Leu32699Phe) rs397517774
NM_001267550.2(TTN):c.98158G>A (p.Gly32720Ser) rs727504768
NM_001267550.2(TTN):c.98161G>A (p.Val32721Ile) rs533651182
NM_001267550.2(TTN):c.9820A>C (p.Lys3274Gln) rs201696360
NM_001267550.2(TTN):c.98242C>T (p.Arg32748Cys) rs72648272
NM_001267550.2(TTN):c.98243G>A (p.Arg32748His) rs397517775
NM_001267550.2(TTN):c.98286C>G (p.Ile32762Met) rs794729550
NM_001267550.2(TTN):c.98296G>T (p.Asp32766Tyr) rs727504449
NM_001267550.2(TTN):c.98453G>A (p.Arg32818Lys) rs794729551
NM_001267550.2(TTN):c.98465A>G (p.Asp32822Gly) rs191054704
NM_001267550.2(TTN):c.9851A>G (p.Lys3284Arg) rs147903846
NM_001267550.2(TTN):c.9857A>G (p.Lys3286Arg) rs200052398
NM_001267550.2(TTN):c.98591T>C (p.Val32864Ala) rs201257063
NM_001267550.2(TTN):c.98605C>T (p.Arg32869Cys) rs186244950
NM_001267550.2(TTN):c.98641C>T (p.Pro32881Ser) rs367979582
NM_001267550.2(TTN):c.98684-10A>G rs727505072
NM_001267550.2(TTN):c.98726T>C (p.Val32909Ala) rs368877793
NM_001267550.2(TTN):c.98759G>A (p.Arg32920Gln) rs752015224
NM_001267550.2(TTN):c.9875A>G (p.Gln3292Arg) rs794729586
NM_001267550.2(TTN):c.98806C>T (p.Arg32936Cys) rs764276622
NM_001267550.2(TTN):c.98809A>G (p.Lys32937Glu) rs200544701
NM_001267550.2(TTN):c.98826C>G (p.Asp32942Glu) rs190967471
NM_001267550.2(TTN):c.9884C>T (p.Thr3295Met) rs191708454
NM_001267550.2(TTN):c.98866A>G (p.Met32956Val) rs727503538
NM_001267550.2(TTN):c.98867T>C (p.Met32956Thr) rs727504962
NM_001267550.2(TTN):c.98920G>A (p.Ala32974Thr) rs374454949
NM_001267550.2(TTN):c.98924A>T (p.Gln32975Leu) rs776743138
NM_001267550.2(TTN):c.98959T>C (p.Ser32987Pro) rs758494581
NM_001267550.2(TTN):c.98959_98960delinsCT (p.Ser32987Leu) rs727504588
NM_001267550.2(TTN):c.98960C>T (p.Ser32987Phe) rs746380940
NM_001267550.2(TTN):c.99016G>A (p.Glu33006Lys) rs201931674
NM_001267550.2(TTN):c.9908C>T (p.Pro3303Leu) rs201379132
NM_001267550.2(TTN):c.99102G>C (p.Trp33034Cys) rs397517778
NM_001267550.2(TTN):c.99151G>A (p.Glu33051Lys) rs144319649
NM_001267550.2(TTN):c.99273A>G (p.Ile33091Met) rs746305727
NM_001267550.2(TTN):c.99278C>G (p.Thr33093Ser) rs777386197
NM_001267550.2(TTN):c.99290-6G>T rs727504987
NM_001267550.2(TTN):c.99434G>A (p.Arg33145Gln) rs371531675
NM_001267550.2(TTN):c.99460C>T (p.Arg33154Cys) rs143556947
NM_001267550.2(TTN):c.99466C>A (p.His33156Asn) rs374666520
NM_001267550.2(TTN):c.99466C>T (p.His33156Tyr) rs374666520
NM_001267550.2(TTN):c.99478G>A (p.Val33160Ile) rs794729553
NM_001267550.2(TTN):c.99517T>A (p.Cys33173Ser) rs773021609
NM_001267550.2(TTN):c.99668G>A (p.Arg33223His) rs369081242
NM_001267550.2(TTN):c.99814C>T (p.Leu33272Phe) rs397517780
NM_001267550.2(TTN):c.99896T>C (p.Val33299Ala) rs794729554
NM_001267550.2(TTN):c.99901G>A (p.Glu33301Lys) rs72648278
NM_001267550.2(TTN):c.99940C>T (p.Pro33314Ser) rs754605294
NM_001267550.2(TTN):c.99951T>G (p.Asp33317Glu) rs794729555
NM_001267550.2(TTN):c.[106154A>C];[45599C>G]
NM_001267550.2(TTN):c.[14217A>C];[84105A>T]
NM_001267550.2(TTN):c.[46387G>A];[75050T>C]
NM_001267550.2(TTN):c.[83315A>T];[91762G>A]
NM_133378.4(TTN):c.19367-15_19367-11dup rs876658044
NM_133378.4(TTN):c.2076G>T
NM_133378.4(TTN):c.22468+5G>A rs727503645
NM_133378.4(TTN):c.28030+4C>T rs368538884
NM_133378.4(TTN):c.32854+1G>A rs368219776
NM_133378.4(TTN):c.41829-13G>A
NM_133378.4(TTN):c.45877G>A
NM_133378.4(TTN):c.47178A>C
NM_133378.4(TTN):c.47599-10C>G
NM_133378.4(TTN):c.51070A>G
NM_133378.4(TTN):c.52301A>G rs199512049
NM_133378.4(TTN):c.87965G>T
NM_133378.4(TTN):c.96125G>A
NM_133378.4(TTN):c.[45418A>G;45419A>T]
NM_133378.4:c.(?_37112)_(50143_?)dup
NM_133379.5(TTN):c.10303+2764T>C rs199565715
NM_133379.5(TTN):c.1398+5G>A rs542965530
NM_133379.5(TTN):c.1399-3C>T rs397517486
NM_133379.5(TTN):c.583+5G>A rs397517663

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.