ClinVar Miner

List of variants in gene TTN reported as benign

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 1827
Download table as spreadsheet
HGVS dbSNP
GRCh37/hg19 2q31.2(chr2:179395958-179522194)x3
NC_000002.12:g.178555347_178555348del rs145641095
NC_000002.12:g.178582901del rs143554070
NC_000002.12:g.178604458del rs72646817
NC_000002.12:g.178617583_178617586del rs3835071
NC_000002.12:g.178617621_178617624del rs72677235
NC_000002.12:g.178619018_178619020del rs148909508
NC_000002.12:g.178654185_178654187del rs139167585
NC_000002.12:g.178781584dup rs141324241
NC_000002.12:g.178783236_178783240del rs67143080
NM_001256850.1(TTN):c.32389+5A>C rs373367032
NM_001256850.1(TTN):c.33586+8C>A rs762808097
NM_001256850.1(TTN):c.45935-9A>C rs146208555
NM_001267550.1(TTN):c.45599C>G rs201057307
NM_001267550.1(TTN):c.46387G>A rs200042932
NM_001267550.1(TTN):c.83315A>T rs578191491
NM_001267550.2(TTN):c.*1015A>G rs72629798
NM_001267550.2(TTN):c.*130G>C rs144026962
NM_001267550.2(TTN):c.*25C>T rs370597649
NM_001267550.2(TTN):c.*280A>G rs549242855
NM_001267550.2(TTN):c.*587T>A rs114788736
NM_001267550.2(TTN):c.*59G>A rs72629795
NM_001267550.2(TTN):c.*664G>T rs72629796
NM_001267550.2(TTN):c.*6C>A rs188728343
NM_001267550.2(TTN):c.100059T>A (p.Ile33353=) rs56026369
NM_001267550.2(TTN):c.100094G>A (p.Arg33365Gln) rs55742743
NM_001267550.2(TTN):c.100095G>A (p.Arg33365=) rs786205341
NM_001267550.2(TTN):c.100096G>A (p.Val33366Ile) rs55675869
NM_001267550.2(TTN):c.100171+145T>A rs4894027
NM_001267550.2(TTN):c.100172-17dup rs397517782
NM_001267550.2(TTN):c.100226G>A (p.Cys33409Tyr) rs201112096
NM_001267550.2(TTN):c.100315T>C (p.Trp33439Arg) rs545443009
NM_001267550.2(TTN):c.100400T>G (p.Val33467Gly) rs200166942
NM_001267550.2(TTN):c.100432T>G (p.Trp33478Gly) rs372304158
NM_001267550.2(TTN):c.100447G>C (p.Glu33483Gln) rs368321767
NM_001267550.2(TTN):c.100459C>T (p.Pro33487Ser) rs72629779
NM_001267550.2(TTN):c.100579G>A (p.Val33527Ile) rs2278196
NM_001267550.2(TTN):c.100766-11_100766-10delTT rs749872538
NM_001267550.2(TTN):c.100766-9C>T rs77483833
NM_001267550.2(TTN):c.100766-9dup rs202238743
NM_001267550.2(TTN):c.101064T>C (p.Asp33688=) rs368168812
NM_001267550.2(TTN):c.101211C>T (p.Leu33737=) rs786205333
NM_001267550.2(TTN):c.101212C>T (p.Arg33738Cys) rs56273463
NM_001267550.2(TTN):c.101245G>A (p.Val33749Met) rs201554140
NM_001267550.2(TTN):c.101291C>T (p.Ala33764Val) rs773542514
NM_001267550.2(TTN):c.101376T>C (p.Tyr33792=) rs367732133
NM_001267550.2(TTN):c.101406C>G (p.Val33802=) rs55802460
NM_001267550.2(TTN):c.101665G>A (p.Val33889Ile) rs34924609
NM_001267550.2(TTN):c.101697C>T (p.Asp33899=) rs114267234
NM_001267550.2(TTN):c.101766G>C (p.Gln33922His) rs55886356
NM_001267550.2(TTN):c.101803A>G (p.Ile33935Val) rs56376197
NM_001267550.2(TTN):c.101853A>C (p.Arg33951Ser)
NM_001267550.2(TTN):c.101891G>A (p.Arg33964His) rs55669553
NM_001267550.2(TTN):c.101925A>G (p.Leu33975=) rs201246720
NM_001267550.2(TTN):c.102103G>A (p.Asp34035Asn) rs144963736
NM_001267550.2(TTN):c.102190G>A (p.Ala34064Thr) rs200237973
NM_001267550.2(TTN):c.102271C>T (p.Arg34091Trp) rs140319117
NM_001267550.2(TTN):c.102287C>A (p.Thr34096Asn) rs375002174
NM_001267550.2(TTN):c.102519C>T (p.Gly34173=) rs2857265
NM_001267550.2(TTN):c.102561C>T (p.Tyr34187=) rs375625664
NM_001267550.2(TTN):c.102595A>G (p.Ile34199Val) rs56347248
NM_001267550.2(TTN):c.102696C>T (p.Val34232=) rs202180775
NM_001267550.2(TTN):c.102737G>A (p.Arg34246His) rs372716177
NM_001267550.2(TTN):c.102751A>G (p.Met34251Val) rs56173891
NM_001267550.2(TTN):c.102790C>T (p.Leu34264Phe)
NM_001267550.2(TTN):c.102832G>T (p.Gly34278Ter) rs786205337
NM_001267550.2(TTN):c.102833G>T (p.Gly34278Val) rs3731752
NM_001267550.2(TTN):c.102963C>T (p.Asn34321=) rs528502993
NM_001267550.2(TTN):c.102984C>T (p.Asp34328=) rs541125667
NM_001267550.2(TTN):c.10303+134C>A rs2291309
NM_001267550.2(TTN):c.10304-162T>C rs77535462
NM_001267550.2(TTN):c.103053C>T (p.Thr34351=) rs3731753
NM_001267550.2(TTN):c.103147G>C (p.Glu34383Gln) rs148525155
NM_001267550.2(TTN):c.103292C>T (p.Thr34431Met) rs192001910
NM_001267550.2(TTN):c.103363C>T (p.Arg34455Cys) rs72629785
NM_001267550.2(TTN):c.103365C>T (p.Arg34455=) rs398124462
NM_001267550.2(TTN):c.103412G>A (p.Arg34471Gln) rs149391616
NM_001267550.2(TTN):c.103417G>A (p.Val34473Ile) rs188917199
NM_001267550.2(TTN):c.103430T>C (p.Ile34477Thr) rs751914956
NM_001267550.2(TTN):c.103524C>T (p.Val34508=) rs587780985
NM_001267550.2(TTN):c.103688T>C (p.Val34563Ala) rs55945684
NM_001267550.2(TTN):c.103781G>A (p.Arg34594His) rs3829747
NM_001267550.2(TTN):c.10378C>G (p.Pro3460Ala) rs201735487
NM_001267550.2(TTN):c.103913G>A (p.Arg34638His) rs371528685
NM_001267550.2(TTN):c.103974C>T (p.Ile34658=) rs199714102
NM_001267550.2(TTN):c.103992C>G (p.Leu34664=) rs375120372
NM_001267550.2(TTN):c.103993C>G (p.Leu34665Val) rs370890922
NM_001267550.2(TTN):c.104045G>A (p.Arg34682His)
NM_001267550.2(TTN):c.104205G>A (p.Thr34735=) rs752424146
NM_001267550.2(TTN):c.104251G>C (p.Ala34751Pro) rs185683410
NM_001267550.2(TTN):c.104277G>A (p.Lys34759=) rs377391143
NM_001267550.2(TTN):c.104298T>C (p.Ala34766=) rs751788327
NM_001267550.2(TTN):c.104347C>T (p.Leu34783Phe) rs539735520
NM_001267550.2(TTN):c.104365G>A (p.Glu34789Lys) rs190565627
NM_001267550.2(TTN):c.104377A>C (p.Met34793Leu) rs72629787
NM_001267550.2(TTN):c.104457C>T (p.Tyr34819=) rs548677252
NM_001267550.2(TTN):c.104522G>A (p.Arg34841His) rs373709706
NM_001267550.2(TTN):c.104560G>C (p.Val34854Leu) rs55866005
NM_001267550.2(TTN):c.104576G>A (p.Arg34859Gln) rs68080670
NM_001267550.2(TTN):c.104591C>T (p.Pro34864Leu) rs72629788
NM_001267550.2(TTN):c.104592G>A (p.Pro34864=) rs144094650
NM_001267550.2(TTN):c.104691G>A (p.Ser34897=) rs369619711
NM_001267550.2(TTN):c.104769A>C (p.Thr34923=) rs56375087
NM_001267550.2(TTN):c.104774A>C (p.Glu34925Ala) rs201218828
NM_001267550.2(TTN):c.104890A>T (p.Asn34964Tyr)
NM_001267550.2(TTN):c.104988C>T (p.Val34996=) rs3829748
NM_001267550.2(TTN):c.105085T>C (p.Leu35029=) rs374678473
NM_001267550.2(TTN):c.105127C>T (p.Arg35043Cys) rs200378865
NM_001267550.2(TTN):c.105180G>C (p.Glu35060Asp) rs56308529
NM_001267550.2(TTN):c.105183G>A (p.Ala35061=) rs371075036
NM_001267550.2(TTN):c.105212C>G (p.Ser35071Cys) rs3813249
NM_001267550.2(TTN):c.105228G>A (p.Ser35076=) rs55938627
NM_001267550.2(TTN):c.105383C>T (p.Ala35128Val) rs758458467
NM_001267550.2(TTN):c.105384A>G (p.Ala35128=) rs3813250
NM_001267550.2(TTN):c.105406C>T (p.Arg35136Trp) rs372875128
NM_001267550.2(TTN):c.105468G>A (p.Pro35156=) rs55806007
NM_001267550.2(TTN):c.105490C>T (p.Arg35164Cys) rs200123047
NM_001267550.2(TTN):c.105512C>T (p.Thr35171Ile) rs774524898
NM_001267550.2(TTN):c.105520C>T (p.Arg35174Cys)
NM_001267550.2(TTN):c.105529G>A (p.Val35177Met) rs55865284
NM_001267550.2(TTN):c.105570A>G (p.Ser35190=) rs377340289
NM_001267550.2(TTN):c.105582C>T (p.Ser35194=) rs3829749
NM_001267550.2(TTN):c.105653T>C (p.Ile35218Thr) rs143499441
NM_001267550.2(TTN):c.105769G>A (p.Glu35257Lys) rs56324595
NM_001267550.2(TTN):c.105781C>T (p.Pro35261Ser) rs786205336
NM_001267550.2(TTN):c.105782C>T (p.Pro35261Leu) rs16866380
NM_001267550.2(TTN):c.105787G>T (p.Ala35263Ser) rs67254537
NM_001267550.2(TTN):c.105787_105788delinsTT (p.Ala35263Phe) rs794729250
NM_001267550.2(TTN):c.105788C>T (p.Ala35263Val) rs66961115
NM_001267550.2(TTN):c.106020T>C (p.Gly35340=) rs148865574
NM_001267550.2(TTN):c.10608G>A (p.Gln3536=) rs371651343
NM_001267550.2(TTN):c.106275G>C (p.Gly35425=) rs56207956
NM_001267550.2(TTN):c.106442A>G (p.Lys35481Arg) rs200716018
NM_001267550.2(TTN):c.106468T>C (p.Tyr35490His) rs199663911
NM_001267550.2(TTN):c.106476T>C (p.Cys35492=) rs6725673
NM_001267550.2(TTN):c.106578T>A (p.Ser35526=) rs55838839
NM_001267550.2(TTN):c.106580A>T (p.Glu35527Val) rs55725279
NM_001267550.2(TTN):c.106619T>C (p.Ile35540Thr) rs55880440
NM_001267550.2(TTN):c.106638G>A (p.Arg35546=) rs56324602
NM_001267550.2(TTN):c.106675G>C (p.Glu35559Gln) rs199632397
NM_001267550.2(TTN):c.106787C>T (p.Thr35596Ile) rs55842557
NM_001267550.2(TTN):c.106788A>T (p.Thr35596=) rs369896045
NM_001267550.2(TTN):c.106820C>T (p.Ala35607Val) rs377337528
NM_001267550.2(TTN):c.106857C>T (p.Asn35619=) rs116604145
NM_001267550.2(TTN):c.106920G>A (p.Leu35640=) rs183923129
NM_001267550.2(TTN):c.106926C>T (p.Gly35642=) rs761965591
NM_001267550.2(TTN):c.106955G>A (p.Arg35652Gln) rs200497615
NM_001267550.2(TTN):c.107080C>G (p.Leu35694Val) rs769369764
NM_001267550.2(TTN):c.107089G>C (p.Glu35697Gln) rs199531140
NM_001267550.2(TTN):c.107267T>C (p.Val35756Ala) rs16866378
NM_001267550.2(TTN):c.10726A>G (p.Thr3576Ala) rs6433728
NM_001267550.2(TTN):c.107377+14C>T rs367908657
NM_001267550.2(TTN):c.107377+216C>T rs10515939
NM_001267550.2(TTN):c.107397C>T (p.Ser35799=) rs371480338
NM_001267550.2(TTN):c.107576T>C (p.Met35859Thr) rs72629793
NM_001267550.2(TTN):c.107605A>G (p.Ser35869Gly) rs201835888
NM_001267550.2(TTN):c.107681-46T>A rs16866373
NM_001267550.2(TTN):c.107688G>A (p.Pro35896=) rs542575761
NM_001267550.2(TTN):c.107700A>G (p.Glu35900=) rs55832587
NM_001267550.2(TTN):c.107766T>C (p.Gly35922=) rs147293964
NM_001267550.2(TTN):c.107961T>C (p.His35987=) rs377439315
NM_001267550.2(TTN):c.10854A>C (p.Gln3618His) rs79466278
NM_001267550.2(TTN):c.11019C>T (p.Cys3673=) rs72955212
NM_001267550.2(TTN):c.11255-17_11255-16del rs72647895
NM_001267550.2(TTN):c.11311+1070_11311+1071insG rs574419329
NM_001267550.2(TTN):c.11311+1341T>C rs200284932
NM_001267550.2(TTN):c.11311+1372C>T rs141407971
NM_001267550.2(TTN):c.11311+1857A>G rs922986
NM_001267550.2(TTN):c.11311+2316A>T rs369610255
NM_001267550.2(TTN):c.11311+2530C>A rs147087155
NM_001267550.2(TTN):c.11311+2899T>C rs10803917
NM_001267550.2(TTN):c.11311+3448A>G rs541264551
NM_001267550.2(TTN):c.11311+3792A>G rs16866490
NM_001267550.2(TTN):c.11311+4179T>C rs146470872
NM_001267550.2(TTN):c.11311+4200C>T rs72648904
NM_001267550.2(TTN):c.11311+4332C>T rs72648905
NM_001267550.2(TTN):c.11311+4338A>C rs139344272
NM_001267550.2(TTN):c.11311+4593T>G rs72648906
NM_001267550.2(TTN):c.11311+4968T>C rs139669372
NM_001267550.2(TTN):c.11311+5478T>G rs72648908
NM_001267550.2(TTN):c.11311+5544G>A rs145029589
NM_001267550.2(TTN):c.11312-3515T>A rs10497519
NM_001267550.2(TTN):c.11312-3829T>C rs16866488
NM_001267550.2(TTN):c.11312-3971G>C rs16866489
NM_001267550.2(TTN):c.11312-4333T>C rs139775634
NM_001267550.2(TTN):c.11312-4498G>A rs186841908
NM_001267550.2(TTN):c.11312-5032C>T rs72648911
NM_001267550.2(TTN):c.11312-5203G>A rs72648910
NM_001267550.2(TTN):c.11312-5227T>C rs61233923
NM_001267550.2(TTN):c.11312-5251C>A rs143135505
NM_001267550.2(TTN):c.11312-5284T>C rs138832697
NM_001267550.2(TTN):c.11312-5286C>T rs200953966
NM_001267550.2(TTN):c.11370A>G (p.Gln3790=) rs72648918
NM_001267550.2(TTN):c.11422C>T (p.Pro3808Ser) rs2627037
NM_001267550.2(TTN):c.11506G>A (p.Val3836Met) rs397517825
NM_001267550.2(TTN):c.11672C>T (p.Thr3891Ile) rs148164929
NM_001267550.2(TTN):c.11719C>G (p.Leu3907Val) rs55853696
NM_001267550.2(TTN):c.11811T>C (p.Pro3937=) rs571602215
NM_001267550.2(TTN):c.11969C>T (p.Pro3990Leu) rs33971253
NM_001267550.2(TTN):c.11991T>C (p.Ile3997=) rs565546452
NM_001267550.2(TTN):c.12024C>T (p.Leu4008=) rs371694842
NM_001267550.2(TTN):c.12117C>T (p.Pro4039=) rs55895721
NM_001267550.2(TTN):c.1213G>A (p.Ala405Thr) rs112266780
NM_001267550.2(TTN):c.12195T>C (p.Leu4065=) rs201129413
NM_001267550.2(TTN):c.12233C>T (p.Thr4078Ile) rs80136515
NM_001267550.2(TTN):c.12234C>G (p.Thr4078=) rs192857526
NM_001267550.2(TTN):c.12235A>G (p.Ile4079Val) rs34070843
NM_001267550.2(TTN):c.12255T>C (p.Ile4085=) rs2742357
NM_001267550.2(TTN):c.12307T>C (p.Leu4103=) rs587780988
NM_001267550.2(TTN):c.12580A>T (p.Ile4194Phe) rs34618570
NM_001267550.2(TTN):c.12733A>C (p.Asn4245His) rs199652066
NM_001267550.2(TTN):c.12780G>A (p.Ala4260=) rs746578
NM_001267550.2(TTN):c.12780G>T (p.Ala4260=) rs746578
NM_001267550.2(TTN):c.12955G>A (p.Ala4319Thr) rs150137596
NM_001267550.2(TTN):c.12986G>A (p.Arg4329Lys) rs199560188
NM_001267550.2(TTN):c.13194A>G (p.Gln4398=) rs375347596
NM_001267550.2(TTN):c.13202G>A (p.Arg4401Gln) rs200431386
NM_001267550.2(TTN):c.13218C>T (p.Ala4406=) rs1883084
NM_001267550.2(TTN):c.13287T>C (p.Ala4429=) rs370604524
NM_001267550.2(TTN):c.13594A>C (p.Thr4532Pro) rs2562829
NM_001267550.2(TTN):c.13706G>A (p.Ser4569Asn) rs115532048
NM_001267550.2(TTN):c.13800A>C (p.Leu4600Phe) rs1883085
NM_001267550.2(TTN):c.13859G>A (p.Gly4620Asp) rs55857742
NM_001267550.2(TTN):c.13969A>C (p.Asn4657His) rs200204761
NM_001267550.2(TTN):c.13976A>G (p.Tyr4659Cys) rs34706803
NM_001267550.2(TTN):c.1398+16C>T rs144043280
NM_001267550.2(TTN):c.1398+18A>G rs72647849
