ClinVar Miner

List of variants in gene TTN reported as likely benign

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 4124
Download table as spreadsheet
HGVS dbSNP
NC_000002.12:g.178584654del
NC_000002.12:g.178644816_178644819del
NC_000002.12:g.178652190_178652192del
NC_000002.12:g.178680243del
NC_000002.12:g.178689900dup
NC_000002.12:g.178700829_178700831del
NC_000002.12:g.178782191_178782192del
NM_001256850.1(TTN):c.13984+9C>T rs544241749
NM_001256850.1(TTN):c.15671-9C>T rs752362183
NM_001256850.1(TTN):c.16232-9T>C rs141687561
NM_001256850.1(TTN):c.18197-4A>G rs1025136671
NM_001256850.1(TTN):c.21578-7C>A rs769076842
NM_001256850.1(TTN):c.22427-10C>A rs72648975
NM_001256850.1(TTN):c.22709-7C>T rs771244164
NM_001256850.1(TTN):c.29273-7T>G rs778458915
NM_001256850.1(TTN):c.31360+9T>C rs573677447
NM_001256850.1(TTN):c.31604-6T>C rs375742678
NM_001256850.1(TTN):c.32222-4G>A rs727504440
NM_001256850.1(TTN):c.32876-8C>T rs371318311
NM_001256850.1(TTN):c.33586+8C>A rs762808097
NM_001256850.1(TTN):c.33664+8A>G rs775606653
NM_001256850.1(TTN):c.34106-9T>A rs537626868
NM_001256850.1(TTN):c.34523-784T>C rs200819643
NM_001256850.1(TTN):c.35188+9G>C rs765647346
NM_001256850.1(TTN):c.35189-4A>G rs781589169
NM_001256850.1(TTN):c.35711-10T>A rs375097334
NM_001256850.1(TTN):c.36407-7T>A rs373636988
NM_001256850.1(TTN):c.39359-6G>A rs372166634
NM_001256850.1(TTN):c.45935-9A>C rs146208555
NM_001256850.1(TTN):c.48079+10G>A rs370352450
NM_001256850.1(TTN):c.52340-4C>T rs373552048
NM_001256850.1(TTN):c.54704-10C>T rs775224600
NM_001256850.1(TTN):c.60050-4C>G rs369934310
NM_001256850.1(TTN):c.60353-8T>C rs377484398
NM_001256850.1(TTN):c.60652+10T>C rs72646864
NM_001256850.1(TTN):c.64489+10G>C rs72646883
NM_001256850.1(TTN):c.83383+8T>C rs369690199
NM_001256850.1(TTN):c.92873-10T>C rs1553512260
NM_001256850.1(TTN):c.93175+3G>A rs556524594
NM_001256850.1(TTN):c.94943-10C>T rs773128928
NM_001267550.1(TTN):c.45599C>G rs201057307
NM_001267550.1(TTN):c.83315A>T rs578191491
NM_001267550.2(TTN):c.*664G>T rs72629796
NM_001267550.2(TTN):c.*6C>A rs188728343
NM_001267550.2(TTN):c.*99dup rs11424072
NM_001267550.2(TTN):c.-108G>A rs13422986
NM_001267550.2(TTN):c.100044G>A (p.Val33348=) rs56080118
NM_001267550.2(TTN):c.100047A>C (p.Thr33349=) rs727504698
NM_001267550.2(TTN):c.100049C>T (p.Thr33350Ile) rs370300135
NM_001267550.2(TTN):c.100050C>A (p.Thr33350=) rs760990381
NM_001267550.2(TTN):c.100093C>T (p.Arg33365Trp) rs543226487
NM_001267550.2(TTN):c.100094G>A (p.Arg33365Gln) rs55742743
NM_001267550.2(TTN):c.100096G>A (p.Val33366Ile) rs55675869
NM_001267550.2(TTN):c.100116C>T (p.Phe33372=) rs770089807
NM_001267550.2(TTN):c.100172-17dup rs397517782