NM_001267550.2(TTN):c.14004C>T (p.Thr4668=) rs201200682
NM_001267550.2(TTN):c.14093-138C>T rs2253324
NM_001267550.2(TTN):c.14232C>A (p.Asp4744Glu) rs55906845
NM_001267550.2(TTN):c.14372-256T>C rs2627041
NM_001267550.2(TTN):c.14424G>C (p.Val4808=) rs374479775
NM_001267550.2(TTN):c.14428A>C (p.Lys4810Gln)
NM_001267550.2(TTN):c.14486A>C (p.Gln4829Pro) rs375177753
NM_001267550.2(TTN):c.14525G>A (p.Arg4842Lys) rs2742347
NM_001267550.2(TTN):c.14533G>A (p.Asp4845Asn) rs373378672
NM_001267550.2(TTN):c.14535C>T (p.Asp4845=) rs184307461
NM_001267550.2(TTN):c.14610C>T (p.Ser4870=) rs2742348
NM_001267550.2(TTN):c.14697C>T (p.Ser4899=) rs372740215
NM_001267550.2(TTN):c.14698G>A (p.Ala4900Thr) rs72648923
NM_001267550.2(TTN):c.14765G>A (p.Ser4922Asn) rs184740744
NM_001267550.2(TTN):c.14784C>A (p.Leu4928=) rs373875040
NM_001267550.2(TTN):c.14788C>G (p.Pro4930Ala) rs201744218
NM_001267550.2(TTN):c.14813T>C (p.Phe4938Ser) rs560537668
NM_001267550.2(TTN):c.14870C>G (p.Thr4957Ser) rs72648925
NM_001267550.2(TTN):c.14873A>G (p.Tyr4958Cys) rs530572005
NM_001267550.2(TTN):c.14898T>C (p.Ala4966=) rs370105333
NM_001267550.2(TTN):c.14935+9C>T rs544241749
NM_001267550.2(TTN):c.14973T>C (p.Tyr4991=) rs761666344
NM_001267550.2(TTN):c.14984C>G (p.Pro4995Arg) rs72648927
NM_001267550.2(TTN):c.15016A>G (p.Lys5006Glu) rs886038712
NM_001267550.2(TTN):c.15178G>A (p.Val5060Ile) rs72648929
NM_001267550.2(TTN):c.15178G>C (p.Val5060Leu) rs72648929
NM_001267550.2(TTN):c.15408G>A (p.Ser5136=) rs761269554
NM_001267550.2(TTN):c.15542G>C (p.Gly5181Ala) rs201185434
NM_001267550.2(TTN):c.15552C>T (p.Thr5184=) rs146353237
NM_001267550.2(TTN):c.15561G>A (p.Leu5187=) rs779159076
NM_001267550.2(TTN):c.15561G>T (p.Leu5187=) rs779159076
NM_001267550.2(TTN):c.15563A>C (p.Gln5188Pro) rs72648930
NM_001267550.2(TTN):c.15584A>G (p.Glu5195Gly) rs72648931
NM_001267550.2(TTN):c.15717G>A (p.Thr5239=) rs72648932
NM_001267550.2(TTN):c.15792T>C (p.Ile5264=) rs12993099
NM_001267550.2(TTN):c.15850G>A (p.Val5284Met) rs66839174
NM_001267550.2(TTN):c.15906C>T (p.Val5302=) rs375179152
NM_001267550.2(TTN):c.15986G>A (p.Gly5329Asp) rs202234492
NM_001267550.2(TTN):c.16017G>A (p.Val5339=) rs587780989
NM_001267550.2(TTN):c.16055-9A>C rs368897883
NM_001267550.2(TTN):c.16056T>C (p.Asp5352=) rs376820575
NM_001267550.2(TTN):c.16095C>T (p.Asn5365=) rs72648935
NM_001267550.2(TTN):c.16113T>C (p.Asn5371=) rs143845692
NM_001267550.2(TTN):c.16275G>A (p.Gly5425=) rs772821743
NM_001267550.2(TTN):c.16303G>A (p.Val5435Met) rs72648937
NM_001267550.2(TTN):c.16313A>G (p.Lys5438Arg) rs190636272
NM_001267550.2(TTN):c.16375A>C (p.Lys5459Gln) rs886038713
NM_001267550.2(TTN):c.16422A>G (p.Gln5474=) rs371026448
NM_001267550.2(TTN):c.16515T>C (p.Ser5505=) rs201625116
NM_001267550.2(TTN):c.16529A>G (p.Tyr5510Cys) rs72648939
NM_001267550.2(TTN):c.16546G>T (p.Asp5516Tyr) rs72648940
NM_001267550.2(TTN):c.16551G>A (p.Ser5517=) rs376037792
NM_001267550.2(TTN):c.1662+120A>G rs67587484
NM_001267550.2(TTN):c.16621+10G>A rs539530049
NM_001267550.2(TTN):c.16621+7A>T rs10200398
NM_001267550.2(TTN):c.1663-52A>G rs72647857
NM_001267550.2(TTN):c.16716A>G (p.Pro5572=) rs367821526
NM_001267550.2(TTN):c.16934C>T (p.Pro5645Leu) rs370889765
NM_001267550.2(TTN):c.17048A>G (p.Tyr5683Cys) rs72648942
NM_001267550.2(TTN):c.17115C>T (p.Gly5705=) rs370036981
NM_001267550.2(TTN):c.17183-7C>T rs371785683
NM_001267550.2(TTN):c.17183-9T>C rs141687561
NM_001267550.2(TTN):c.17224C>T (p.Leu5742Phe) rs72648943
NM_001267550.2(TTN):c.17300G>A (p.Ser5767Asn) rs200692495
NM_001267550.2(TTN):c.17312C>G (p.Thr5771Ser) rs16866477
NM_001267550.2(TTN):c.17319C>T (p.Asp5773=) rs760724229
NM_001267550.2(TTN):c.17543G>A (p.Gly5848Glu) rs185962498
NM_001267550.2(TTN):c.17686G>A (p.Glu5896Lys) rs561557554
NM_001267550.2(TTN):c.17741-9A>G rs72648944
NM_001267550.2(TTN):c.177C>T (p.Ser59=) rs191057824
NM_001267550.2(TTN):c.17833T>C (p.Ser5945Pro) rs776790387
NM_001267550.2(TTN):c.17871A>T (p.Gln5957His) rs181067357
NM_001267550.2(TTN):c.17888A>G (p.Glu5963Gly) rs146983095
NM_001267550.2(TTN):c.17928G>A (p.Leu5976=) rs373963067
NM_001267550.2(TTN):c.17989G>A (p.Ala5997Thr) rs72648946
NM_001267550.2(TTN):c.18029-19G>C rs17076
NM_001267550.2(TTN):c.18054A>C (p.Pro6018=) rs575829011
NM_001267550.2(TTN):c.18075C>T (p.Pro6025=) rs557350005
NM_001267550.2(TTN):c.180T>C (p.Asp60=) rs144750850
NM_001267550.2(TTN):c.18307+12A>G rs376899412
NM_001267550.2(TTN):c.18325A>G (p.Lys6109Glu) rs73973139
NM_001267550.2(TTN):c.18363G>A (p.Gln6121=) rs375032616
NM_001267550.2(TTN):c.18379T>G (p.Cys6127Gly) rs370812788
NM_001267550.2(TTN):c.18390A>T (p.Thr6130=) rs66523653
NM_001267550.2(TTN):c.18407G>A (p.Arg6136Gln) rs117551279
NM_001267550.2(TTN):c.18456T>C (p.His6152=) rs756540833
NM_001267550.2(TTN):c.18531G>C (p.Val6177=) rs370684491
NM_001267550.2(TTN):c.18659G>C (p.Cys6220Ser) rs191692293
NM_001267550.2(TTN):c.18669G>A (p.Thr6223=) rs772600691
NM_001267550.2(TTN):c.18684T>C (p.Phe6228=) rs368427156
NM_001267550.2(TTN):c.18745G>A (p.Asp6249Asn) rs201263441
NM_001267550.2(TTN):c.18776C>G (p.Thr6259Ser) rs72648949
NM_001267550.2(TTN):c.18816T>C (p.Ile6272=) rs146219199
NM_001267550.2(TTN):c.18824A>G (p.Asn6275Ser) rs184412722
NM_001267550.2(TTN):c.18856G>A (p.Val6286Ile) rs149131555
NM_001267550.2(TTN):c.18903C>T (p.Thr6301=) rs72648950
NM_001267550.2(TTN):c.18942C>T (p.Thr6314=) rs572285982
NM_001267550.2(TTN):c.18961A>G (p.Ile6321Val) rs145204073
NM_001267550.2(TTN):c.19004A>G (p.Asp6335Gly) rs72648951
NM_001267550.2(TTN):c.19016A>G (p.Tyr6339Cys) rs192553687
NM_001267550.2(TTN):c.19063G>T (p.Asp6355Tyr) rs188878341
NM_001267550.2(TTN):c.19150C>A (p.Pro6384Thr) rs72648953
NM_001267550.2(TTN):c.19191G>A (p.Thr6397=) rs140495148
NM_001267550.2(TTN):c.19204A>G (p.Met6402Val) rs72648954
NM_001267550.2(TTN):c.19301G>A (p.Ser6434Asn) rs11888217
NM_001267550.2(TTN):c.19356C>T (p.Ser6452=) rs369275615
NM_001267550.2(TTN):c.19383T>C (p.Asn6461=) rs76771282
NM_001267550.2(TTN):c.1939-89T>C rs13421990
NM_001267550.2(TTN):c.19547A>T (p.Lys6516Met) rs199796249
NM_001267550.2(TTN):c.19714+113T>C rs2627042
NM_001267550.2(TTN):c.19738C>T (p.Pro6580Ser) rs116572520
NM_001267550.2(TTN):c.19818A>G (p.Lys6606=) rs397517492
NM_001267550.2(TTN):c.19976C>T (p.Thr6659Met) rs16866475
NM_001267550.2(TTN):c.19995A>T (p.Glu6665Asp) rs146828735
NM_001267550.2(TTN):c.20025C>A (p.Ala6675=) rs373842558
NM_001267550.2(TTN):c.20108G>A (p.Arg6703Gln) rs546821182
NM_001267550.2(TTN):c.20142C>T (p.Tyr6714=) rs535793314
NM_001267550.2(TTN):c.20147T>A (p.Met6716Lys) rs28626194
NM_001267550.2(TTN):c.20175A>G (p.Ile6725Met) rs146627500
NM_001267550.2(TTN):c.20236G>A (p.Ala6746Thr) rs202108224
NM_001267550.2(TTN):c.20276-282T>G rs2129110
NM_001267550.2(TTN):c.20335A>T (p.Ser6779Cys) rs149470241
NM_001267550.2(TTN):c.20341G>A (p.Glu6781Lys) rs72648958
NM_001267550.2(TTN):c.20355G>A (p.Ser6785=) rs549470227
NM_001267550.2(TTN):c.20397G>A (p.Arg6799=) rs376573256
NM_001267550.2(TTN):c.20418A>C (p.Lys6806Asn) rs768932465
NM_001267550.2(TTN):c.20602G>A (p.Gly6868Arg) rs17355460
NM_001267550.2(TTN):c.2077-86C>T rs6715901
NM_001267550.2(TTN):c.20772G>A (p.Lys6924=) rs369993514
NM_001267550.2(TTN):c.20792A>G (p.Asn6931Ser) rs200866883
NM_001267550.2(TTN):c.20798G>C (p.Gly6933Ala) rs200118743
NM_001267550.2(TTN):c.20808G>A (p.Arg6936=) rs773342572
NM_001267550.2(TTN):c.20836+18C>T rs759032534
NM_001267550.2(TTN):c.20861C>T (p.Ala6954Val) rs17355446
NM_001267550.2(TTN):c.21019A>T (p.Ile7007Phe) rs114626713
NM_001267550.2(TTN):c.21044C>T (p.Ala7015Val) rs72648960
NM_001267550.2(TTN):c.21106G>A (p.Asp7036Asn) rs72648962
NM_001267550.2(TTN):c.21148C>T (p.Leu7050=) rs202089818
NM_001267550.2(TTN):c.21157A>C (p.Thr7053Pro) rs727504741
NM_001267550.2(TTN):c.21173G>A (p.Gly7058Asp) rs72648964
NM_001267550.2(TTN):c.21197A>G (p.Lys7066Arg) rs553548392
NM_001267550.2(TTN):c.21276C>T (p.Thr7092=) rs372264428
NM_001267550.2(TTN):c.21364G>A (p.Ala7122Thr) rs201394117
NM_001267550.2(TTN):c.21404-4A>G rs72648965
NM_001267550.2(TTN):c.21489C>G (p.Thr7163=) rs376882041
NM_001267550.2(TTN):c.2151C>T (p.Pro717=) rs374570732
NM_001267550.2(TTN):c.21555C>A (p.Ile7185=) rs201155967
NM_001267550.2(TTN):c.21656C>T (p.Ser7219Phe) rs201029552
NM_001267550.2(TTN):c.21668G>A (p.Arg7223His) rs138853909
NM_001267550.2(TTN):c.21779C>A (p.Ser7260Tyr) rs187925021
NM_001267550.2(TTN):c.21800G>A (p.Gly7267Asp) rs375627540
NM_001267550.2(TTN):c.21962-23A>G rs2742327
NM_001267550.2(TTN):c.21962-6C>T rs374870814
NM_001267550.2(TTN):c.22074A>G (p.Lys7358=) rs34562585
NM_001267550.2(TTN):c.22077A>T (p.Gly7359=) rs202102237
NM_001267550.2(TTN):c.22080T>C (p.Asp7360=) rs16866473
NM_001267550.2(TTN):c.22240+7A>C rs368101794
NM_001267550.2(TTN):c.22384G>C (p.Asp7462His) rs12693166
NM_001267550.2(TTN):c.22386T>A (p.Asp7462Glu) rs183482849
NM_001267550.2(TTN):c.22420G>A (p.Ala7474Thr) rs759713604
NM_001267550.2(TTN):c.22439A>C (p.Gln7480Pro) rs201065037
NM_001267550.2(TTN):c.22473C>T (p.Cys7491=) rs566454891
NM_001267550.2(TTN):c.22529-47dup rs143276035
NM_001267550.2(TTN):c.22611T>C (p.His7537=) rs16866469
NM_001267550.2(TTN):c.22634G>A (p.Arg7545Gln) rs72648969
NM_001267550.2(TTN):c.22692A>T (p.Thr7564=) rs187182557
NM_001267550.2(TTN):c.22786G>C (p.Asp7596His) rs72648970
NM_001267550.2(TTN):c.2280C>T (p.Val760=) rs727505021
NM_001267550.2(TTN):c.22966A>G (p.Asn7656Asp)
NM_001267550.2(TTN):c.22968C>T (p.Asn7656=) rs201904848
NM_001267550.2(TTN):c.23001G>A (p.Thr7667=) rs16866467
NM_001267550.2(TTN):c.23023G>T (p.Asp7675Tyr) rs552951988
NM_001267550.2(TTN):c.23029G>A (p.Gly7677Arg) rs367826445
NM_001267550.2(TTN):c.23099-3T>C rs2562830
NM_001267550.2(TTN):c.23121G>A (p.Lys7707=) rs72648971
NM_001267550.2(TTN):c.23177C>T (p.Ser7726Leu) rs17452588
NM_001267550.2(TTN):c.23223G>A (p.Gln7741=) rs2562831
NM_001267550.2(TTN):c.23232C>G (p.Asn7744Lys) rs72648972
NM_001267550.2(TTN):c.23301C>T (p.Ser7767=) rs73038337
NM_001267550.2(TTN):c.23302G>A (p.Asp7768Asn) rs72648973
NM_001267550.2(TTN):c.23378-10C>A rs72648975
NM_001267550.2(TTN):c.23392G>A (p.Val7798Met) rs144032104
NM_001267550.2(TTN):c.23455G>C (p.Glu7819Gln) rs201420077
NM_001267550.2(TTN):c.23538C>G (p.Phe7846Leu) rs149523263
NM_001267550.2(TTN):c.23538C>T (p.Phe7846=) rs149523263
NM_001267550.2(TTN):c.23578G>A (p.Ala7860Thr) rs138076523
NM_001267550.2(TTN):c.23853C>A (p.Ala7951=) rs201766927
NM_001267550.2(TTN):c.23925C>T (p.Ser7975=) rs374879942
NM_001267550.2(TTN):c.23965C>T (p.Arg7989Cys) rs201653851
NM_001267550.2(TTN):c.24039G>A (p.Pro8013=) rs768390615
NM_001267550.2(TTN):c.24075T>G (p.Ile8025Met) rs371496970
NM_001267550.2(TTN):c.24150C>T (p.Ser8050=) rs185062935
NM_001267550.2(TTN):c.24157G>A (p.Gly8053Ser) rs374167223
NM_001267550.2(TTN):c.24160A>T (p.Ile8054Leu) rs72648976
NM_001267550.2(TTN):c.24195C>T (p.Ser8065=) rs182425565
NM_001267550.2(TTN):c.24227-15C>T rs397517505
NM_001267550.2(TTN):c.24345C>T (p.Ser8115=) rs72648977
NM_001267550.2(TTN):c.24431A>C (p.Glu8144Ala) rs16866465
NM_001267550.2(TTN):c.24471C>T (p.Gly8157=) rs113391261
NM_001267550.2(TTN):c.24505+13C>T rs534803807
NM_001267550.2(TTN):c.24505+24A>G rs62178978
NM_001267550.2(TTN):c.24506-16T>C rs200319727
NM_001267550.2(TTN):c.24516C>T (p.Thr8172=) rs72648978
NM_001267550.2(TTN):c.24579A>G (p.Thr8193=) rs72648979
NM_001267550.2(TTN):c.24652A>G (p.Ser8218Gly) rs72648980
NM_001267550.2(TTN):c.24756T>G (p.Asp8252Glu) rs764248656
NM_001267550.2(TTN):c.24820G>A (p.Glu8274Lys) rs72648981
NM_001267550.2(TTN):c.24880A>G (p.Arg8294Gly) rs72648982
NM_001267550.2(TTN):c.24905C>A (p.Thr8302Lys) rs549604128
NM_001267550.2(TTN):c.24909G>A (p.Lys8303=) rs72648983
NM_001267550.2(TTN):c.24952G>A (p.Val8318Ile) rs200103997
NM_001267550.2(TTN):c.24964G>T (p.Val8322Leu) rs201571580
NM_001267550.2(TTN):c.24973A>G (p.Lys8325Glu) rs72648984
NM_001267550.2(TTN):c.25008C>T (p.Cys8336=) rs116378128
NM_001267550.2(TTN):c.25063+65T>C rs6750145
NM_001267550.2(TTN):c.25064C>A (p.Ala8355Glu) rs2627043
NM_001267550.2(TTN):c.25066C>T (p.Arg8356Cys) rs201810836
NM_001267550.2(TTN):c.25126C>T (p.Pro8376Ser) rs375209098
NM_001267550.2(TTN):c.25134A>G (p.Ala8378=) rs371819104
NM_001267550.2(TTN):c.25209T>C (p.Asp8403=) rs569860898
NM_001267550.2(TTN):c.25223C>T (p.Thr8408Ile) rs201432372
NM_001267550.2(TTN):c.25274G>A (p.Ser8425Asn) rs13390491
NM_001267550.2(TTN):c.25352-53G>A rs62178977
NM_001267550.2(TTN):c.25398T>A (p.Asp8466Glu) rs72648986
NM_001267550.2(TTN):c.25490G>A (p.Arg8497His) rs149855485
NM_001267550.2(TTN):c.25563C>T (p.Gly8521=) rs556205722
NM_001267550.2(TTN):c.25569C>T (p.Ala8523=) rs375022009
NM_001267550.2(TTN):c.25619C>T (p.Ser8540Phe) rs201523784
NM_001267550.2(TTN):c.25626G>A (p.Gln8542=) rs2562832
NM_001267550.2(TTN):c.25626G>T (p.Gln8542His) rs2562832
NM_001267550.2(TTN):c.25639+182A>T rs2562833
NM_001267550.2(TTN):c.25640-24G>A rs10183361
NM_001267550.2(TTN):c.25640-82A>G rs2562834
NM_001267550.2(TTN):c.25660A>G (p.Lys8554Glu) rs201945791
NM_001267550.2(TTN):c.25704G>A (p.Arg8568=) rs150544093
NM_001267550.2(TTN):c.25707T>C (p.Tyr8569=) rs2742329
NM_001267550.2(TTN):c.25758C>T (p.Asp8586=) rs372802604
NM_001267550.2(TTN):c.25809G>A (p.Ser8603=) rs369099681
NM_001267550.2(TTN):c.25877A>G (p.Asn8626Ser) rs200355367
NM_001267550.2(TTN):c.25921+10C>T rs10183237
NM_001267550.2(TTN):c.25921+20G>A rs148460010
NM_001267550.2(TTN):c.25922-102T>G rs12622914
NM_001267550.2(TTN):c.25922-77T>G rs2562835
NM_001267550.2(TTN):c.25936C>T (p.Arg8646Cys) rs72648987
NM_001267550.2(TTN):c.25942A>G (p.Lys8648Glu) rs188234466
NM_001267550.2(TTN):c.25978G>A (p.Val8660Ile) rs141856116
NM_001267550.2(TTN):c.26019C>T (p.His8673=) rs370266918
NM_001267550.2(TTN):c.26091A>T (p.Leu8697=) rs2562836
NM_001267550.2(TTN):c.26144G>A (p.Cys8715Tyr) rs183499397
NM_001267550.2(TTN):c.26200+19A>T rs2562837
NM_001267550.2(TTN):c.26201-11dup rs727503644
NM_001267550.2(TTN):c.26201-66C>T rs2627044
NM_001267550.2(TTN):c.26245G>A (p.Val8749Ile) rs16866457
NM_001267550.2(TTN):c.26289A>G (p.Glu8763=) rs2562838
NM_001267550.2(TTN):c.26408A>G (p.Asn8803Ser) rs12693164
NM_001267550.2(TTN):c.26439C>T (p.Asn8813=) rs200088963
NM_001267550.2(TTN):c.26466C>G (p.Ala8822=) rs140003804
NM_001267550.2(TTN):c.26483-35T>C rs2742330
NM_001267550.2(TTN):c.26494A>G (p.Ile8832Val) rs72648989
NM_001267550.2(TTN):c.26655C>T (p.Ser8885=) rs2562839
NM_001267550.2(TTN):c.26672A>G (p.Asn8891Ser) rs146057575
NM_001267550.2(TTN):c.26681C>T (p.Pro8894Leu) rs13398235
NM_001267550.2(TTN):c.26682G>A (p.Pro8894=) rs142812510
NM_001267550.2(TTN):c.26694G>T (p.Gly8898=) rs199525540
NM_001267550.2(TTN):c.26753A>G (p.Gln8918Arg)
NM_001267550.2(TTN):c.26761+146G>T rs10176708
NM_001267550.2(TTN):c.26762-39TTTGT[10] rs71393436
NM_001267550.2(TTN):c.26762-39TTTGT[11] rs71393436
NM_001267550.2(TTN):c.26762-39TTTGT[12] rs71393436
NM_001267550.2(TTN):c.26762-39TTTGT[4] rs71393436
NM_001267550.2(TTN):c.26762-39TTTGT[5] rs71393436
NM_001267550.2(TTN):c.26762-39TTTGT[7] rs71393436
NM_001267550.2(TTN):c.26762-39TTTGT[8] rs71393436
NM_001267550.2(TTN):c.26818G>A (p.Gly8940Ser) rs201005813
NM_001267550.2(TTN):c.26849A>G (p.Tyr8950Cys) rs199557654
NM_001267550.2(TTN):c.26863A>G (p.Ile8955Val) rs72648994
NM_001267550.2(TTN):c.26991A>C (p.Thr8997=) rs61232800
NM_001267550.2(TTN):c.26991A>G (p.Thr8997=) rs61232800
NM_001267550.2(TTN):c.27049+10C>A rs780979988
NM_001267550.2(TTN):c.27124G>A (p.Val9042Ile)
NM_001267550.2(TTN):c.27273C>T (p.Cys9091=) rs375546576
NM_001267550.2(TTN):c.2730C>T (p.Thr910=) rs375432172
NM_001267550.2(TTN):c.27328+5G>A rs397517521
NM_001267550.2(TTN):c.27498G>A (p.Ser9166=) rs372528823
NM_001267550.2(TTN):c.27652G>T (p.Val9218Phe) rs746558975
NM_001267550.2(TTN):c.27654T>G (p.Val9218=) rs780101457
NM_001267550.2(TTN):c.27702T>C (p.Ile9234=) rs143368674
NM_001267550.2(TTN):c.2775+18C>T rs372384261
NM_001267550.2(TTN):c.27793A>C (p.Asn9265His) rs397517524
NM_001267550.2(TTN):c.27846C>T (p.Ser9282=) rs182355009
NM_001267550.2(TTN):c.27856G>T (p.Val9286Phe) rs777547707
NM_001267550.2(TTN):c.27886+270G>A rs12997957
NM_001267550.2(TTN):c.27886+75T>A rs2742331
NM_001267550.2(TTN):c.28011C>T (p.Asp9337=) rs757848062
NM_001267550.2(TTN):c.28070C>T (p.Thr9357Ile) rs144930507
NM_001267550.2(TTN):c.28131C>T (p.Asn9377=) rs72648997
NM_001267550.2(TTN):c.28170C>T (p.Leu9390=) rs149910892
NM_001267550.2(TTN):c.28175-10C>T rs748478445
NM_001267550.2(TTN):c.28313G>A (p.Arg9438Gln) rs72648998
NM_001267550.2(TTN):c.2842-33C>T rs72647864
NM_001267550.2(TTN):c.28462+11T>C
NM_001267550.2(TTN):c.28463-132T>C rs2562841
NM_001267550.2(TTN):c.28463-14G>A rs200917885
NM_001267550.2(TTN):c.28463-24AT[2] rs769617035
NM_001267550.2(TTN):c.28465C>T (p.Arg9489Trp) rs200489972
NM_001267550.2(TTN):c.28507G>A (p.Val9503Ile) rs202160275
NM_001267550.2(TTN):c.28542G>A (p.Glu9514=) rs370604793
NM_001267550.2(TTN):c.28547G>A (p.Arg9516His) rs374156904
NM_001267550.2(TTN):c.28662G>A (p.Arg9554=) rs2742332
NM_001267550.2(TTN):c.28677C>T (p.Asn9559=) rs775065173
NM_001267550.2(TTN):c.28678G>A (p.Asp9560Asn) rs771843862
NM_001267550.2(TTN):c.28681G>A (p.Ala9561Thr) rs373380202
NM_001267550.2(TTN):c.28741A>G (p.Ile9581Val) rs371826762
NM_001267550.2(TTN):c.28754-11T>C rs146738622
NM_001267550.2(TTN):c.28970C>T (p.Ser9657Leu) rs200049911
NM_001267550.2(TTN):c.289G>A (p.Val97Met) rs185921345
NM_001267550.2(TTN):c.29041+145T>C rs10179811
NM_001267550.2(TTN):c.29041+281C>G rs2742339
NM_001267550.2(TTN):c.29042-16G>A rs10203085
NM_001267550.2(TTN):c.29042-261G>A rs2742340
NM_001267550.2(TTN):c.29079G>A (p.Ala9693=) rs372997298
NM_001267550.2(TTN):c.29128G>A (p.Val9710Ile) rs72649002
NM_001267550.2(TTN):c.29153T>C (p.Ile9718Thr) rs4893852
NM_001267550.2(TTN):c.29178C>A (p.Ile9726=) rs72650003
NM_001267550.2(TTN):c.29230C>T (p.Arg9744Cys) rs375266859
NM_001267550.2(TTN):c.29325C>T (p.Asn9775=) rs377442695
NM_001267550.2(TTN):c.29421-30T>A rs2742342
NM_001267550.2(TTN):c.29541C>T (p.Phe9847=) rs56812642
NM_001267550.2(TTN):c.29605-12T>C rs143352892
NM_001267550.2(TTN):c.29763T>C (p.Ile9921=) rs2742343
NM_001267550.2(TTN):c.29799G>A (p.Ser9933=) rs2742344
NM_001267550.2(TTN):c.29812A>T (p.Thr9938Ser) rs72650006
NM_001267550.2(TTN):c.29938G>A (p.Ala9980Thr) rs189286381
NM_001267550.2(TTN):c.29963-13A>G rs72650008
NM_001267550.2(TTN):c.30223+192G>A rs2742345
NM_001267550.2(TTN):c.30224-244A>G rs2366753
NM_001267550.2(TTN):c.30224-8T>G rs72650010
NM_001267550.2(TTN):c.30231A>G (p.Pro10077=) rs74324101
NM_001267550.2(TTN):c.30274C>T (p.His10092Tyr) rs72650011
NM_001267550.2(TTN):c.30309T>C (p.Phe10103=) rs762141482
NM_001267550.2(TTN):c.30384T>C (p.Asp10128=) rs188584219
NM_001267550.2(TTN):c.30389G>A (p.Arg10130His) rs373355159
NM_001267550.2(TTN):c.30426C>T (p.Asp10142=) rs147524531
NM_001267550.2(TTN):c.30433+11T>G rs199848546
NM_001267550.2(TTN):c.30433+15A>T rs371872220
NM_001267550.2(TTN):c.30444G>A (p.Ser10148=) rs367901929
NM_001267550.2(TTN):c.30485C>T (p.Thr10162Met) rs200593368
NM_001267550.2(TTN):c.30511+19A>G rs587780976
NM_001267550.2(TTN):c.30511+3G>A rs563582627
NM_001267550.2(TTN):c.30512-19_30512-18dup rs397517532
NM_001267550.2(TTN):c.30512-19dup rs397517532
NM_001267550.2(TTN):c.30598+15C>T rs79685525
NM_001267550.2(TTN):c.30682+288dup rs141526230
NM_001267550.2(TTN):c.30683-18C>T rs587780977
NM_001267550.2(TTN):c.30683-28_30683-14del
NM_001267550.2(TTN):c.30683-3del rs368277751
NM_001267550.2(TTN):c.30683-3dupT rs368277751
NM_001267550.2(TTN):c.30683-4_30683-3del rs368277751
NM_001267550.2(TTN):c.30718G>T (p.Val10240Phe) rs111671438
NM_001267550.2(TTN):c.30755-245A>G rs6755456
NM_001267550.2(TTN):c.30888A>G (p.Lys10296=) rs587780978
NM_001267550.2(TTN):c.30952G>A (p.Glu10318Lys) rs73038324
NM_001267550.2(TTN):c.30966C>T (p.Asp10322=) rs587780979
NM_001267550.2(TTN):c.31114G>C (p.Glu10372Gln) rs200831060
NM_001267550.2(TTN):c.31390C>T (p.Arg10464Trp) rs374555701
NM_001267550.2(TTN):c.31399G>A (p.Val10467Ile) rs72650019
NM_001267550.2(TTN):c.31422G>A (p.Val10474=) rs72650020
NM_001267550.2(TTN):c.31441A>G (p.Thr10481Ala) rs370208651
NM_001267550.2(TTN):c.31456A>T (p.Ile10486Phe) rs772882862
NM_001267550.2(TTN):c.31518C>T (p.Pro10506=) rs746912694
NM_001267550.2(TTN):c.31564A>G (p.Ile10522Val) rs2042995
NM_001267550.2(TTN):c.31594+54A>T rs2255167
NM_001267550.2(TTN):c.31645A>G (p.Ile10549Val) rs376613199
NM_001267550.2(TTN):c.31678+40A>G rs72650022
NM_001267550.2(TTN):c.31735A>C (p.Lys10579Gln) rs376287951
NM_001267550.2(TTN):c.31757C>A (p.Pro10586Gln) rs200459347
NM_001267550.2(TTN):c.31762+5_31762+7del rs397517538
NM_001267550.2(TTN):c.31806C>T (p.Pro10602=) rs370080995
NM_001267550.2(TTN):c.31837C>G (p.Pro10613Ala) rs200213832
NM_001267550.2(TTN):c.31847-17A>G rs72650025
NM_001267550.2(TTN):c.31864G>A (p.Gly10622Arg) rs2244492
NM_001267550.2(TTN):c.32011+10C>G rs192002980
NM_001267550.2(TTN):c.32012-54C>T rs2627038
NM_001267550.2(TTN):c.32026A>G (p.Lys10676Glu) rs200952728
NM_001267550.2(TTN):c.32049A>G (p.Lys10683=) rs375408527
NM_001267550.2(TTN):c.32197+11G>A rs369265969
NM_001267550.2(TTN):c.32211G>A (p.Glu10737=)
NM_001267550.2(TTN):c.32254G>A (p.Val10752Ile) rs72650028
NM_001267550.2(TTN):c.32350C>G (p.Leu10784Val) rs72650029
NM_001267550.2(TTN):c.32367G>A (p.Lys10789=) rs79232842
NM_001267550.2(TTN):c.32393-12A>G rs16866434
NM_001267550.2(TTN):c.3243G>A (p.Ala1081=) rs559501661
NM_001267550.2(TTN):c.32462C>T (p.Pro10821Leu) rs146400809
NM_001267550.2(TTN):c.32480C>T (p.Ala10827Val) rs72650030
NM_001267550.2(TTN):c.32555-6T>C rs375742678
NM_001267550.2(TTN):c.32557C>T (p.Pro10853Ser) rs201738153
NM_001267550.2(TTN):c.32593G>C (p.Val10865Leu) rs150733188
NM_001267550.2(TTN):c.32624C>T (p.Pro10875Leu) rs72650031
NM_001267550.2(TTN):c.32648G>A (p.Arg10883Lys) rs116676813
NM_001267550.2(TTN):c.32703G>A (p.Glu10901=) rs397517542
NM_001267550.2(TTN):c.32722+9G>A rs148231130
NM_001267550.2(TTN):c.32743G>C (p.Ala10915Pro) rs72650032
NM_001267550.2(TTN):c.32750C>T (p.Pro10917Leu) rs73973137
NM_001267550.2(TTN):c.32807-10T>A rs138192315
NM_001267550.2(TTN):c.32837A>T (p.Glu10946Val) rs763205133
NM_001267550.2(TTN):c.32887+78T>C rs2303828
NM_001267550.2(TTN):c.32953C>T (p.Arg10985Trp) rs201991864
NM_001267550.2(TTN):c.32954G>C (p.Arg10985Pro) rs181395238
NM_001267550.2(TTN):c.33018A>G (p.Thr11006=) rs765492188
NM_001267550.2(TTN):c.33053G>A (p.Arg11018Gln) rs72650034
NM_001267550.2(TTN):c.33063A>G (p.Glu11021=) rs115744476
NM_001267550.2(TTN):c.33094+131C>T rs4894034
NM_001267550.2(TTN):c.33126C>T (p.Val11042=) rs72650036
NM_001267550.2(TTN):c.33173-4G>A rs727504440
NM_001267550.2(TTN):c.33287G>A (p.Arg11096His) rs36051007
NM_001267550.2(TTN):c.33305G>A (p.Arg11102His) rs368777046
NM_001267550.2(TTN):c.33331G>A (p.Ala11111Thr) rs545067681
NM_001267550.2(TTN):c.33340+10T>C rs72650039
NM_001267550.2(TTN):c.33416G>C (p.Arg11139Thr) rs72650040
NM_001267550.2(TTN):c.33418+12C>A rs199772748
NM_001267550.2(TTN):c.33501_33503AGA[6] (p.Glu11172dup) rs368327166
NM_001267550.2(TTN):c.33516_33517insAAG (p.Tyr11173_Ile11174insLys) rs1577324587
NM_001267550.2(TTN):c.33580+52G>T rs72650041
NM_001267550.2(TTN):c.33581-18T>C rs148392677
NM_001267550.2(TTN):c.33664+20C>T rs762601689
NM_001267550.2(TTN):c.33732G>A (p.Pro11244=) rs190604150
NM_001267550.2(TTN):c.33742+11A>G rs72650042
NM_001267550.2(TTN):c.33742+8C>T rs375939001
NM_001267550.2(TTN):c.33743-148C>T rs73973135
NM_001267550.2(TTN):c.33796C>T (p.Pro11266Ser) rs201120871
NM_001267550.2(TTN):c.33826+17T>A rs199586235
NM_001267550.2(TTN):c.33827-8C>T rs371318311
NM_001267550.2(TTN):c.33834G>A (p.Glu11278=) rs35112591
NM_001267550.2(TTN):c.33856G>A (p.Glu11286Lys) rs376874956
NM_001267550.2(TTN):c.33881C>G (p.Pro11294Arg)
NM_001267550.2(TTN):c.33910+82T>C rs72650047
NM_001267550.2(TTN):c.34119G>A (p.Glu11373=) rs548399416
NM_001267550.2(TTN):c.34129_34149GTTCTACCTGAAGAAGAGGAA[1] (p.11363_11369VLPEEEE[3]) rs587780487
NM_001267550.2(TTN):c.34140A>G (p.Glu11380=) rs147418835
NM_001267550.2(TTN):c.34201G>A (p.Glu11401Lys) rs765827814
NM_001267550.2(TTN):c.34216C>A (p.Pro11406Thr) rs532102837
NM_001267550.2(TTN):c.34241_34243AAG[2] (p.Glu11416del) rs397517549
NM_001267550.2(TTN):c.34291+115C>T rs2742349
NM_001267550.2(TTN):c.34453+12C>A rs74930148
NM_001267550.2(TTN):c.34453+14G>A rs397517550
NM_001267550.2(TTN):c.34474C>A (p.Pro11492Thr) rs182428755
NM_001267550.2(TTN):c.34505G>T (p.Gly11502Val) rs190209925
NM_001267550.2(TTN):c.34538-123A>G rs13398590
NM_001267550.2(TTN):c.34538-63G>T rs2472751
NM_001267550.2(TTN):c.34566A>C (p.Glu11522Asp) rs140640738
NM_001267550.2(TTN):c.34768G>C (p.Glu11590Gln)
NM_001267550.2(TTN):c.34769A>G (p.Glu11590Gly) rs201167067
NM_001267550.2(TTN):c.34845C>T (p.Pro11615=) rs368781863
NM_001267550.2(TTN):c.34856-17A>G rs188686309
NM_001267550.2(TTN):c.34864G>A (p.Val11622Ile) rs202014478
NM_001267550.2(TTN):c.34970G>A (p.Arg11657His) rs59887778
NM_001267550.2(TTN):c.35228-12A>G rs377168857
NM_001267550.2(TTN):c.3523+117G>T rs12464703
NM_001267550.2(TTN):c.35264A>C (p.Lys11755Thr) rs189966800
NM_001267550.2(TTN):c.35471-10A>G rs780849590
NM_001267550.2(TTN):c.35797+107C>T rs10221760
NM_001267550.2(TTN):c.35875+8T>G rs192408585
NM_001267550.2(TTN):c.36126A>C (p.Glu12042Asp) rs113231696
NM_001267550.2(TTN):c.36203-9T>C rs2562849
NM_001267550.2(TTN):c.36281-164G>A rs2562848