NM_001267550.2(TTN):c.1001C>A (p.Thr334Asn) rs1042860959
NM_001267550.2(TTN):c.100226G>A (p.Cys33409Tyr) rs201112096
NM_001267550.2(TTN):c.100245A>C (p.Pro33415=) rs777803018
NM_001267550.2(TTN):c.10024G>A (p.Val3342Ile) rs727503679
NM_001267550.2(TTN):c.100257T>C (p.Asp33419=) rs727505046
NM_001267550.2(TTN):c.100281C>T (p.Tyr33427=) rs373085562
NM_001267550.2(TTN):c.1002C>T (p.Thr334=) rs148094198
NM_001267550.2(TTN):c.10032A>C (p.Pro3344=) rs757321139
NM_001267550.2(TTN):c.100389C>T (p.Tyr33463=) rs368984050
NM_001267550.2(TTN):c.1003G>A (p.Val335Met) rs72647846
NM_001267550.2(TTN):c.10044C>T (p.Ile3348=) rs1553983924
NM_001267550.2(TTN):c.100459C>T (p.Pro33487Ser) rs72629779
NM_001267550.2(TTN):c.10049C>T (p.Pro3350Leu) rs139504522
NM_001267550.2(TTN):c.10050G>A (p.Pro3350=) rs759936737
NM_001267550.2(TTN):c.100578C>T (p.Ile33526=) rs764709619
NM_001267550.2(TTN):c.100579G>A (p.Val33527Ile) rs2278196
NM_001267550.2(TTN):c.100653C>A (p.Gly33551=) rs727505326
NM_001267550.2(TTN):c.10065C>T (p.Val3355=) rs766884321
NM_001267550.2(TTN):c.100696A>G (p.Thr33566Ala) rs878854282
NM_001267550.2(TTN):c.100766-10_100766-9insTC rs779410830
NM_001267550.2(TTN):c.100766-10dupT rs749872538
NM_001267550.2(TTN):c.100766-11_100766-10delinsCC rs1060503962
NM_001267550.2(TTN):c.100766-9C>T rs77483833
NM_001267550.2(TTN):c.10088G>A (p.Arg3363His) rs148169214
NM_001267550.2(TTN):c.100935T>C (p.Ile33645=) rs763249842
NM_001267550.2(TTN):c.100982G>A (p.Arg33661Lys) rs201857158
NM_001267550.2(TTN):c.101037G>A (p.Gln33679=) rs377190399
NM_001267550.2(TTN):c.10104T>G (p.Val3368=) rs142460433
NM_001267550.2(TTN):c.101055T>C (p.Asp33685=) rs372788551
NM_001267550.2(TTN):c.101136G>A (p.Glu33712=) rs1060503937
NM_001267550.2(TTN):c.10114+14C>T rs876657598
NM_001267550.2(TTN):c.10115-17T>G rs932815761
NM_001267550.2(TTN):c.1011A>G (p.Thr337=) rs758427242
NM_001267550.2(TTN):c.101212C>T (p.Arg33738Cys) rs56273463
NM_001267550.2(TTN):c.101214T>C (p.Arg33738=) rs876657617
NM_001267550.2(TTN):c.101214T>G (p.Arg33738=) rs876657617
NM_001267550.2(TTN):c.101245G>A (p.Val33749Met) rs201554140
NM_001267550.2(TTN):c.101262A>G (p.Gly33754=) rs374878689
NM_001267550.2(TTN):c.10128G>A (p.Ser3376=) rs755262343
NM_001267550.2(TTN):c.101291C>T (p.Ala33764Val) rs773542514
NM_001267550.2(TTN):c.101376T>C (p.Tyr33792=) rs367732133
NM_001267550.2(TTN):c.101391T>C (p.Asp33797=) rs374228740
NM_001267550.2(TTN):c.101406C>G (p.Val33802=) rs55802460
NM_001267550.2(TTN):c.101409C>T (p.Ser33803=) rs1387260088
NM_001267550.2(TTN):c.101480G>A (p.Arg33827His) rs376403708
NM_001267550.2(TTN):c.101546T>C (p.Phe33849Ser) rs1434361992
NM_001267550.2(TTN):c.101565T>G (p.Thr33855=) rs1553498268