NM_001267550.2(TTN):c.36285C>T (p.His12095=) rs201184203
NM_001267550.2(TTN):c.36299A>T (p.Glu12100Val) rs73973133
NM_001267550.2(TTN):c.36318A>G (p.Lys12106=) rs2115557
NM_001267550.2(TTN):c.36347A>G (p.Glu12116Gly) rs200513156
NM_001267550.2(TTN):c.36489G>A (p.Ala12163=) rs115493456
NM_001267550.2(TTN):c.36508G>A (p.Glu12170Lys) rs2163008
NM_001267550.2(TTN):c.36509A>T (p.Glu12170Val) rs200840285
NM_001267550.2(TTN):c.36532+19A>G rs10204913
NM_001267550.2(TTN):c.36625G>T (p.Val12209Leu) rs72650053
NM_001267550.2(TTN):c.36655T>G (p.Leu12219Val) rs12994774
NM_001267550.2(TTN):c.36676A>G (p.Lys12226Glu) rs200815663
NM_001267550.2(TTN):c.36855G>A (p.Pro12285=) rs535294541
NM_001267550.2(TTN):c.37009C>T (p.Pro12337Ser) rs201474544
NM_001267550.2(TTN):c.37202-4T>C rs202032281
NM_001267550.2(TTN):c.37247C>T (p.Ser12416Leu) rs370765948
NM_001267550.2(TTN):c.37432C>T (p.Pro12478Ser) rs200992277
NM_001267550.2(TTN):c.37461A>T (p.Glu12487Asp) rs200021871
NM_001267550.2(TTN):c.37525G>A (p.Glu12509Lys) rs201797790
NM_001267550.2(TTN):c.37543+64C>T rs62178968
NM_001267550.2(TTN):c.37705G>A (p.Val12569Ile) rs568086259
NM_001267550.2(TTN):c.37722T>C (p.Val12574=) rs377422414
NM_001267550.2(TTN):c.37955-29C>T rs79253568
NM_001267550.2(TTN):c.37956G>T (p.Val12652=) rs541757326
NM_001267550.2(TTN):c.38256G>A (p.Pro12752=) rs794728014
NM_001267550.2(TTN):c.38311A>G (p.Lys12771Glu) rs551811137
NM_001267550.2(TTN):c.38323C>T (p.Leu12775Phe) rs186232617
NM_001267550.2(TTN):c.38336T>C (p.Val12779Ala) rs2099130
NM_001267550.2(TTN):c.38378A>G (p.Lys12793Arg) rs189389531
NM_001267550.2(TTN):c.38708-29T>C rs13420457
NM_001267550.2(TTN):c.38708-4T>C rs200819643
NM_001267550.2(TTN):c.38753T>C (p.Leu12918Ser) rs2562847
NM_001267550.2(TTN):c.38880A>G (p.Pro12960=) rs2742354
NM_001267550.2(TTN):c.38929C>T (p.Pro12977Ser) rs150223722
NM_001267550.2(TTN):c.38955T>G (p.Val12985=) rs375699886
NM_001267550.2(TTN):c.39006G>T (p.Ser13002=) rs548745743
NM_001267550.2(TTN):c.39044-15C>T rs749495580
NM_001267550.2(TTN):c.39044-9T>A rs184888200
NM_001267550.2(TTN):c.39045G>C (p.Val13015=) rs192464868
NM_001267550.2(TTN):c.39050A>G (p.Glu13017Gly) rs368056479
NM_001267550.2(TTN):c.39057G>A (p.Pro13019=) rs371945519
NM_001267550.2(TTN):c.39082G>A (p.Val13028Met) rs73038314
NM_001267550.2(TTN):c.39085C>A (p.Pro13029Thr) rs397517553
NM_001267550.2(TTN):c.39090G>A (p.Ala13030=) rs375519815
NM_001267550.2(TTN):c.39127+10A>C rs397517554
NM_001267550.2(TTN):c.39128-14T>C rs200916144
NM_001267550.2(TTN):c.39183T>A (p.Pro13061=) rs12474306
NM_001267550.2(TTN):c.39211+6C>T rs187365142
NM_001267550.2(TTN):c.39296-13C>T rs372380420
NM_001267550.2(TTN):c.39385G>A (p.Val13129Ile) rs774557269
NM_001267550.2(TTN):c.39389C>T (p.Pro13130Leu) rs370520319
NM_001267550.2(TTN):c.39466C>A (p.Pro13156Thr) rs72650064
NM_001267550.2(TTN):c.39616C>T (p.Pro13206Ser) rs186404793
NM_001267550.2(TTN):c.39625+196T>C rs1429094
NM_001267550.2(TTN):c.39689C>T (p.Ala13230Val) rs148140756
NM_001267550.2(TTN):c.39690G>A (p.Ala13230=) rs528832388
NM_001267550.2(TTN):c.39704C>G (p.Pro13235Arg) rs72650066
NM_001267550.2(TTN):c.39709+6C>T rs72650067
NM_001267550.2(TTN):c.39731_39748TTGCTCCTGAAGAGGAAA[1] (p.13244_13249IAPEEE[1]) rs139512154
NM_001267550.2(TTN):c.39813A>G (p.Pro13271=) rs373429851
NM_001267550.2(TTN):c.39896-75A>G rs2562845
NM_001267550.2(TTN):c.39973+73C>T rs116254094
NM_001267550.2(TTN):c.40057+52T>A rs7606485
NM_001267550.2(TTN):c.40141+7G>A rs77960621
NM_001267550.2(TTN):c.40222+2TA[10] rs10580462
NM_001267550.2(TTN):c.40222+2TA[12] rs10580462
NM_001267550.2(TTN):c.40250C>T (p.Pro13417Leu) rs537578226
NM_001267550.2(TTN):c.40408+7_40408+10dup rs397517560
NM_001267550.2(TTN):c.40408+8del rs727504922
NM_001267550.2(TTN):c.40409-157C>T rs34659500
NM_001267550.2(TTN):c.40478-297T>C rs2742358
NM_001267550.2(TTN):c.40498G>T (p.Val13500Phe) rs201944202
NM_001267550.2(TTN):c.40515G>A (p.Pro13505=) rs367958537
NM_001267550.2(TTN):c.40519C>T (p.Arg13507Cys)
NM_001267550.2(TTN):c.40558+1G>A rs368219776
NM_001267550.2(TTN):c.40576_40578GAA[3] (p.Glu13529del) rs727504199
NM_001267550.2(TTN):c.40587A>G (p.Glu13529=) rs370597107
NM_001267550.2(TTN):c.40786+15C>A rs187582271
NM_001267550.2(TTN):c.40786+3G>A rs551963261
NM_001267550.2(TTN):c.40877-243T>C rs2562843
NM_001267550.2(TTN):c.40927+16C>T rs369965589
NM_001267550.2(TTN):c.40973A>G (p.Lys13658Arg) rs184713215
NM_001267550.2(TTN):c.41010T>C (p.Asp13670=) rs193191368
NM_001267550.2(TTN):c.41103C>T (p.Gly13701=) rs72650077
NM_001267550.2(TTN):c.41166C>T (p.Asp13722=) rs143049740
NM_001267550.2(TTN):c.41330-7T>A rs373636988
NM_001267550.2(TTN):c.41428G>A (p.Val13810Met) rs763668057
NM_001267550.2(TTN):c.41508T>C (p.Ala13836=) rs55847232
NM_001267550.2(TTN):c.41521G>A (p.Asp13841Asn) rs201257644
NM_001267550.2(TTN):c.41569G>A (p.Ala13857Thr)
NM_001267550.2(TTN):c.41703T>C (p.Thr13901=) rs756282138
NM_001267550.2(TTN):c.41810C>T (p.Ala13937Val) rs545806408
NM_001267550.2(TTN):c.41885-16T>C rs368838630
NM_001267550.2(TTN):c.41931T>C (p.Tyr13977=) rs369128249
NM_001267550.2(TTN):c.41958A>G (p.Ala13986=) rs186699871
NM_001267550.2(TTN):c.42024+6T>C rs140002940
NM_001267550.2(TTN):c.42046G>C (p.Gly14016Arg)
NM_001267550.2(TTN):c.42071A>G (p.His14024Arg) rs2288563
NM_001267550.2(TTN):c.42156C>T (p.Ile14052=) rs76815324
NM_001267550.2(TTN):c.42219C>T (p.Phe14073=) rs150612172
NM_001267550.2(TTN):c.42329T>C (p.Val14110Ala) rs34706299
NM_001267550.2(TTN):c.42415+55T>C rs7590037
NM_001267550.2(TTN):c.42687C>T (p.Ala14229=) rs775889693
NM_001267550.2(TTN):c.42783A>G (p.Lys14261=) rs16866425
NM_001267550.2(TTN):c.42891C>T (p.Gly14297=) rs550471556
NM_001267550.2(TTN):c.42933T>C (p.Asn14311=) rs148528251
NM_001267550.2(TTN):c.42950G>C (p.Arg14317Pro) rs727505144
NM_001267550.2(TTN):c.42958A>G (p.Lys14320Glu) rs6723526
NM_001267550.2(TTN):c.42978C>T (p.Tyr14326=) rs369959066
NM_001267550.2(TTN):c.43120A>G (p.Ile14374Val) rs754227553
NM_001267550.2(TTN):c.43138T>C (p.Cys14380Arg) rs557125278
NM_001267550.2(TTN):c.43161G>A (p.Glu14387=) rs765214404
NM_001267550.2(TTN):c.43260C>T (p.Phe14420=) rs372382546
NM_001267550.2(TTN):c.43417G>C (p.Asp14473His) rs397517573
NM_001267550.2(TTN):c.43481-16dup rs730880350
NM_001267550.2(TTN):c.43488G>A (p.Arg14496=) rs56034831
NM_001267550.2(TTN):c.43577G>A (p.Arg14526Gln) rs373491468
NM_001267550.2(TTN):c.43596T>C (p.Asn14532=) rs16866423
NM_001267550.2(TTN):c.43603C>T (p.Arg14535Cys) rs12471771
NM_001267550.2(TTN):c.43690T>A (p.Ser14564Thr) rs181189778
NM_001267550.2(TTN):c.43691C>G (p.Ser14564Cys) rs377015571
NM_001267550.2(TTN):c.43704A>G (p.Val14568=) rs368783829
NM_001267550.2(TTN):c.44014+19G>C rs139264089
NM_001267550.2(TTN):c.44154+6G>T rs794729234
NM_001267550.2(TTN):c.44210G>T (p.Arg14737Leu) rs373298007
NM_001267550.2(TTN):c.44229G>A (p.Gly14743=) rs376445406
NM_001267550.2(TTN):c.44281C>T (p.Pro14761Ser) rs192766485
NM_001267550.2(TTN):c.44529C>T (p.His14843=) rs55973744
NM_001267550.2(TTN):c.44548+9A>G rs372725070
NM_001267550.2(TTN):c.44549-268T>C rs12614435
NM_001267550.2(TTN):c.44589G>A (p.Thr14863=) rs369800903
NM_001267550.2(TTN):c.44593G>A (p.Glu14865Lys) rs543102139
NM_001267550.2(TTN):c.44599G>A (p.Gly14867Arg) rs144848584
NM_001267550.2(TTN):c.44691G>A (p.Lys14897=) rs755769210
NM_001267550.2(TTN):c.44784T>C (p.Asp14928=) rs186105748
NM_001267550.2(TTN):c.44816-189A>C rs2366752
NM_001267550.2(TTN):c.44913+259T>A rs72677219
NM_001267550.2(TTN):c.45053C>T (p.Ala15018Val) rs72677221
NM_001267550.2(TTN):c.45083-10A>G rs72677222
NM_001267550.2(TTN):c.45120T>G (p.Ile15040Met) rs74580375
NM_001267550.2(TTN):c.45174C>T (p.Gly15058=) rs372609980
NM_001267550.2(TTN):c.45175G>A (p.Ala15059Thr) rs144668626
NM_001267550.2(TTN):c.45206A>T (p.Glu15069Val) rs114331773
NM_001267550.2(TTN):c.45212T>C (p.Ile15071Thr) rs184078045
NM_001267550.2(TTN):c.45273C>T (p.Asn15091=) rs72677223
NM_001267550.2(TTN):c.45328G>A (p.Asp15110Asn) rs17354992
NM_001267550.2(TTN):c.45349+23T>A rs760207565
NM_001267550.2(TTN):c.45349+26_45349+35del rs762765150
NM_001267550.2(TTN):c.45350-13T>C rs113084617
NM_001267550.2(TTN):c.45408G>T (p.Lys15136Asn) rs72677225
NM_001267550.2(TTN):c.45526C>T (p.Leu15176=) rs61004744
NM_001267550.2(TTN):c.45738T>C (p.Ala15246=) rs2303829
NM_001267550.2(TTN):c.45786C>T (p.Tyr15262=)
NM_001267550.2(TTN):c.45979C>T (p.Arg15327Cys) rs367774903
NM_001267550.2(TTN):c.46065G>C (p.Lys15355Asn) rs397517583
NM_001267550.2(TTN):c.46363G>A (p.Asp15455Asn) rs370813526
NM_001267550.2(TTN):c.46386C>T (p.Cys15462=) rs147703145
NM_001267550.2(TTN):c.46483G>A (p.Ala15495Thr) rs537428006
NM_001267550.2(TTN):c.46580T>A (p.Met15527Lys) rs77496539
NM_001267550.2(TTN):c.46693G>T (p.Ala15565Ser) rs145520397
NM_001267550.2(TTN):c.46696+294G>A rs1864243
NM_001267550.2(TTN):c.46697-12C>T rs727504699
NM_001267550.2(TTN):c.46800A>G (p.Glu15600=) rs190058852
NM_001267550.2(TTN):c.46847C>T (p.Thr15616Met) rs368057764
NM_001267550.2(TTN):c.46880C>T (p.Ala15627Val) rs115813214
NM_001267550.2(TTN):c.46967-19C>G rs755875136
NM_001267550.2(TTN):c.47077G>A (p.Val15693Ile) rs201717871
NM_001267550.2(TTN):c.47191C>T (p.Arg15731Cys) rs72677231
NM_001267550.2(TTN):c.47248G>A (p.Val15750Ile) rs72677232
NM_001267550.2(TTN):c.47271T>C (p.Asp15757=) rs76081119
NM_001267550.2(TTN):c.47315G>A (p.Arg15772Gln) rs72677233
NM_001267550.2(TTN):c.47379C>T (p.Tyr15793=) rs374281025
NM_001267550.2(TTN):c.47400G>A (p.Lys15800=) rs114145817
NM_001267550.2(TTN):c.47545C>A (p.Pro15849Thr) rs146181477
NM_001267550.2(TTN):c.47684T>C (p.Ile15895Thr) rs768530598
NM_001267550.2(TTN):c.47723G>A (p.Arg15908His) rs72677237
NM_001267550.2(TTN):c.47737C>T (p.Leu15913Phe) rs138576504
NM_001267550.2(TTN):c.47740G>C (p.Val15914Leu) rs764059405
NM_001267550.2(TTN):c.47875+12T>G
NM_001267550.2(TTN):c.47876-18A>C rs776809349
NM_001267550.2(TTN):c.47938A>G (p.Ile15980Val) rs780634456
NM_001267550.2(TTN):c.47955A>G (p.Pro15985=) rs192953152
NM_001267550.2(TTN):c.47978C>A (p.Thr15993Asn) rs727503622
NM_001267550.2(TTN):c.47998G>C (p.Asp16000His) rs201388509
NM_001267550.2(TTN):c.48055G>A (p.Glu16019Lys) rs758399903
NM_001267550.2(TTN):c.48353A>G (p.Asp16118Gly) rs376273101
NM_001267550.2(TTN):c.48394C>T (p.Arg16132Cys) rs2303830
NM_001267550.2(TTN):c.48460+8C>T rs2288565
NM_001267550.2(TTN):c.48461C>T (p.Thr16154Met) rs771120250
NM_001267550.2(TTN):c.48462G>A (p.Thr16154=) rs202141158
NM_001267550.2(TTN):c.48624T>C (p.Pro16208=) rs72677240
NM_001267550.2(TTN):c.48639-46C>T rs16866416
NM_001267550.2(TTN):c.48727C>T (p.Pro16243Ser) rs72677242
NM_001267550.2(TTN):c.48850G>A (p.Gly16284Arg) rs368527534
NM_001267550.2(TTN):c.48953T>C (p.Ile16318Thr) rs72677243
NM_001267550.2(TTN):c.48996G>A (p.Glu16332=) rs72677244
NM_001267550.2(TTN):c.49032G>A (p.Val16344=) rs587780980
NM_001267550.2(TTN):c.49126C>T (p.Arg16376Cys) rs772152172
NM_001267550.2(TTN):c.49172G>A (p.Arg16391Gln) rs200944827
NM_001267550.2(TTN):c.49263C>T (p.Tyr16421=) rs376188859
NM_001267550.2(TTN):c.49278T>C (p.Ala16426=) rs372633280
NM_001267550.2(TTN):c.49310T>A (p.Val16437Asp) rs767768313
NM_001267550.2(TTN):c.49367G>A (p.Arg16456His) rs768914789
NM_001267550.2(TTN):c.49371A>T (p.Leu16457=) rs146163169
NM_001267550.2(TTN):c.49413G>T (p.Trp16471Cys) rs202094100
NM_001267550.2(TTN):c.49443A>C (p.Pro16481=) rs74321406
NM_001267550.2(TTN):c.49648+13T>A rs368996176
NM_001267550.2(TTN):c.49648+16T>C rs57677875
NM_001267550.2(TTN):c.49731T>C (p.His16577=) rs2115558
NM_001267550.2(TTN):c.49758T>C (p.Tyr16586=) rs72677247
NM_001267550.2(TTN):c.49919G>C (p.Ser16640Thr) rs55663050
NM_001267550.2(TTN):c.49944G>A (p.Lys16648=) rs190021597
NM_001267550.2(TTN):c.49985A>C (p.Asn16662Thr) rs36043230
NM_001267550.2(TTN):c.49988T>C (p.Ile16663Thr) rs774556838
NM_001267550.2(TTN):c.4998A>T (p.Thr1666=) rs139054950
NM_001267550.2(TTN):c.49998T>C (p.Asn16666=) rs376917681
NM_001267550.2(TTN):c.50363T>C (p.Ile16788Thr) rs397517599
NM_001267550.2(TTN):c.50385T>C (p.Gly16795=) rs374672630
NM_001267550.2(TTN):c.50452G>A (p.Glu16818Lys) rs397517600
NM_001267550.2(TTN):c.50480G>A (p.Arg16827Gln) rs138896856
NM_001267550.2(TTN):c.50551+20C>T rs67636125
NM_001267550.2(TTN):c.50597G>A (p.Arg16866Lys) rs774137928
NM_001267550.2(TTN):c.50669A>C (p.Glu16890Ala) rs752204728
NM_001267550.2(TTN):c.50714G>A (p.Arg16905His) rs191539637
NM_001267550.2(TTN):c.50719A>G (p.Ile16907Val) rs750610895
NM_001267550.2(TTN):c.50994T>C (p.Ser16998=) rs752023426
NM_001267550.2(TTN):c.51273G>A (p.Arg17091=) rs532589236
NM_001267550.2(TTN):c.51482C>T (p.Ala17161Val) rs16866412
NM_001267550.2(TTN):c.51527G>C (p.Gly17176Ala) rs768961892
NM_001267550.2(TTN):c.51678C>T (p.Asn17226=) rs372635204
NM_001267550.2(TTN):c.51683C>T (p.Ala17228Val) rs370644359
NM_001267550.2(TTN):c.51684G>A (p.Ala17228=) rs2288566
NM_001267550.2(TTN):c.51739+14C>A rs727505018
NM_001267550.2(TTN):c.51782G>A (p.Arg17261Gln) rs201825412
NM_001267550.2(TTN):c.51809G>T (p.Ser17270Ile) rs200650668
NM_001267550.2(TTN):c.51991G>C (p.Glu17331Gln) rs547986881
NM_001267550.2(TTN):c.52008C>G (p.Val17336=) rs144507270
NM_001267550.2(TTN):c.52110G>A (p.Pro17370=) rs139789997
NM_001267550.2(TTN):c.52406-12dup rs1553688916
NM_001267550.2(TTN):c.52406-16G>A rs372221219
NM_001267550.2(TTN):c.52409C>A (p.Pro17470Gln) rs372618781
NM_001267550.2(TTN):c.52434T>G (p.Ile17478Met) rs554368924
NM_001267550.2(TTN):c.52536C>G (p.Asn17512Lys) rs199615557
NM_001267550.2(TTN):c.52702A>G (p.Ile17568Val) rs377571654
NM_001267550.2(TTN):c.52706-17A>G rs72646807
NM_001267550.2(TTN):c.52821T>C (p.Asp17607=) rs2303831
NM_001267550.2(TTN):c.52852C>T (p.Arg17618Cys) rs201213901
NM_001267550.2(TTN):c.52853G>A (p.Arg17618His) rs371538664
NM_001267550.2(TTN):c.52890C>T (p.Thr17630=) rs374228930
NM_001267550.2(TTN):c.52908G>C (p.Glu17636Asp) rs748175453
NM_001267550.2(TTN):c.52917T>C (p.Asp17639=) rs73036398
NM_001267550.2(TTN):c.52948G>A (p.Ala17650Thr) rs535008556
NM_001267550.2(TTN):c.52962G>A (p.Pro17654=) rs773148195
NM_001267550.2(TTN):c.53002+10G>A rs370352450
NM_001267550.2(TTN):c.53055G>A (p.Met17685Ile) rs200387466
NM_001267550.2(TTN):c.53095C>T (p.Arg17699Cys)
NM_001267550.2(TTN):c.53096G>A (p.Arg17699His) rs72646808
NM_001267550.2(TTN):c.53100T>G (p.Pro17700=) rs373140387
NM_001267550.2(TTN):c.53123A>T (p.Lys17708Ile) rs2303832
NM_001267550.2(TTN):c.53159T>C (p.Ile17720Thr) rs201358641
NM_001267550.2(TTN):c.53166C>T (p.Asn17722=) rs371730757
NM_001267550.2(TTN):c.53192T>C (p.Ile17731Thr) rs72646809
NM_001267550.2(TTN):c.53226T>C (p.Tyr17742=) rs202200861
NM_001267550.2(TTN):c.53260T>C (p.Phe17754Leu) rs397517612
NM_001267550.2(TTN):c.53287+6G>A rs149890360
NM_001267550.2(TTN):c.53288-18G>T rs72646810
NM_001267550.2(TTN):c.53507G>A (p.Arg17836His) rs373526624
NM_001267550.2(TTN):c.53882-25G>T rs2303833
NM_001267550.2(TTN):c.5388T>C (p.Asp1796=) rs72647878
NM_001267550.2(TTN):c.53943A>T (p.Gly17981=) rs367580862
NM_001267550.2(TTN):c.54037G>T (p.Ala18013Ser) rs531242797
NM_001267550.2(TTN):c.54105G>A (p.Ala18035=) rs371155050
NM_001267550.2(TTN):c.54148C>T (p.Arg18050Cys) rs55734111
NM_001267550.2(TTN):c.54160G>C (p.Val18054Leu) rs200968679
NM_001267550.2(TTN):c.54178G>A (p.Val18060Ile) rs190574498
NM_001267550.2(TTN):c.54189T>C (p.Tyr18063=) rs2303834
NM_001267550.2(TTN):c.54194G>A (p.Arg18065His) rs375895183
NM_001267550.2(TTN):c.54207A>G (p.Pro18069=) rs372686070
NM_001267550.2(TTN):c.54208A>C (p.Arg18070=) rs138240658
NM_001267550.2(TTN):c.54321A>G (p.Ala18107=) rs368021072
NM_001267550.2(TTN):c.54381+49T>C rs10497518
NM_001267550.2(TTN):c.54381+6C>G rs368265962
NM_001267550.2(TTN):c.54685G>A (p.Val18229Met) rs116142642
NM_001267550.2(TTN):c.54710T>C (p.Leu18237Pro) rs201412693
NM_001267550.2(TTN):c.54796G>T (p.Ala18266Ser) rs199837769
NM_001267550.2(TTN):c.54811+15G>A rs201450276
NM_001267550.2(TTN):c.54811+8T>C rs747409403
NM_001267550.2(TTN):c.54812-5A>G rs375343798
NM_001267550.2(TTN):c.54818C>T (p.Pro18273Leu) rs201035511
NM_001267550.2(TTN):c.54855G>A (p.Thr18285=) rs200410212
NM_001267550.2(TTN):c.54903C>G (p.Gly18301=) rs190830121
NM_001267550.2(TTN):c.54947C>G (p.Thr18316Ser) rs758527900
NM_001267550.2(TTN):c.55029G>A (p.Arg18343=) rs62178963
NM_001267550.2(TTN):c.55432+10A>G
NM_001267550.2(TTN):c.55449C>T (p.Pro18483=) rs187366691
NM_001267550.2(TTN):c.55512C>T (p.Asp18504=) rs377164046
NM_001267550.2(TTN):c.55547T>C (p.Ile18516Thr) rs146608896
NM_001267550.2(TTN):c.55553A>G (p.Lys18518Arg) rs72646823
NM_001267550.2(TTN):c.55659G>A (p.Val18553=) rs368450420
NM_001267550.2(TTN):c.55738C>T (p.Pro18580Ser) rs528329600
NM_001267550.2(TTN):c.55809G>A (p.Pro18603=) rs750472100
NM_001267550.2(TTN):c.55925T>A (p.Leu18642Gln) rs140714512
NM_001267550.2(TTN):c.55929A>G (p.Gln18643=) rs151335428
NM_001267550.2(TTN):c.55932T>C (p.Phe18644=) rs755839294
NM_001267550.2(TTN):c.56051-12T>A rs147192175
NM_001267550.2(TTN):c.56101A>G (p.Asn18701Asp) rs1001238
NM_001267550.2(TTN):c.561G>A (p.Ser187=) rs141444282
NM_001267550.2(TTN):c.56264G>A (p.Arg18755His) rs772767570
NM_001267550.2(TTN):c.56529G>A (p.Thr18843=) rs72646827
NM_001267550.2(TTN):c.56850G>A (p.Val18950=) rs368068200
NM_001267550.2(TTN):c.56910C>T (p.Gly18970=) rs148299739
NM_001267550.2(TTN):c.56942C>T (p.Ala18981Val) rs397517627
NM_001267550.2(TTN):c.56943G>A (p.Ala18981=) rs370998052
NM_001267550.2(TTN):c.56970T>C (p.Pro18990=) rs372019333
NM_001267550.2(TTN):c.57112-4C>T rs117072049
NM_001267550.2(TTN):c.57273C>T (p.Asp19091=) rs587780489
NM_001267550.2(TTN):c.57315T>C (p.His19105=) rs35833641
NM_001267550.2(TTN):c.57442A>G (p.Met19148Val) rs188185141
NM_001267550.2(TTN):c.57462G>A (p.Gln19154=) rs72646832
NM_001267550.2(TTN):c.57464G>A (p.Arg19155Lys) rs72646833
NM_001267550.2(TTN):c.57477C>T (p.Gly19159=) rs777480811
NM_001267550.2(TTN):c.57478G>C (p.Val19160Leu) rs200778464
NM_001267550.2(TTN):c.57544+123T>C rs6712785
NM_001267550.2(TTN):c.57544+306G>A rs28378468
NM_001267550.2(TTN):c.57646A>G (p.Ile19216Val) rs374058726
NM_001267550.2(TTN):c.57648C>T (p.Ile19216=) rs55956577
NM_001267550.2(TTN):c.57656A>T (p.Tyr19219Phe) rs201541213
NM_001267550.2(TTN):c.57683G>A (p.Arg19228His) rs114711705
NM_001267550.2(TTN):c.57770G>A (p.Arg19257Gln) rs202076328
NM_001267550.2(TTN):c.57847+19del rs111496283
NM_001267550.2(TTN):c.57848-286G>A rs62178962
NM_001267550.2(TTN):c.58122C>G (p.Thr19374=) rs189818369
NM_001267550.2(TTN):c.58155C>A (p.Pro19385=) rs373587801
NM_001267550.2(TTN):c.58207G>C (p.Ala19403Pro) rs545185154
NM_001267550.2(TTN):c.58226G>A (p.Arg19409His) rs201505306
NM_001267550.2(TTN):c.58363G>A (p.Gly19455Ser) rs191927501
NM_001267550.2(TTN):c.58397G>C (p.Gly19466Ala) rs201922910
NM_001267550.2(TTN):c.58419A>G (p.Gln19473=) rs186563991
NM_001267550.2(TTN):c.58426G>A (p.Val19476Ile) rs397517636
NM_001267550.2(TTN):c.58433-16dup rs758370659
NM_001267550.2(TTN):c.58436G>A (p.Arg19479His) rs2288569
NM_001267550.2(TTN):c.58576G>A (p.Val19526Ile) rs377682563
NM_001267550.2(TTN):c.58612A>G (p.Thr19538Ala) rs200017524
NM_001267550.2(TTN):c.58636G>C (p.Glu19546Gln) rs201840554
NM_001267550.2(TTN):c.58841T>C (p.Ile19614Thr) rs199933004
NM_001267550.2(TTN):c.58869A>G (p.Lys19623=) rs191066933
NM_001267550.2(TTN):c.58933C>T (p.Leu19645=) rs2303836
NM_001267550.2(TTN):c.59165T>C (p.Val19722Ala) rs116592778
NM_001267550.2(TTN):c.59247C>T (p.Asp19749=) rs587780491
NM_001267550.2(TTN):c.59248G>A (p.Gly19750Ser) rs200732032
NM_001267550.2(TTN):c.59282A>G (p.Asn19761Ser) rs563969986
NM_001267550.2(TTN):c.59315C>T (p.Pro19772Leu) rs72646840
NM_001267550.2(TTN):c.59316G>A (p.Pro19772=) rs377180286
NM_001267550.2(TTN):c.59319G>A (p.Glu19773=) rs367622770
NM_001267550.2(TTN):c.59322A>G (p.Pro19774=) rs188063446
NM_001267550.2(TTN):c.59341C>T (p.Leu19781Phe) rs555577161
NM_001267550.2(TTN):c.59344+3G>A rs142095604
NM_001267550.2(TTN):c.59534G>A (p.Arg19845His) rs201457934
NM_001267550.2(TTN):c.59573C>T (p.Thr19858Ile) rs757911359
NM_001267550.2(TTN):c.59584C>T (p.Pro19862Ser) rs786205335
NM_001267550.2(TTN):c.59585C>T (p.Pro19862Leu) rs16866406
NM_001267550.2(TTN):c.59729C>T (p.Thr19910Ile) rs369476725
NM_001267550.2(TTN):c.59835C>T (p.Asn19945=) rs72646842
NM_001267550.2(TTN):c.59943C>A (p.Pro19981=) rs202017608
NM_001267550.2(TTN):c.60055G>A (p.Glu20019Lys) rs201487340
NM_001267550.2(TTN):c.60198G>A (p.Pro20066=) rs767152563
NM_001267550.2(TTN):c.60232G>A (p.Val20078Met) rs77351975
NM_001267550.2(TTN):c.6041C>T (p.Thr2014Ile) rs189149543
NM_001267550.2(TTN):c.60490G>C (p.Val20164Leu) rs72646843
NM_001267550.2(TTN):c.60524C>T (p.Pro20175Leu) rs771358314
NM_001267550.2(TTN):c.60621T>C (p.Tyr20207=) rs376959563
NM_001267550.2(TTN):c.60654G>A (p.Thr20218=) rs776141268
NM_001267550.2(TTN):c.60721G>C (p.Glu20241Gln) rs200212521
NM_001267550.2(TTN):c.60821C>T (p.Pro20274Leu) rs72646845
NM_001267550.2(TTN):c.60932G>A (p.Arg20311Gln) rs373062007
NM_001267550.2(TTN):c.61029T>C (p.Phe20343=) rs6706088
NM_001267550.2(TTN):c.61100G>A (p.Arg20367Gln) rs141973925
NM_001267550.2(TTN):c.61138C>A (p.Leu20380Met) rs201167216
NM_001267550.2(TTN):c.61224G>A (p.Val20408=) rs566188777
NM_001267550.2(TTN):c.61245A>G (p.Thr20415=) rs2163009
NM_001267550.2(TTN):c.61276C>T (p.Leu20426Phe) rs377529060
NM_001267550.2(TTN):c.61484G>A (p.Arg20495His) rs775137607
NM_001267550.2(TTN):c.61740T>C (p.Asn20580=)
NM_001267550.2(TTN):c.61922G>A (p.Arg20641Gln) rs199895260
NM_001267550.2(TTN):c.62011G>A (p.Glu20671Lys) rs770684884
NM_001267550.2(TTN):c.62058T>C (p.Tyr20686=) rs1560221
NM_001267550.2(TTN):c.62149A>G (p.Arg20717Gly) rs75458912
NM_001267550.2(TTN):c.62178T>C (p.Thr20726=) rs72646847
NM_001267550.2(TTN):c.62275G>A (p.Glu20759Lys) rs562680371
NM_001267550.2(TTN):c.62280T>C (p.Val20760=) rs372065796
NM_001267550.2(TTN):c.62385C>A (p.Gly20795=) rs72646848
NM_001267550.2(TTN):c.62425G>A (p.Ala20809Thr) rs532844402
NM_001267550.2(TTN):c.62511T>C (p.Ser20837=) rs369467841
NM_001267550.2(TTN):c.62534C>T (p.Thr20845Met) rs727505316
NM_001267550.2(TTN):c.62572A>G (p.Thr20858Ala) rs200689750
NM_001267550.2(TTN):c.62609A>C (p.Asn20870Thr) rs376338324
NM_001267550.2(TTN):c.62651G>T (p.Cys20884Phe)
NM_001267550.2(TTN):c.62679C>T (p.Gly20893=) rs188059075
NM_001267550.2(TTN):c.62943T>C (p.Thr20981=) rs184863287
NM_001267550.2(TTN):c.62994C>T (p.Tyr20998=) rs375006117
NM_001267550.2(TTN):c.62995T>G (p.Phe20999Val) rs568886353
NM_001267550.2(TTN):c.63023C>T (p.Thr21008Ile) rs72646850
NM_001267550.2(TTN):c.63026G>A (p.Arg21009Gln) rs72646851
NM_001267550.2(TTN):c.63109C>T (p.Arg21037Cys) rs191549948
NM_001267550.2(TTN):c.63165G>A (p.Pro21055=) rs72646852
NM_001267550.2(TTN):c.63273T>C (p.Asp21091=) rs374168580
NM_001267550.2(TTN):c.63287T>A (p.Ile21096Asn) rs558727238
NM_001267550.2(TTN):c.63329C>T (p.Ala21110Val) rs370687831
NM_001267550.2(TTN):c.63352C>T (p.Arg21118Trp) rs200726948
NM_001267550.2(TTN):c.63439G>A (p.Ala21147Thr) rs72646853
NM_001267550.2(TTN):c.63578G>A (p.Arg21193His) rs372267046
NM_001267550.2(TTN):c.63589A>G (p.Ile21197Val) rs72646855
NM_001267550.2(TTN):c.63876C>T (p.Asn21292=) rs199598302
NM_001267550.2(TTN):c.63879C>T (p.Asp21293=) rs200463088
NM_001267550.2(TTN):c.63907G>A (p.Val21303Met) rs372812312
NM_001267550.2(TTN):c.63917G>A (p.Arg21306His) rs202240487
NM_001267550.2(TTN):c.63942G>A (p.Ser21314=) rs201285872
NM_001267550.2(TTN):c.63981A>G (p.Val21327=) rs397517656
NM_001267550.2(TTN):c.64032C>T (p.Asn21344=) rs72646857
NM_001267550.2(TTN):c.64119A>C (p.Leu21373Phe) rs753245626
NM_001267550.2(TTN):c.64174C>T (p.Arg21392Cys) rs72646859
NM_001267550.2(TTN):c.64208C>T (p.Thr21403Ile) rs2042996
NM_001267550.2(TTN):c.64338T>C (p.Ala21446=) rs371514555
NM_001267550.2(TTN):c.64453C>A (p.Arg21485=) rs768345594
NM_001267550.2(TTN):c.64762G>A (p.Gly21588Arg) rs181717727
NM_001267550.2(TTN):c.64789G>A (p.Val21597Met) rs150661999
NM_001267550.2(TTN):c.65092C>T (p.Arg21698Cys) rs72646861
NM_001267550.2(TTN):c.65093G>T (p.Arg21698Leu) rs371581072
NM_001267550.2(TTN):c.65144G>T (p.Arg21715Leu) rs368450785
NM_001267550.2(TTN):c.65147C>T (p.Ser21716Leu) rs13021201
NM_001267550.2(TTN):c.65182C>G (p.Leu21728Val) rs781121273
NM_001267550.2(TTN):c.65187G>A (p.Glu21729=) rs397517660
NM_001267550.2(TTN):c.65275+92C>T rs16866400
NM_001267550.2(TTN):c.65276-8T>C rs377484398
NM_001267550.2(TTN):c.65410T>C (p.Trp21804Arg) rs745626132
NM_001267550.2(TTN):c.65459C>T (p.Thr21820Ile) rs56130023
NM_001267550.2(TTN):c.65499A>G (p.Arg21833=) rs369255906
NM_001267550.2(TTN):c.65515G>A (p.Ala21839Thr) rs56378177
NM_001267550.2(TTN):c.65516C>T (p.Ala21839Val) rs55948748
NM_001267550.2(TTN):c.65534C>T (p.Pro21845Leu) rs201662134
NM_001267550.2(TTN):c.65575+10T>C rs72646864
NM_001267550.2(TTN):c.65575+19T>G rs72646865
NM_001267550.2(TTN):c.65604T>C (p.Ala21868=) rs200825430
NM_001267550.2(TTN):c.65622T>C (p.Thr21874=) rs55766906
NM_001267550.2(TTN):c.65682A>G (p.Thr21894=) rs4894029
NM_001267550.2(TTN):c.65729T>C (p.Ile21910Thr) rs146941600
NM_001267550.2(TTN):c.65743C>A (p.Gln21915Lys) rs62618736
NM_001267550.2(TTN):c.65746C>T (p.Arg21916Trp) rs200155485
NM_001267550.2(TTN):c.65747G>A (p.Arg21916Gln) rs148849567
NM_001267550.2(TTN):c.65775C>T (p.Ser21925=) rs72646867
NM_001267550.2(TTN):c.66051G>A (p.Val22017=) rs587780981
NM_001267550.2(TTN):c.66123A>G (p.Pro22041=) rs727504190
NM_001267550.2(TTN):c.66160+15C>T rs377288086