NM_001267550.2(TTN):c.101580A>G (p.Val33860=) rs1060503929
NM_001267550.2(TTN):c.10162C>T (p.Arg3388Trp)
NM_001267550.2(TTN):c.101637T>C (p.His33879=) rs373461875
NM_001267550.2(TTN):c.101665G>A (p.Val33889Ile) rs34924609
NM_001267550.2(TTN):c.101684T>C (p.Ile33895Thr)
NM_001267550.2(TTN):c.101692C>T (p.Leu33898Phe) rs371930491
NM_001267550.2(TTN):c.101708G>A (p.Arg33903His) rs72629782
NM_001267550.2(TTN):c.101728G>A (p.Glu33910Lys)
NM_001267550.2(TTN):c.101766G>C (p.Gln33922His) rs55886356
NM_001267550.2(TTN):c.101803A>G (p.Ile33935Val) rs56376197
NM_001267550.2(TTN):c.10188A>G (p.Glu3396=) rs183336802
NM_001267550.2(TTN):c.101890C>A (p.Arg33964Ser) rs779064623
NM_001267550.2(TTN):c.101891G>A (p.Arg33964His) rs55669553
NM_001267550.2(TTN):c.101925A>G (p.Leu33975=) rs201246720
NM_001267550.2(TTN):c.101936C>G (p.Pro33979Arg) rs200238877
NM_001267550.2(TTN):c.102024A>G (p.Leu34008=) rs727504677
NM_001267550.2(TTN):c.102064C>G (p.Gln34022Glu)
NM_001267550.2(TTN):c.102102C>T (p.Phe34034=) rs377354934
NM_001267550.2(TTN):c.102103G>A (p.Asp34035Asn) rs144963736
NM_001267550.2(TTN):c.102156G>T (p.Arg34052=) rs376894729
NM_001267550.2(TTN):c.102183C>T (p.Arg34061=) rs727504536
NM_001267550.2(TTN):c.102190G>A (p.Ala34064Thr) rs200237973
NM_001267550.2(TTN):c.102217T>C (p.Leu34073=)
NM_001267550.2(TTN):c.102270C>T (p.His34090=) rs786205330
NM_001267550.2(TTN):c.102271C>T (p.Arg34091Trp) rs140319117
NM_001267550.2(TTN):c.102293T>A (p.Ile34098Asn)
NM_001267550.2(TTN):c.102363G>A (p.Lys34121=) rs758224214
NM_001267550.2(TTN):c.102399T>C (p.Ile34133=) rs1271132251
NM_001267550.2(TTN):c.1023G>T (p.Val341=) rs1060503956
NM_001267550.2(TTN):c.10242C>T (p.Tyr3414=) rs45447891
NM_001267550.2(TTN):c.10244C>T (p.Thr3415Met) rs761799688
NM_001267550.2(TTN):c.102519C>T (p.Gly34173=) rs2857265
NM_001267550.2(TTN):c.102520G>A (p.Val34174Ile) rs200430493
NM_001267550.2(TTN):c.102549C>T (p.Tyr34183=) rs761394437
NM_001267550.2(TTN):c.102561C>T (p.Tyr34187=) rs375625664
NM_001267550.2(TTN):c.102562G>A (p.Glu34188Lys) rs577667352
NM_001267550.2(TTN):c.10256G>A (p.Ser3419Asn) rs2291310
NM_001267550.2(TTN):c.102573G>A (p.Val34191=) rs151209395
NM_001267550.2(TTN):c.102595A>G (p.Ile34199Val) rs56347248
NM_001267550.2(TTN):c.102603A>G (p.Lys34201=) rs1414951574
NM_001267550.2(TTN):c.102609T>C (p.Asp34203=) rs879218563
NM_001267550.2(TTN):c.102621C>T (p.Tyr34207=) rs1553494225
NM_001267550.2(TTN):c.102657T>A (p.Ser34219Arg) rs370077023
NM_001267550.2(TTN):c.102688A>C (p.Arg34230=) rs745836095
NM_001267550.2(TTN):c.102696C>T (p.Val34232=) rs202180775
NM_001267550.2(TTN):c.102711C>T (p.Cys34237=) rs568801205
NM_001267550.2(TTN):c.102737G>A (p.Arg34246His) rs372716177
NM_001267550.2(TTN):c.102750A>G (p.Thr34250=) rs786205322