NM_001267550.2(TTN):c.66160+16G>A rs149714835
NM_001267550.2(TTN):c.66283C>T (p.Arg22095Trp) rs571093313
NM_001267550.2(TTN):c.66491A>T (p.Lys22164Ile) rs371081043
NM_001267550.2(TTN):c.66552C>T (p.Gly22184=)
NM_001267550.2(TTN):c.66576C>A (p.Leu22192=) rs187378247
NM_001267550.2(TTN):c.66580G>A (p.Glu22194Lys)
NM_001267550.2(TTN):c.66600C>T (p.Ser22200=) rs371324060
NM_001267550.2(TTN):c.66614G>A (p.Arg22205Lys) rs72646869
NM_001267550.2(TTN):c.66692G>A (p.Arg22231His) rs200971254
NM_001267550.2(TTN):c.66702C>T (p.Ala22234=) rs371802557
NM_001267550.2(TTN):c.66898G>A (p.Val22300Ile) rs200343420
NM_001267550.2(TTN):c.66917T>C (p.Ile22306Thr) rs397517667
NM_001267550.2(TTN):c.66977A>G (p.Lys22326Arg) rs202125813
NM_001267550.2(TTN):c.67058-16C>T rs201800666
NM_001267550.2(TTN):c.67075G>A (p.Val22359Ile) rs2303838
NM_001267550.2(TTN):c.67099T>C (p.Ser22367Pro) rs72646873
NM_001267550.2(TTN):c.67246G>C (p.Ala22416Pro) rs4145333
NM_001267550.2(TTN):c.67348+11G>C rs587780982
NM_001267550.2(TTN):c.67444C>T (p.Arg22482Trp) rs563233842
NM_001267550.2(TTN):c.67542T>G (p.Thr22514=) rs72646876
NM_001267550.2(TTN):c.67635T>C (p.Val22545=) rs2288570
NM_001267550.2(TTN):c.67636+2T>C rs1575872984
NM_001267550.2(TTN):c.67637-17T>C rs2288571
NM_001267550.2(TTN):c.67809G>A (p.Ala22603=) rs548223512
NM_001267550.2(TTN):c.67833C>T (p.Tyr22611=) rs375538420
NM_001267550.2(TTN):c.67960G>C (p.Asp22654His) rs144295295
NM_001267550.2(TTN):c.68079G>A (p.Thr22693=) rs11904444
NM_001267550.2(TTN):c.68082C>T (p.Cys22694=) rs79406408
NM_001267550.2(TTN):c.68160C>T (p.Ala22720=) rs397517673
NM_001267550.2(TTN):c.68161G>A (p.Glu22721Lys) rs374492812
NM_001267550.2(TTN):c.68208T>A (p.Val22736=) rs727503575
NM_001267550.2(TTN):c.68217T>C (p.His22739=) rs10497517
NM_001267550.2(TTN):c.68329+121A>C rs3769864
NM_001267550.2(TTN):c.68391G>A (p.Pro22797=) rs368985748
NM_001267550.2(TTN):c.68437G>A (p.Glu22813Lys) rs200797552
NM_001267550.2(TTN):c.68450G>A (p.Arg22817Gln) rs372496072
NM_001267550.2(TTN):c.68457G>C (p.Met22819Ile) rs786205339
NM_001267550.2(TTN):c.68458G>C (p.Ala22820Pro) rs72646880
NM_001267550.2(TTN):c.68527+15G>A rs184043128
NM_001267550.2(TTN):c.68528-8T>C
NM_001267550.2(TTN):c.68632G>A (p.Val22878Met) rs764263517
NM_001267550.2(TTN):c.68762C>T (p.Thr22921Ile) rs534567766
NM_001267550.2(TTN):c.68792G>A (p.Ser22931Asn) rs201567815
NM_001267550.2(TTN):c.68824G>A (p.Glu22942Lys) rs199506676
NM_001267550.2(TTN):c.68981C>T (p.Thr22994Ile) rs183056142
NM_001267550.2(TTN):c.69129C>T (p.Pro23043=) rs786205332
NM_001267550.2(TTN):c.69130C>T (p.Pro23044Ser) rs55980498
NM_001267550.2(TTN):c.69144A>G (p.Glu23048=) rs786205342
NM_001267550.2(TTN):c.69145A>G (p.Ile23049Val) rs72646881
NM_001267550.2(TTN):c.69231T>C (p.Leu23077=) rs12615797
NM_001267550.2(TTN):c.69383C>A (p.Ser23128Tyr) rs72646882
NM_001267550.2(TTN):c.69412+10G>C rs72646883
NM_001267550.2(TTN):c.69585C>T (p.Ser23195=) rs67041405
NM_001267550.2(TTN):c.69676A>G (p.Ser23226Gly) rs72646885
NM_001267550.2(TTN):c.69716-5C>G rs72646886
NM_001267550.2(TTN):c.69739C>T (p.Pro23247Ser) rs786205381
NM_001267550.2(TTN):c.69740C>T (p.Pro23247Leu) rs115658240
NM_001267550.2(TTN):c.69821G>A (p.Gly23274Asp) rs201043950
NM_001267550.2(TTN):c.69864A>G (p.Ile23288Met) rs368867993
NM_001267550.2(TTN):c.69903C>A (p.Phe23301Leu) rs372799151
NM_001267550.2(TTN):c.70131A>G (p.Thr23377=) rs369503828
NM_001267550.2(TTN):c.7020C>T (p.Ile2340=) rs587780986
NM_001267550.2(TTN):c.7023C>T (p.Asp2341=) rs761409144
NM_001267550.2(TTN):c.70250T>C (p.Ile23417Thr) rs201836227
NM_001267550.2(TTN):c.70305G>A (p.Thr23435=) rs397517684
NM_001267550.2(TTN):c.70380G>A (p.Leu23460=) rs185660043
NM_001267550.2(TTN):c.70491C>T (p.Thr23497=) rs372382315
NM_001267550.2(TTN):c.70492G>A (p.Gly23498Ser) rs370771532
NM_001267550.2(TTN):c.70506G>T (p.Gly23502=) rs181702963
NM_001267550.2(TTN):c.70579G>A (p.Val23527Ile)
NM_001267550.2(TTN):c.70651C>T (p.Leu23551=) rs72646889
NM_001267550.2(TTN):c.70677T>C (p.Asp23559=) rs72646890
NM_001267550.2(TTN):c.70696G>C (p.Gly23566Arg) rs55801134
NM_001267550.2(TTN):c.70761G>T (p.Gly23587=) rs190149868
NM_001267550.2(TTN):c.70815G>A (p.Val23605=) rs55847238
NM_001267550.2(TTN):c.70830C>T (p.Ser23610=) rs12464787
NM_001267550.2(TTN):c.70832C>T (p.Ala23611Val) rs72646891
NM_001267550.2(TTN):c.70833G>A (p.Ala23611=) rs377220635
NM_001267550.2(TTN):c.70906C>T (p.Arg23636Cys) rs189208539
NM_001267550.2(TTN):c.70907G>A (p.Arg23636His) rs56071233
NM_001267550.2(TTN):c.70952T>G (p.Ile23651Ser) rs149075285
NM_001267550.2(TTN):c.70998A>G (p.Thr23666=) rs767989384
NM_001267550.2(TTN):c.71036G>A (p.Arg23679Lys) rs200144345
NM_001267550.2(TTN):c.71058G>A (p.Ala23686=) rs375183437
NM_001267550.2(TTN):c.71369G>A (p.Arg23790His) rs55677134
NM_001267550.2(TTN):c.71705T>C (p.Ile23902Thr) rs55837610
NM_001267550.2(TTN):c.71793A>G (p.Pro23931=) rs780920316
NM_001267550.2(TTN):c.71833T>C (p.Trp23945Arg) rs553796385
NM_001267550.2(TTN):c.71883T>C (p.Val23961=) rs368692510
NM_001267550.2(TTN):c.71940G>A (p.Leu23980=) rs72646893
NM_001267550.2(TTN):c.71993G>A (p.Arg23998His) rs10164753
NM_001267550.2(TTN):c.72033A>G (p.Pro24011=) rs72646894
NM_001267550.2(TTN):c.72105T>C (p.Phe24035=) rs397517691
NM_001267550.2(TTN):c.72113C>T (p.Thr24038Met) rs370375696
NM_001267550.2(TTN):c.72132T>C (p.Gly24044=) rs56169243
NM_001267550.2(TTN):c.72137C>T (p.Ala24046Val) rs146767076
NM_001267550.2(TTN):c.72146T>C (p.Leu24049Pro) rs56399205
NM_001267550.2(TTN):c.72149A>G (p.Glu24050Gly)
NM_001267550.2(TTN):c.72302C>A (p.Thr24101Asn) rs192962624
NM_001267550.2(TTN):c.72379G>A (p.Glu24127Lys) rs149763294
NM_001267550.2(TTN):c.72587G>A (p.Arg24196His) rs200317412
NM_001267550.2(TTN):c.72624A>G (p.Pro24208=) rs56293906
NM_001267550.2(TTN):c.72720T>A (p.Val24240=) rs550285671
NM_001267550.2(TTN):c.72766A>G (p.Asn24256Asp) rs187868672
NM_001267550.2(TTN):c.72782G>A (p.Arg24261Gln) rs142874389
NM_001267550.2(TTN):c.72803G>A (p.Arg24268His) rs140018785
NM_001267550.2(TTN):c.72906T>A (p.Ala24302=) rs773886758
NM_001267550.2(TTN):c.72931A>G (p.Thr24311Ala) rs56201325
NM_001267550.2(TTN):c.73168A>G (p.Thr24390Ala) rs182491843
NM_001267550.2(TTN):c.73336C>T (p.Leu24446=) rs189768015
NM_001267550.2(TTN):c.73517G>A (p.Gly24506Asp) rs567446185
NM_001267550.2(TTN):c.73604C>A (p.Ser24535Tyr) rs201804005
NM_001267550.2(TTN):c.73783G>A (p.Ala24595Thr) rs543275318
NM_001267550.2(TTN):c.73825G>C (p.Glu24609Gln) rs55762754
NM_001267550.2(TTN):c.74042A>G (p.Gln24681Arg) rs537071956
NM_001267550.2(TTN):c.74144C>T (p.Pro24715Leu) rs55713856
NM_001267550.2(TTN):c.74190T>G (p.Gly24730=) rs201797603
NM_001267550.2(TTN):c.74549A>G (p.Asp24850Gly) rs573415766
NM_001267550.2(TTN):c.74564C>T (p.Thr24855Ile) rs759432194
NM_001267550.2(TTN):c.74602A>G (p.Ile24868Val) rs72646898
NM_001267550.2(TTN):c.74839C>T (p.Arg24947Cys) rs744426
NM_001267550.2(TTN):c.74891C>T (p.Pro24964Leu) rs72646899
NM_001267550.2(TTN):c.74895A>C (p.Gln24965His) rs201512527
NM_001267550.2(TTN):c.74965G>A (p.Val24989Met) rs567800207
NM_001267550.2(TTN):c.74972T>C (p.Ile24991Thr) rs744427
NM_001267550.2(TTN):c.75034C>T (p.Arg25012Trp) rs368914555
NM_001267550.2(TTN):c.75192T>C (p.Thr25064=) rs370480927
NM_001267550.2(TTN):c.75194A>G (p.His25065Arg) rs182161195
NM_001267550.2(TTN):c.7530A>G (p.Ser2510=) rs189187431
NM_001267550.2(TTN):c.75441A>G (p.Lys25147=) rs56151652
NM_001267550.2(TTN):c.75522A>C (p.Ala25174=) rs6732060
NM_001267550.2(TTN):c.75738A>G (p.Glu25246=) rs371344165
NM_001267550.2(TTN):c.75745C>T (p.Arg25249Cys) rs397517702
NM_001267550.2(TTN):c.75762G>T (p.Val25254=) rs374003257
NM_001267550.2(TTN):c.75969T>C (p.Val25323=) rs368759398
NM_001267550.2(TTN):c.76019T>A (p.Val25340Asp) rs200287703
NM_001267550.2(TTN):c.76069C>T (p.Arg25357Cys) rs145437410
NM_001267550.2(TTN):c.76113A>G (p.Glu25371=) rs140350441
NM_001267550.2(TTN):c.76343G>A (p.Ser25448Asn) rs3813243
NM_001267550.2(TTN):c.76483G>A (p.Val25495Ile) rs773127796
NM_001267550.2(TTN):c.76523C>A (p.Pro25508Gln) rs188085512
NM_001267550.2(TTN):c.76610G>A (p.Arg25537His) rs561977468
NM_001267550.2(TTN):c.76699G>T (p.Val25567Phe) rs3813244
NM_001267550.2(TTN):c.76720T>C (p.Tyr25574His) rs3813245
NM_001267550.2(TTN):c.76722T>C (p.Tyr25574=) rs55696153
NM_001267550.2(TTN):c.76739C>A (p.Thr25580Lys) rs56372592
NM_001267550.2(TTN):c.76739C>T (p.Thr25580Met) rs56372592
NM_001267550.2(TTN):c.76803G>A (p.Thr25601=) rs751627427
NM_001267550.2(TTN):c.76854A>G (p.Val25618=) rs192902075
NM_001267550.2(TTN):c.76922G>A (p.Arg25641His) rs369707906
NM_001267550.2(TTN):c.77043T>C (p.Tyr25681=) rs370810609
NM_001267550.2(TTN):c.77052C>T (p.Gly25684=) rs372543652
NM_001267550.2(TTN):c.77073T>C (p.Asp25691=) rs375398118
NM_001267550.2(TTN):c.77205G>A (p.Val25735=) rs55857909
NM_001267550.2(TTN):c.77216C>G (p.Ala25739Gly) rs56391938
NM_001267550.2(TTN):c.77249G>A (p.Arg25750Gln) rs368038362
NM_001267550.2(TTN):c.77278A>G (p.Asn25760Asp) rs786205340
NM_001267550.2(TTN):c.77279A>G (p.Asn25760Ser) rs3813246
NM_001267550.2(TTN):c.77638A>G (p.Thr25880Ala) rs56018860
NM_001267550.2(TTN):c.77654T>C (p.Ile25885Thr) rs199514898
NM_001267550.2(TTN):c.77716G>A (p.Glu25906Lys) rs56341835
NM_001267550.2(TTN):c.77813G>C (p.Trp25938Ser) rs186681106
NM_001267550.2(TTN):c.77913T>C (p.Tyr25971=) rs72648203
NM_001267550.2(TTN):c.78147A>G (p.Gln26049=) rs149127072
NM_001267550.2(TTN):c.78371T>A (p.Ile26124Asn) rs778290450
NM_001267550.2(TTN):c.78431T>C (p.Ile26144Thr) rs183015944
NM_001267550.2(TTN):c.7856-59A>T rs2291305
NM_001267550.2(TTN):c.78674T>C (p.Ile26225Thr) rs12463674
NM_001267550.2(TTN):c.78756T>C (p.Ile26252=) rs372319281
NM_001267550.2(TTN):c.78855T>C (p.Asp26285=) rs139953862
NM_001267550.2(TTN):c.78892G>A (p.Gly26298Arg) rs72648205
NM_001267550.2(TTN):c.78942T>C (p.Asp26314=) rs560223850
NM_001267550.2(TTN):c.78991C>A (p.Arg26331=) rs779996703
NM_001267550.2(TTN):c.79062T>A (p.Gly26354=) rs3731744
NM_001267550.2(TTN):c.79226G>A (p.Arg26409His) rs72648206
NM_001267550.2(TTN):c.79265T>C (p.Ile26422Thr) rs3731745
NM_001267550.2(TTN):c.79317C>T (p.Arg26439=) rs770029880
NM_001267550.2(TTN):c.79318C>T (p.Arg26440Cys) rs55861600
NM_001267550.2(TTN):c.79319G>A (p.Arg26440His) rs56044609
NM_001267550.2(TTN):c.79410G>A (p.Gly26470=) rs140942979
NM_001267550.2(TTN):c.79612A>G (p.Thr26538Ala) rs150682764
NM_001267550.2(TTN):c.79689C>A (p.Val26563=) rs10185798
NM_001267550.2(TTN):c.79700A>G (p.Asn26567Ser) rs183844833
NM_001267550.2(TTN):c.79783G>C (p.Asp26595His) rs56307213
NM_001267550.2(TTN):c.79856G>A (p.Arg26619His) rs530507211
NM_001267550.2(TTN):c.79862C>A (p.Thr26621Lys) rs3731746
NM_001267550.2(TTN):c.79862C>T (p.Thr26621Met) rs3731746
NM_001267550.2(TTN):c.79941A>G (p.Gln26647=) rs72648208
NM_001267550.2(TTN):c.80115G>T (p.Glu26705Asp) rs558830502
NM_001267550.2(TTN):c.80263T>C (p.Phe26755Leu) rs200181804
NM_001267550.2(TTN):c.80271C>T (p.Val26757=) rs199875474
NM_001267550.2(TTN):c.80322C>T (p.Ala26774=) rs55892928
NM_001267550.2(TTN):c.80553C>T (p.Phe26851=) rs189790119
NM_001267550.2(TTN):c.80554C>T (p.Arg26852Cys) rs185887755
NM_001267550.2(TTN):c.80586C>T (p.Ser26862=) rs748292845
NM_001267550.2(TTN):c.80635C>A (p.Gln26879Lys) rs79926414
NM_001267550.2(TTN):c.80661C>T (p.Asn26887=) rs201069672
NM_001267550.2(TTN):c.80700A>G (p.Glu26900=) rs751557221
NM_001267550.2(TTN):c.80701A>G (p.Ile26901Val) rs201562505
NM_001267550.2(TTN):c.80722A>C (p.Arg26908=) rs573877174
NM_001267550.2(TTN):c.80799C>A (p.Thr26933=) rs3813247
NM_001267550.2(TTN):c.80854G>A (p.Val26952Ile) rs371362606
NM_001267550.2(TTN):c.80858C>T (p.Thr26953Met) rs377506142
NM_001267550.2(TTN):c.80859G>A (p.Thr26953=) rs771257647
NM_001267550.2(TTN):c.80882C>T (p.Ala26961Val) rs749194310
NM_001267550.2(TTN):c.80904C>T (p.Ile26968=) rs539234338
NM_001267550.2(TTN):c.80944T>C (p.Phe26982Leu) rs200406978
NM_001267550.2(TTN):c.80983G>A (p.Glu26995Lys) rs397517719
NM_001267550.2(TTN):c.81057T>C (p.Thr27019=) rs114908705
NM_001267550.2(TTN):c.81105C>A (p.Thr27035=) rs72648212
NM_001267550.2(TTN):c.81123G>A (p.Thr27041=) rs181299250
NM_001267550.2(TTN):c.81157T>A (p.Tyr27053Asn) rs776943572
NM_001267550.2(TTN):c.8116+19G>A rs13011633
NM_001267550.2(TTN):c.8116+88A>G rs2291304
NM_001267550.2(TTN):c.81217C>T (p.Pro27073Ser) rs542799302
NM_001267550.2(TTN):c.81539T>C (p.Ile27180Thr) rs182126530
NM_001267550.2(TTN):c.81558T>C (p.Asn27186=) rs56181243
NM_001267550.2(TTN):c.81855C>T (p.Ile27285=) rs56214710
NM_001267550.2(TTN):c.81892G>A (p.Asp27298Asn) rs200697681
NM_001267550.2(TTN):c.81938G>A (p.Gly27313Glu) rs199670463
NM_001267550.2(TTN):c.81958G>A (p.Ala27320Thr) rs56365600
NM_001267550.2(TTN):c.82070C>G (p.Thr27357Arg) rs754175266
NM_001267550.2(TTN):c.82081C>G (p.Pro27361Ala) rs56137800
NM_001267550.2(TTN):c.82103A>G (p.Asp27368Gly) rs145373396
NM_001267550.2(TTN):c.82235C>A (p.Thr27412Lys) rs201489661
NM_001267550.2(TTN):c.82241G>A (p.Arg27414Gln)
NM_001267550.2(TTN):c.82385C>A (p.Thr27462Lys) rs55933739
NM_001267550.2(TTN):c.82402A>C (p.Lys27468Gln) rs201958805
NM_001267550.2(TTN):c.82486G>A (p.Asp27496Asn) rs554231442
NM_001267550.2(TTN):c.82489G>A (p.Gly27497Arg) rs201158906
NM_001267550.2(TTN):c.82497C>T (p.Thr27499=) rs199629314
NM_001267550.2(TTN):c.82560C>A (p.Asn27520Lys) rs56264840
NM_001267550.2(TTN):c.82575G>A (p.Thr27525=) rs11896779
NM_001267550.2(TTN):c.82688G>A (p.Arg27563His) rs118079537
NM_001267550.2(TTN):c.82691C>T (p.Ala27564Val) rs55634791
NM_001267550.2(TTN):c.82692G>A (p.Ala27564=) rs557628408
NM_001267550.2(TTN):c.82740G>A (p.Thr27580=) rs56345408
NM_001267550.2(TTN):c.82797C>T (p.Gly27599=) rs72648216
NM_001267550.2(TTN):c.82798G>A (p.Ala27600Thr) rs11896637
NM_001267550.2(TTN):c.82810G>A (p.Gly27604Ser) rs199929362
NM_001267550.2(TTN):c.83056G>A (p.Val27686Ile) rs56309296
NM_001267550.2(TTN):c.83059C>T (p.Leu27687=) rs200992636
NM_001267550.2(TTN):c.83063G>A (p.Arg27688His) rs185002960
NM_001267550.2(TTN):c.83080C>T (p.Arg27694Cys) rs192360370
NM_001267550.2(TTN):c.83133G>A (p.Lys27711=) rs369223412
NM_001267550.2(TTN):c.83171T>G (p.Val27724Gly) rs201896662
NM_001267550.2(TTN):c.83272T>C (p.Phe27758Leu) rs188323108
NM_001267550.2(TTN):c.83323A>G (p.Ile27775Val) rs3829746
NM_001267550.2(TTN):c.83351C>T (p.Thr27784Met) rs140879454
NM_001267550.2(TTN):c.83516G>A (p.Arg27839Gln) rs376820301
NM_001267550.2(TTN):c.83618T>C (p.Val27873Ala) rs200775919
NM_001267550.2(TTN):c.83673T>C (p.Gly27891=) rs2366751
NM_001267550.2(TTN):c.83740A>G (p.Thr27914Ala) rs188370772
NM_001267550.2(TTN):c.83870G>C (p.Arg27957Thr) rs148067743
NM_001267550.2(TTN):c.84148A>G (p.Ile28050Val) rs201348580
NM_001267550.2(TTN):c.84263G>A (p.Ser28088Asn) rs200450022
NM_001267550.2(TTN):c.84352C>T (p.Arg28118Cys) rs56057221
NM_001267550.2(TTN):c.84453A>G (p.Pro28151=) rs73036373
NM_001267550.2(TTN):c.84461C>T (p.Pro28154Leu) rs200350579
NM_001267550.2(TTN):c.84640A>G (p.Met28214Val) rs72648221
NM_001267550.2(TTN):c.84682C>T (p.Arg28228Cys)
NM_001267550.2(TTN):c.84696A>C (p.Glu28232Asp) rs397517730
NM_001267550.2(TTN):c.84871C>T (p.Arg28291Cys) rs192152102
NM_001267550.2(TTN):c.84893G>A (p.Arg28298Gln) rs187270666
NM_001267550.2(TTN):c.84977G>A (p.Arg28326Gln) rs200843338
NM_001267550.2(TTN):c.85248A>T (p.Thr28416=) rs187180708
NM_001267550.2(TTN):c.85406C>G (p.Ser28469Cys) rs202040332
NM_001267550.2(TTN):c.85462G>A (p.Val28488Ile) rs377264123
NM_001267550.2(TTN):c.85516C>A (p.Gln28506Lys) rs201272728
NM_001267550.2(TTN):c.85651C>A (p.Pro28551Thr) rs142478636
NM_001267550.2(TTN):c.85691A>T (p.Lys28564Ile) rs199859344
NM_001267550.2(TTN):c.85863T>C (p.Tyr28621=) rs113527853
NM_001267550.2(TTN):c.86002A>G (p.Ile28668Val) rs72648225
NM_001267550.2(TTN):c.86052T>C (p.Thr28684=) rs76928874
NM_001267550.2(TTN):c.86117G>A (p.Arg28706Gln) rs199788826
NM_001267550.2(TTN):c.86301G>A (p.Lys28767=) rs56310931
NM_001267550.2(TTN):c.86526T>G (p.Val28842=) rs72648226
NM_001267550.2(TTN):c.86654G>A (p.Arg28885His) rs371539720
NM_001267550.2(TTN):c.86658G>A (p.Glu28886=) rs760858743
NM_001267550.2(TTN):c.86683G>A (p.Val28895Met) rs201290358
NM_001267550.2(TTN):c.86811A>G (p.Val28937=) rs55972010
NM_001267550.2(TTN):c.86821+156T>C rs28653157
NM_001267550.2(TTN):c.86935G>A (p.Val28979Ile) rs201687390
NM_001267550.2(TTN):c.86949A>G (p.Glu28983=) rs375565646
NM_001267550.2(TTN):c.87006T>C (p.Val29002=) rs761762773
NM_001267550.2(TTN):c.87087T>C (p.Leu29029=) rs12621078
NM_001267550.2(TTN):c.87111G>A (p.Glu29037=) rs374902148
NM_001267550.2(TTN):c.87137T>G (p.Met29046Arg) rs143975327
NM_001267550.2(TTN):c.87280G>A (p.Glu29094Lys) rs199501185
NM_001267550.2(TTN):c.87412C>A (p.Pro29138Thr) rs72648227
NM_001267550.2(TTN):c.87600G>C (p.Met29200Ile) rs750362675
NM_001267550.2(TTN):c.87623A>T (p.Tyr29208Phe) rs201831707
NM_001267550.2(TTN):c.87669T>C (p.His29223=) rs72648229
NM_001267550.2(TTN):c.87707-4G>T rs201770959
NM_001267550.2(TTN):c.87771C>A (p.Gly29257=) rs72648230
NM_001267550.2(TTN):c.87808G>A (p.Val29270Ile) rs141624266
NM_001267550.2(TTN):c.87877C>T (p.Arg29293Cys) rs191482653
NM_001267550.2(TTN):c.88009+22G>T rs72648232
NM_001267550.2(TTN):c.88028G>A (p.Arg29343His) rs73036368
NM_001267550.2(TTN):c.88090G>A (p.Gly29364Ser) rs183013408
NM_001267550.2(TTN):c.88134A>G (p.Pro29378=) rs374612925
NM_001267550.2(TTN):c.88187T>C (p.Ile29396Thr) rs9808377
NM_001267550.2(TTN):c.88272G>A (p.Glu29424=) rs9808036
NM_001267550.2(TTN):c.88297G>A (p.Asp29433Asn) rs189202799
NM_001267550.2(TTN):c.88306+281G>A rs35504893
NM_001267550.2(TTN):c.88340C>G (p.Thr29447Arg) rs140201636
NM_001267550.2(TTN):c.88394C>T (p.Ser29465Phe) rs146181116
NM_001267550.2(TTN):c.88407G>A (p.Ala29469=) rs531445644
NM_001267550.2(TTN):c.88459G>A (p.Val29487Met) rs200899806
NM_001267550.2(TTN):c.88476C>G (p.Thr29492=) rs190406444
NM_001267550.2(TTN):c.88485C>T (p.Leu29495=) rs371612136
NM_001267550.2(TTN):c.88510G>A (p.Asp29504Asn) rs376679796
NM_001267550.2(TTN):c.88611T>G (p.Pro29537=) rs555380931
NM_001267550.2(TTN):c.88708A>G (p.Ile29570Val) rs139506970
NM_001267550.2(TTN):c.88720C>T (p.Arg29574Cys) rs200513274
NM_001267550.2(TTN):c.88721G>A (p.Arg29574His) rs111727915
NM_001267550.2(TTN):c.88851C>G (p.Gly29617=) rs201241167
NM_001267550.2(TTN):c.88858C>T (p.Leu29620=) rs115070904
NM_001267550.2(TTN):c.88895-18C>T rs547463003
NM_001267550.2(TTN):c.88972A>G (p.Ile29658Val) rs200193877
NM_001267550.2(TTN):c.8902+14TA[7] rs769907387
NM_001267550.2(TTN):c.8902+14_8902+16delinsA rs786200994
NM_001267550.2(TTN):c.8902+14del rs573000455
NM_001267550.2(TTN):c.8902+16T>A rs66507451
NM_001267550.2(TTN):c.8902+16del
NM_001267550.2(TTN):c.89136C>T (p.Asn29712=) rs376289479
NM_001267550.2(TTN):c.89317A>T (p.Ile29773Leu) rs77853750
NM_001267550.2(TTN):c.89386G>A (p.Val29796Met) rs72648237
NM_001267550.2(TTN):c.89410G>A (p.Val29804Ile)
NM_001267550.2(TTN):c.89426G>A (p.Arg29809Gln) rs72648238
NM_001267550.2(TTN):c.89520C>T (p.Asp29840=) rs746569192
NM_001267550.2(TTN):c.89924C>T (p.Ala29975Val) rs117097948
NM_001267550.2(TTN):c.89989T>A (p.Leu29997Met) rs369855092
NM_001267550.2(TTN):c.89994G>A (p.Ser29998=) rs142891278
NM_001267550.2(TTN):c.90536G>A (p.Arg30179His) rs149567378
NM_001267550.2(TTN):c.90638T>C (p.Ile30213Thr) rs114026724
NM_001267550.2(TTN):c.90652A>G (p.Thr30218Ala) rs768528782
NM_001267550.2(TTN):c.90826T>G (p.Cys30276Gly) rs150430592
NM_001267550.2(TTN):c.90913T>C (p.Tyr30305His) rs544353741
NM_001267550.2(TTN):c.90968G>A (p.Arg30323Lys) rs11887722
NM_001267550.2(TTN):c.91+47_91+51del rs3830329
NM_001267550.2(TTN):c.91071T>G (p.Thr30357=) rs11897366
NM_001267550.2(TTN):c.91089G>A (p.Lys30363=) rs762103106
NM_001267550.2(TTN):c.91173A>C (p.Glu30391Asp) rs199505541
NM_001267550.2(TTN):c.91343G>A (p.Arg30448His)
NM_001267550.2(TTN):c.91347T>C (p.Asp30449=) rs193022702
NM_001267550.2(TTN):c.91352G>A (p.Gly30451Asp) rs751610164
NM_001267550.2(TTN):c.91373G>A (p.Ser30458Asn) rs376634713
NM_001267550.2(TTN):c.914+164T>C rs66733621
NM_001267550.2(TTN):c.91425C>T (p.Asp30475=) rs145133144
NM_001267550.2(TTN):c.9150A>G (p.Thr3050=) rs72647886
NM_001267550.2(TTN):c.91557T>C (p.Asp30519=) rs202185465
NM_001267550.2(TTN):c.91565-13C>T rs200847757
NM_001267550.2(TTN):c.91572A>G (p.Pro30524=) rs786205334
NM_001267550.2(TTN):c.91573A>G (p.Ile30525Val) rs72648244
NM_001267550.2(TTN):c.91601A>T (p.Asp30534Val) rs182549226
NM_001267550.2(TTN):c.91621G>A (p.Gly30541Arg) rs200854704
NM_001267550.2(TTN):c.9163+123G>A rs72647887
NM_001267550.2(TTN):c.9163+213A>G rs72647888
NM_001267550.2(TTN):c.9164-208T>C rs72647889
NM_001267550.2(TTN):c.91643C>T (p.Ala30548Val) rs553668520
NM_001267550.2(TTN):c.91732G>A (p.Val30578Ile) rs727504672
NM_001267550.2(TTN):c.91765G>A (p.Ala30589Thr) rs148617456
NM_001267550.2(TTN):c.91852+8T>A rs56145100
NM_001267550.2(TTN):c.91853-37G>T rs890578
NM_001267550.2(TTN):c.91884A>T (p.Arg30628Ser) rs144922355
NM_001267550.2(TTN):c.91936A>G (p.Asn30646Asp) rs786205328
NM_001267550.2(TTN):c.91937A>G (p.Asn30646Ser) rs72648245
NM_001267550.2(TTN):c.92-22G>A rs3816849
NM_001267550.2(TTN):c.92009T>C (p.Ile30670Thr) rs369342933
NM_001267550.2(TTN):c.92042C>A (p.Ala30681Asp) rs201400267
NM_001267550.2(TTN):c.92058C>T (p.Asn30686=) rs545632095
NM_001267550.2(TTN):c.92131G>A (p.Val30711Met) rs747122
NM_001267550.2(TTN):c.92152+11G>A rs372798472
NM_001267550.2(TTN):c.92176C>T (p.Pro30726Ser) rs72648247
NM_001267550.2(TTN):c.92191A>G (p.Ile30731Val) rs16866391
NM_001267550.2(TTN):c.92241T>C (p.Gly30747=) rs373311745
NM_001267550.2(TTN):c.92362G>A (p.Gly30788Ser) rs199891245
NM_001267550.2(TTN):c.92506A>C (p.Thr30836Pro) rs762590394
NM_001267550.2(TTN):c.92537T>C (p.Val30846Ala) rs77968867
NM_001267550.2(TTN):c.92590G>A (p.Asp30864Asn) rs200621611
NM_001267550.2(TTN):c.92684G>A (p.Arg30895Gln) rs200141081
NM_001267550.2(TTN):c.92696T>C (p.Ile30899Thr) rs373727636
NM_001267550.2(TTN):c.92715C>T (p.Gly30905=) rs140576051
NM_001267550.2(TTN):c.92780T>A (p.Ile30927Lys) rs531432790
NM_001267550.2(TTN):c.92806G>A (p.Val30936Ile) rs200476500
NM_001267550.2(TTN):c.92901C>T (p.Ser30967=) rs11694623
NM_001267550.2(TTN):c.93005G>T (p.Ser31002Ile) rs180975448
NM_001267550.2(TTN):c.93131G>T (p.Gly31044Val) rs570464905
NM_001267550.2(TTN):c.93243C>T (p.Ala31081=) rs3731748
NM_001267550.2(TTN):c.93387C>T (p.Ser31129=) rs35445420
NM_001267550.2(TTN):c.93444C>T (p.Tyr31148=) rs561739832
NM_001267550.2(TTN):c.93524G>A (p.Arg31175His) rs72648251
NM_001267550.2(TTN):c.93803A>C (p.Lys31268Thr) rs200766837
NM_001267550.2(TTN):c.93868C>T (p.Leu31290=) rs557737090
NM_001267550.2(TTN):c.93900C>T (p.Ser31300=) rs200173934
NM_001267550.2(TTN):c.93901G>A (p.Val31301Ile) rs67665715
NM_001267550.2(TTN):c.94016C>T (p.Thr31339Ile) rs184078016
NM_001267550.2(TTN):c.9402C>T (p.Asn3134=) rs587780987
NM_001267550.2(TTN):c.94045C>T (p.Arg31349Cys) rs727503549
NM_001267550.2(TTN):c.94046G>A (p.Arg31349His) rs181104321
NM_001267550.2(TTN):c.94348C>T (p.Arg31450Cys) rs541040798
NM_001267550.2(TTN):c.94464T>C (p.Ala31488=) rs138888307
NM_001267550.2(TTN):c.94523-33T>C rs2288327
NM_001267550.2(TTN):c.94553T>C (p.Val31518Ala) rs377016580
NM_001267550.2(TTN):c.94623C>T (p.Tyr31541=) rs376539252
NM_001267550.2(TTN):c.94629A>G (p.Ile31543Met) rs397517759
NM_001267550.2(TTN):c.9472-19del rs201990196
NM_001267550.2(TTN):c.9472-23T>G rs3816782
NM_001267550.2(TTN):c.9472-26del rs140501763
NM_001267550.2(TTN):c.94846C>T (p.Leu31616=) rs72648255
NM_001267550.2(TTN):c.94851T>A (p.Asp31617Glu) rs72648256
NM_001267550.2(TTN):c.94863C>T (p.His31621=) rs373871146
NM_001267550.2(TTN):c.95016T>C (p.Thr31672=) rs367549998
NM_001267550.2(TTN):c.95035G>A (p.Asp31679Asn) rs116567963
NM_001267550.2(TTN):c.95047A>G (p.Ser31683Gly) rs72648257
NM_001267550.2(TTN):c.95078C>A (p.Ala31693Asp) rs2288326
NM_001267550.2(TTN):c.95085G>T (p.Gly31695=) rs746787955
NM_001267550.2(TTN):c.95094C>T (p.Ala31698=) rs373509153
NM_001267550.2(TTN):c.95148C>T (p.Thr31716=) rs140663434
NM_001267550.2(TTN):c.95153G>T (p.Ser31718Ile) rs758006837
NM_001267550.2(TTN):c.95196G>A (p.Pro31732=) rs752309744
NM_001267550.2(TTN):c.9519C>T (p.Asp3173=) rs151129843
NM_001267550.2(TTN):c.95205C>T (p.Asp31735=) rs373182578
NM_001267550.2(TTN):c.95242C>T (p.Arg31748Cys) rs142525903
NM_001267550.2(TTN):c.95244C>T (p.Arg31748=) rs368243641
NM_001267550.2(TTN):c.95259C>T (p.Leu31753=) rs72648258
NM_001267550.2(TTN):c.95270T>C (p.Ile31757Thr) rs72648259
NM_001267550.2(TTN):c.95297C>T (p.Ser31766Phe) rs191484894
NM_001267550.2(TTN):c.95406A>G (p.Arg31802=) rs199652273
NM_001267550.2(TTN):c.95415C>A (p.Phe31805Leu) rs587780983
NM_001267550.2(TTN):c.95553C>T (p.Ser31851=) rs72648260
NM_001267550.2(TTN):c.95555T>C (p.Leu31852Pro) rs62621206
NM_001267550.2(TTN):c.95582A>G (p.Tyr31861Cys) rs59148238
NM_001267550.2(TTN):c.95653G>A (p.Ala31885Thr) rs72648263
NM_001267550.2(TTN):c.95722T>C (p.Tyr31908His) rs199781261
NM_001267550.2(TTN):c.95723-142T>C rs73973126
NM_001267550.2(TTN):c.95824G>A (p.Val31942Ile)
NM_001267550.2(TTN):c.95829A>G (p.Gly31943=) rs572618111
NM_001267550.2(TTN):c.96008T>C (p.Ile32003Thr) rs745962752
NM_001267550.2(TTN):c.96015C>T (p.Pro32005=) rs183620684
NM_001267550.2(TTN):c.96026T>G (p.Ile32009Arg) rs375368824
NM_001267550.2(TTN):c.96030A>G (p.Glu32010=) rs144101806
NM_001267550.2(TTN):c.96108G>A (p.Val32036=) rs372773283