NM_001267550.2(TTN):c.102751A>G (p.Met34251Val) rs56173891
NM_001267550.2(TTN):c.102833G>T (p.Gly34278Val) rs3731752
NM_001267550.2(TTN):c.102846T>A (p.Thr34282=) rs876657618
NM_001267550.2(TTN):c.102877A>G (p.Lys34293Glu) rs72629783
NM_001267550.2(TTN):c.102882A>G (p.Ser34294=) rs373384005
NM_001267550.2(TTN):c.102885T>C (p.Gly34295=) rs886039175
NM_001267550.2(TTN):c.10288A>C (p.Asn3430His) rs376029089
NM_001267550.2(TTN):c.102963C>T (p.Asn34321=) rs528502993
NM_001267550.2(TTN):c.102965G>A (p.Ser34322Asn) rs763242057
NM_001267550.2(TTN):c.102966T>C (p.Ser34322=) rs200172231
NM_001267550.2(TTN):c.102984C>T (p.Asp34328=) rs541125667
NM_001267550.2(TTN):c.10304-207G>A
NM_001267550.2(TTN):c.103104A>G (p.Leu34368=) rs371535721
NM_001267550.2(TTN):c.103207C>T (p.Leu34403=) rs773892755
NM_001267550.2(TTN):c.103215C>T (p.Leu34405=) rs748516187
NM_001267550.2(TTN):c.103236C>T (p.Ile34412=) rs745465328
NM_001267550.2(TTN):c.103263G>A (p.Leu34421=) rs1057521288
NM_001267550.2(TTN):c.103267A>G (p.Ile34423Val)
NM_001267550.2(TTN):c.103292C>T (p.Thr34431Met) rs192001910
NM_001267550.2(TTN):c.103302T>C (p.Tyr34434=) rs773408387
NM_001267550.2(TTN):c.103363C>T (p.Arg34455Cys) rs72629785
NM_001267550.2(TTN):c.103365C>T (p.Arg34455=) rs398124462
NM_001267550.2(TTN):c.103412G>A (p.Arg34471Gln) rs149391616
NM_001267550.2(TTN):c.103417G>A (p.Val34473Ile) rs188917199
NM_001267550.2(TTN):c.103440C>T (p.Thr34480=) rs781237159
NM_001267550.2(TTN):c.103464T>G (p.Ser34488=) rs960287076
NM_001267550.2(TTN):c.103514A>T (p.Glu34505Val) rs761105256
NM_001267550.2(TTN):c.103524C>T (p.Val34508=) rs587780985
NM_001267550.2(TTN):c.103576G>C (p.Glu34526Gln) rs770742837
NM_001267550.2(TTN):c.103578G>A (p.Glu34526=) rs1478505603
NM_001267550.2(TTN):c.103580T>C (p.Ile34527Thr) rs370618537
NM_001267550.2(TTN):c.103632G>A (p.Glu34544=) rs1285886003
NM_001267550.2(TTN):c.103686C>T (p.Phe34562=) rs777864853
NM_001267550.2(TTN):c.103688T>C (p.Val34563Ala) rs55945684
NM_001267550.2(TTN):c.103713T>C (p.Tyr34571=) rs1057523313
NM_001267550.2(TTN):c.103756A>C (p.Arg34586=) rs1012679574
NM_001267550.2(TTN):c.103772G>A (p.Arg34591Gln) rs778021095
NM_001267550.2(TTN):c.103781G>A (p.Arg34594His) rs3829747
NM_001267550.2(TTN):c.10378C>G (p.Pro3460Ala) rs201735487
NM_001267550.2(TTN):c.103913G>A (p.Arg34638His) rs371528685
NM_001267550.2(TTN):c.103914T>C (p.Arg34638=)
NM_001267550.2(TTN):c.103968G>C (p.Gly34656=) rs1057523617
NM_001267550.2(TTN):c.103974C>T (p.Ile34658=) rs199714102
NM_001267550.2(TTN):c.104049T>C (p.Leu34683=) rs1553489508
NM_001267550.2(TTN):c.104093G>A (p.Arg34698Gln) rs757940030
NM_001267550.2(TTN):c.104106C>G (p.His34702Gln) rs1168028409