NM_001267550.2(TTN):c.96158T>C (p.Ile32053Thr) rs62621236
NM_001267550.2(TTN):c.96173G>A (p.Arg32058Gln) rs374063064
NM_001267550.2(TTN):c.96180T>C (p.Ile32060=) rs572401798
NM_001267550.2(TTN):c.96234C>T (p.Tyr32078=) rs376532382
NM_001267550.2(TTN):c.96235G>A (p.Asp32079Asn) rs200540781
NM_001267550.2(TTN):c.96252A>G (p.Thr32084=) rs369626133
NM_001267550.2(TTN):c.96501T>C (p.Ser32167=) rs139223781
NM_001267550.2(TTN):c.96684C>T (p.Tyr32228=) rs368423941
NM_001267550.2(TTN):c.96904+4T>C rs373514079
NM_001267550.2(TTN):c.96904+8C>T rs528358945
NM_001267550.2(TTN):c.96918C>T (p.Ile32306=) rs72648266
NM_001267550.2(TTN):c.96944C>T (p.Thr32315Ile) rs56027402
NM_001267550.2(TTN):c.96960T>C (p.Ala32320=) rs141431591
NM_001267550.2(TTN):c.9703+17T>A rs377693857
NM_001267550.2(TTN):c.97192+6G>A rs367760700
NM_001267550.2(TTN):c.97193-16T>G rs371317486
NM_001267550.2(TTN):c.97198C>A (p.Pro32400Thr) rs373876117
NM_001267550.2(TTN):c.97257T>C (p.Ile32419=) rs373206096
NM_001267550.2(TTN):c.97331G>C (p.Arg32444Pro) rs184922462
NM_001267550.2(TTN):c.97386C>T (p.Thr32462=) rs376810671
NM_001267550.2(TTN):c.97418G>A (p.Arg32473His) rs397517770
NM_001267550.2(TTN):c.97435C>A (p.Arg32479Ser) rs200148139
NM_001267550.2(TTN):c.97464T>C (p.Ser32488=) rs571147766
NM_001267550.2(TTN):c.97481G>A (p.Arg32494His) rs371645048
NM_001267550.2(TTN):c.97490T>C (p.Ile32497Thr) rs55660660
NM_001267550.2(TTN):c.97492+263T>C rs114248026
NM_001267550.2(TTN):c.97524A>G (p.Ile32508Met) rs755848026
NM_001267550.2(TTN):c.97538G>A (p.Arg32513His) rs201080904
NM_001267550.2(TTN):c.97578C>T (p.Asp32526=) rs142907833
NM_001267550.2(TTN):c.97613G>A (p.Arg32538His) rs3731749
NM_001267550.2(TTN):c.97717C>T (p.Arg32573Cys) rs569593251
NM_001267550.2(TTN):c.97742G>T (p.Gly32581Val) rs397517771
NM_001267550.2(TTN):c.97760G>A (p.Arg32587His) rs55704830
NM_001267550.2(TTN):c.97760G>C (p.Arg32587Pro) rs55704830
NM_001267550.2(TTN):c.97795+202T>C rs3820978
NM_001267550.2(TTN):c.97795+6G>T rs3731750
NM_001267550.2(TTN):c.97859C>T (p.Ala32620Val) rs397517772
NM_001267550.2(TTN):c.9789C>T (p.Ser3263=) rs138313387
NM_001267550.2(TTN):c.98098+11T>A rs587780984
NM_001267550.2(TTN):c.98098+9T>A rs2288325
NM_001267550.2(TTN):c.98164A>T (p.Ile32722Phe) rs72648270
NM_001267550.2(TTN):c.98242C>T (p.Arg32748Cys) rs72648272
NM_001267550.2(TTN):c.98267C>T (p.Thr32756Ile) rs199805060
NM_001267550.2(TTN):c.98294C>G (p.Ala32765Gly) rs72648273
NM_001267550.2(TTN):c.98367G>A (p.Lys32789=) rs72648274
NM_001267550.2(TTN):c.98389A>G (p.Asn32797Asp) rs786205343
NM_001267550.2(TTN):c.98390A>G (p.Asn32797Ser) rs149001703
NM_001267550.2(TTN):c.98439G>A (p.Val32813=) rs368487246
NM_001267550.2(TTN):c.98499C>T (p.Leu32833=) rs138968178
NM_001267550.2(TTN):c.98556T>C (p.Gly32852=) rs373853269
NM_001267550.2(TTN):c.98595A>G (p.Glu32865=) rs55977045
NM_001267550.2(TTN):c.98605C>T (p.Arg32869Cys) rs186244950
NM_001267550.2(TTN):c.98641C>T (p.Pro32881Ser) rs367979582
NM_001267550.2(TTN):c.98683+7G>C rs141150066
NM_001267550.2(TTN):c.98716G>A (p.Val32906Ile) rs182683829
NM_001267550.2(TTN):c.98721C>A (p.Leu32907=) rs375361462
NM_001267550.2(TTN):c.98892C>T (p.Pro32964=) rs374081262
NM_001267550.2(TTN):c.98912G>A (p.Arg32971His) rs4894028
NM_001267550.2(TTN):c.98959T>C (p.Ser32987Pro) rs758494581
NM_001267550.2(TTN):c.98960C>T (p.Ser32987Phe) rs746380940
NM_001267550.2(TTN):c.98989+12A>C rs72648275
NM_001267550.2(TTN):c.99031T>A (p.Ser33011Thr) rs78814506
NM_001267550.2(TTN):c.99111T>C (p.Tyr33037=) rs77257306
NM_001267550.2(TTN):c.99162G>A (p.Lys33054=) rs368686031
NM_001267550.2(TTN):c.99239G>A (p.Gly33080Glu) rs762905152
NM_001267550.2(TTN):c.99310C>T (p.Arg33104Cys) rs766169253
NM_001267550.2(TTN):c.99345T>G (p.Gly33115=) rs56398525
NM_001267550.2(TTN):c.99810C>T (p.Val33270=) rs564536939
NM_001267550.2(TTN):c.99830G>A (p.Gly33277Glu) rs397517781
NM_001267550.2(TTN):c.99866-10C>T rs773128928
NM_001267550.2(TTN):c.99900C>T (p.Ile33300=) rs747130957
NM_001267550.2(TTN):c.99901G>A (p.Glu33301Lys) rs72648278
NM_001267550.2(TTN):c.99966G>T (p.Trp33322Cys) rs775769503
NM_001267550.2(TTN):c.99969C>T (p.Ile33323=) rs375403439
NM_001267550.2(TTN):c.99991T>C (p.Cys33331Arg) rs56061641
NM_003319.4(TTN):c.13282+39166del rs1553868981
NM_003319.4(TTN):c.19502-5A>G rs182706301
NM_133378.4(TTN):c.19928-7C>T rs771244164
NM_133378.4(TTN):c.28030+5G>A rs145387989
NM_133378.4(TTN):c.32930-9A>G rs373511249
NM_133378.4(TTN):c.93062-10T>C rs202214630
NM_133379.5(TTN):c.-108G>A rs13422986
NM_133379.5(TTN):c.1002C>T (p.Thr334=) rs148094198
NM_133379.5(TTN):c.1003G>A (p.Val335Met) rs72647846
NM_133379.5(TTN):c.10088G>A (p.Arg3363His) rs148169214
NM_133379.5(TTN):c.10100G>A (p.Arg3367Gln) rs34819099
NM_133379.5(TTN):c.10104T>G (p.Val3368=) rs142460433
NM_133379.5(TTN):c.10114+5G>A rs115985443
NM_133379.5(TTN):c.10128G>A (p.Ser3376=) rs755262343
NM_133379.5(TTN):c.10163G>A (p.Arg3388Gln) rs187703540
NM_133379.5(TTN):c.10188A>G (p.Glu3396=) rs183336802
NM_133379.5(TTN):c.10191C>A (p.Asp3397Glu) rs773862320
NM_133379.5(TTN):c.10242C>T (p.Tyr3414=) rs45447891
NM_133379.5(TTN):c.10256G>A (p.Ser3419Asn) rs2291310
NM_133379.5(TTN):c.10303+2208G>A rs72955213
NM_133379.5(TTN):c.10303+2234= rs6433728
NM_133379.5(TTN):c.10303+2358C>T rs57389274
NM_133379.5(TTN):c.10303+2439G>A rs78535378
NM_133379.5(TTN):c.10303+2760G>A rs7585334
NM_133379.5(TTN):c.10360+284G>A rs7590886
NM_133379.5(TTN):c.1050C>T (p.Tyr350=) rs375448572
NM_133379.5(TTN):c.1051G>A (p.Val351Met) rs772889673
NM_133379.5(TTN):c.10646G>A (p.Arg3549His) rs148115514
NM_133379.5(TTN):c.1066G>C (p.Glu356Gln) rs144531477
NM_133379.5(TTN):c.1068G>A (p.Glu356=) rs144716589
NM_133379.5(TTN):c.1079G>C (p.Arg360Thr) rs56128843
NM_133379.5(TTN):c.10917C>T (p.Gly3639=) rs140804168
NM_133379.5(TTN):c.10920T>C (p.Ser3640=) rs142585268
NM_133379.5(TTN):c.11006A>G (p.Asp3669Gly) rs72647896
NM_133379.5(TTN):c.11196G>C (p.Leu3732Phe) rs922985
NM_133379.5(TTN):c.11240A>G (p.Asp3747Gly) rs922984
NM_133379.5(TTN):c.1137A>G (p.Arg379=) rs55972547
NM_133379.5(TTN):c.11741C>G (p.Thr3914Arg) rs116593093
NM_133379.5(TTN):c.12067G>A (p.Gly4023Arg) rs143253411
NM_133379.5(TTN):c.1221G>A (p.Glu407=) rs56349212
NM_133379.5(TTN):c.12226G>A (p.Glu4076Lys) rs144690298
NM_133379.5(TTN):c.1246-16G>A rs72647847
NM_133379.5(TTN):c.1297G>A (p.Val433Ile) rs146000949
NM_133379.5(TTN):c.13165G>A (p.Val4389Ile) rs72648903
NM_133379.5(TTN):c.1333G>A (p.Ala445Thr) rs142414432
NM_133379.5(TTN):c.13478A>C (p.Lys4493Thr) rs78457662
NM_133379.5(TTN):c.13633G>A (p.Ala4545Thr) rs147884688
NM_133379.5(TTN):c.1365G>A (p.Thr455=) rs145211131
NM_133379.5(TTN):c.13859A>C (p.Gln4620Pro) rs139172299
NM_133379.5(TTN):c.13863G>A (p.Met4621Ile) rs77419653
NM_133379.5(TTN):c.13936A>G (p.Lys4646Glu) rs140909116
NM_133379.5(TTN):c.1398+4C>T rs368548209
NM_133379.5(TTN):c.1398+8C>T rs72647848
NM_133379.5(TTN):c.1398+9G>A rs368350210
NM_133379.5(TTN):c.13980C>G (p.His4660Gln) rs75785339
NM_133379.5(TTN):c.14214C>T (p.Thr4738=) rs147513899
NM_133379.5(TTN):c.14327T>C (p.Leu4776Ser) rs142132973
NM_133379.5(TTN):c.14492G>A (p.Cys4831Tyr) rs150615457
NM_133379.5(TTN):c.14616C>T (p.Ser4872=) rs148105798
NM_133379.5(TTN):c.14744G>A (p.Arg4915His) rs72648907
NM_133379.5(TTN):c.1492G>A (p.Val498Ile) rs72647851
NM_133379.5(TTN):c.1537-4G>A rs56006378
NM_133379.5(TTN):c.15416G>T (p.Arg5139Met) rs66677602
NM_133379.5(TTN):c.156C>T (p.Pro52=) rs72647842
NM_133379.5(TTN):c.16001C>T (p.Pro5334Leu) rs151253841
NM_133379.5(TTN):c.16432G>A (p.Val5478Met) rs72648915
NM_133379.5(TTN):c.1662+317C>T rs10184892
NM_133379.5(TTN):c.1709C>T (p.Ala570Val) rs146690035
NM_133379.5(TTN):c.1743G>A (p.Pro581=) rs138560523
NM_133379.5(TTN):c.1776T>C (p.Asp592=) rs147081804
NM_133379.5(TTN):c.178G>T (p.Asp60Tyr) rs35683768
NM_133379.5(TTN):c.185G>A (p.Arg62His) rs758169489
NM_133379.5(TTN):c.1938+10G>C rs190935632
NM_133379.5(TTN):c.2226C>A (p.Ser742=) rs151025677
NM_133379.5(TTN):c.2230G>A (p.Ala744Thr) rs144639994
NM_133379.5(TTN):c.2244G>A (p.Glu748=) rs6715406
NM_133379.5(TTN):c.2270C>T (p.Pro757Leu) rs116307796
NM_133379.5(TTN):c.227G>C (p.Gly76Ala) rs138750421
NM_133379.5(TTN):c.2358C>G (p.His786Gln) rs199507913
NM_133379.5(TTN):c.2386G>A (p.Asp796Asn) rs766935265
NM_133379.5(TTN):c.2432C>T (p.Thr811Ile) rs35813871
NM_133379.5(TTN):c.2494-271C>T rs6729746
NM_133379.5(TTN):c.2504C>A (p.Ala835Asp) rs200572298
NM_133379.5(TTN):c.266C>G (p.Ala89Gly) rs200165636
NM_133379.5(TTN):c.2765G>A (p.Arg922His) rs56046320
NM_133379.5(TTN):c.2775+4G>A rs548681281
NM_133379.5(TTN):c.2776-14T>C rs201611946
NM_133379.5(TTN):c.2781A>C (p.Thr927=) rs55892860
NM_133379.5(TTN):c.2949C>T (p.Ile983=) rs56310516
NM_133379.5(TTN):c.296-14T>C rs199951296
NM_133379.5(TTN):c.3087T>C (p.Tyr1029=) rs55863869
NM_133379.5(TTN):c.3100G>A (p.Val1034Met) rs142951505
NM_133379.5(TTN):c.3132C>T (p.Ala1044=) rs777315600
NM_133379.5(TTN):c.3241G>A (p.Ala1081Thr) rs55914517
NM_133379.5(TTN):c.3241G>T (p.Ala1081Ser) rs55914517
NM_133379.5(TTN):c.3318C>T (p.Gly1106=) rs141768043
NM_133379.5(TTN):c.3386A>G (p.Lys1129Arg) rs181375012
NM_133379.5(TTN):c.33G>A (p.Pro11=) rs138331646
NM_133379.5(TTN):c.3409G>C (p.Gly1137Arg) rs72647870
NM_133379.5(TTN):c.3522A>C (p.Glu1174Asp) rs545280886
NM_133379.5(TTN):c.3523+271G>A rs2054708
NM_133379.5(TTN):c.3601A>G (p.Lys1201Glu) rs10497520
NM_133379.5(TTN):c.3605T>C (p.Val1202Ala) rs150667217
NM_133379.5(TTN):c.3668C>T (p.Ala1223Val) rs78269740
NM_133379.5(TTN):c.416G>A (p.Arg139Gln) rs780003580
NM_133379.5(TTN):c.426C>T (p.Ala142=) rs56137037
NM_133379.5(TTN):c.43G>A (p.Val15Ile) rs201857541
NM_133379.5(TTN):c.5001T>C (p.Tyr1667=) rs540957547
NM_133379.5(TTN):c.5231C>T (p.Pro1744Leu) rs75686037
NM_133379.5(TTN):c.542G>A (p.Ser181Asn) rs72647843
NM_133379.5(TTN):c.5479G>T (p.Ala1827Ser) rs141213991
NM_133379.5(TTN):c.5668C>T (p.Arg1890Cys) rs146496197
NM_133379.5(TTN):c.5697C>T (p.Ile1899=) rs148434577
NM_133379.5(TTN):c.5823A>G (p.Arg1941=) rs149668487
NM_133379.5(TTN):c.5875T>A (p.Phe1959Ile) rs562856820
NM_133379.5(TTN):c.5993G>A (p.Arg1998His) rs144135510
NM_133379.5(TTN):c.6162C>T (p.Ala2054=) rs143265948
NM_133379.5(TTN):c.6353T>C (p.Ile2118Thr) rs56404770
NM_133379.5(TTN):c.6359G>A (p.Arg2120Gln) rs141142920
NM_133379.5(TTN):c.6359G>T (p.Arg2120Leu) rs141142920
NM_133379.5(TTN):c.6508+15T>C rs747722195
NM_133379.5(TTN):c.6517T>G (p.Leu2173Val) rs760798049
NM_133379.5(TTN):c.6584A>G (p.Glu2195Gly) rs202032875
NM_133379.5(TTN):c.6727G>T (p.Asp2243Tyr) rs138787974
NM_133379.5(TTN):c.6790+12C>T rs200187117
NM_133379.5(TTN):c.687T>C (p.Phe229=) rs376527094
NM_133379.5(TTN):c.6958C>T (p.Arg2320Cys) rs776478343
NM_133379.5(TTN):c.7061G>A (p.Arg2354His) rs75031300
NM_133379.5(TTN):c.7174G>A (p.Gly2392Ser) rs4894048
NM_133379.5(TTN):c.7523A>G (p.His2508Arg) rs146970027
NM_133379.5(TTN):c.7524T>C (p.His2508=) rs2291307
NM_133379.5(TTN):c.7545C>T (p.Tyr2515=) rs2291306
NM_133379.5(TTN):c.7619G>A (p.Arg2540His) rs397517725
NM_133379.5(TTN):c.7740T>G (p.Ile2580Met) rs146590898
NM_133379.5(TTN):c.7830G>C (p.Met2610Ile) rs56142888
NM_133379.5(TTN):c.7891G>A (p.Val2631Ile) rs766753906
NM_133379.5(TTN):c.7961G>A (p.Arg2654Lys) rs147207100
NM_133379.5(TTN):c.8069C>T (p.Thr2690Ile) rs374620001
NM_133379.5(TTN):c.8314G>A (p.Val2772Met) rs143035953
NM_133379.5(TTN):c.8467G>T (p.Val2823Phe) rs33917087
NM_133379.5(TTN):c.8492G>A (p.Ser2831Asn) rs2306636
NM_133379.5(TTN):c.8589A>G (p.Glu2863=) rs72647883
NM_133379.5(TTN):c.864C>T (p.His288=) rs772543040
NM_133379.5(TTN):c.8887A>C (p.Thr2963Pro) rs200875815
NM_133379.5(TTN):c.8902+14T>A rs13388274
NM_133379.5(TTN):c.8919C>G (p.Ser2973=) rs4894045
NM_133379.5(TTN):c.8938G>A (p.Ala2980Thr) rs72647885
NM_133379.5(TTN):c.8991C>A (p.Ile2997=)
NM_133379.5(TTN):c.9077A>T (p.Asn3026Ile) rs11900987
NM_133379.5(TTN):c.9195G>A (p.Lys3065=) rs780650145
NM_133379.5(TTN):c.9290T>C (p.Leu3097Pro) rs373366126
NM_133379.5(TTN):c.9338G>A (p.Arg3113His) rs141258018
NM_133379.5(TTN):c.9348C>G (p.Ile3116Met) rs760230943
NM_133379.5(TTN):c.9359G>A (p.Arg3120Gln) rs72647894
NM_133379.5(TTN):c.9461A>G (p.Lys3154Arg) rs4893853
NM_133379.5(TTN):c.9485A>G (p.Gln3162Arg) rs727503681
NM_133379.5(TTN):c.9512A>G (p.Asn3171Ser) rs139992576
NM_133379.5(TTN):c.9597A>G (p.Glu3199=) rs2291312
NM_133379.5(TTN):c.970C>T (p.Pro324Ser) rs72647845
NM_133379.5(TTN):c.9781G>A (p.Val3261Met) rs2291311
NM_133379.5(TTN):c.9827A>G (p.Glu3276Gly) rs377049518
NM_133379.5(TTN):c.982C>T (p.Arg328Cys) rs16866538
NM_133379.5(TTN):c.9879A>G (p.Glu3293=) rs4894043
NM_133379.5(TTN):c.9918G>A (p.Ala3306=) rs533798702

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.