NM_001267550.2(TTN):c.104202A>G (p.Pro34734=) rs777542393
NM_001267550.2(TTN):c.104229T>C (p.Tyr34743=) rs762295035
NM_001267550.2(TTN):c.104251G>C (p.Ala34751Pro) rs185683410
NM_001267550.2(TTN):c.104261C>T (p.Ala34754Val) rs727505020
NM_001267550.2(TTN):c.104277G>A (p.Lys34759=) rs377391143
NM_001267550.2(TTN):c.104298T>C (p.Ala34766=) rs751788327
NM_001267550.2(TTN):c.104328A>C (p.Pro34776=)
NM_001267550.2(TTN):c.104333C>A (p.Thr34778Lys) rs762158917
NM_001267550.2(TTN):c.104334G>A (p.Thr34778=) rs550108694
NM_001267550.2(TTN):c.10434C>T (p.Asn3478=) rs749590376
NM_001267550.2(TTN):c.104364C>T (p.Ser34788=) rs181679744
NM_001267550.2(TTN):c.104365G>A (p.Glu34789Lys) rs190565627
NM_001267550.2(TTN):c.104377A>C (p.Met34793Leu) rs72629787
NM_001267550.2(TTN):c.104385G>A (p.Lys34795=) rs397517790
NM_001267550.2(TTN):c.104414G>A (p.Arg34805Gln) rs115150240
NM_001267550.2(TTN):c.104449G>A (p.Glu34817Lys) rs1553488312
NM_001267550.2(TTN):c.104516G>A (p.Arg34839Gln)
NM_001267550.2(TTN):c.104541T>C (p.Tyr34847=) rs750079478
NM_001267550.2(TTN):c.104560G>C (p.Val34854Leu) rs55866005
NM_001267550.2(TTN):c.104576G>A (p.Arg34859Gln) rs68080670
NM_001267550.2(TTN):c.104581C>T (p.Arg34861Cys) rs398124463
NM_001267550.2(TTN):c.10458G>A (p.Ala3486=) rs759465333
NM_001267550.2(TTN):c.104592G>A (p.Pro34864=) rs144094650
NM_001267550.2(TTN):c.104592G>T (p.Pro34864=) rs144094650
NM_001267550.2(TTN):c.104605G>A (p.Glu34869Lys) rs563430855
NM_001267550.2(TTN):c.104640G>A (p.Glu34880=) rs373134178
NM_001267550.2(TTN):c.104691G>A (p.Ser34897=) rs369619711
NM_001267550.2(TTN):c.104769A>C (p.Thr34923=) rs56375087
NM_001267550.2(TTN):c.104774A>C (p.Glu34925Ala) rs201218828
NM_001267550.2(TTN):c.104812C>T (p.Leu34938=) rs755726554
NM_001267550.2(TTN):c.104901T>G (p.Ser34967=) rs367610925
NM_001267550.2(TTN):c.104936G>C (p.Gly34979Ala) rs376634193
NM_001267550.2(TTN):c.104943A>G (p.Glu34981=) rs372312805
NM_001267550.2(TTN):c.104978C>T (p.Thr34993Met) rs368945564
NM_001267550.2(TTN):c.104985A>G (p.Gly34995=) rs397517793
NM_001267550.2(TTN):c.104988C>T (p.Val34996=) rs3829748
NM_001267550.2(TTN):c.104995C>T (p.Leu34999=) rs727503532
NM_001267550.2(TTN):c.105006G>A (p.Leu35002=) rs1320843432
NM_001267550.2(TTN):c.105045G>A (p.Val35015=) rs1469317465
NM_001267550.2(TTN):c.105090C>T (p.Asp35030=) rs72629789
NM_001267550.2(TTN):c.1050C>T (p.Tyr350=) rs375448572
NM_001267550.2(TTN):c.105127C>T (p.Arg35043Cys) rs200378865
NM_001267550.2(TTN):c.105180G>C (p.Glu35060Asp) rs56308529
NM_001267550.2(TTN):c.105180G>T (p.Glu35060Asp) rs56308529
NM_001267550.2(TTN):c.105183G>A (p.Ala35061=) rs371075036
NM_001267550.2(TTN):c.105210A>G (p.Thr35070=) rs1553486016
NM_001267550.2(TTN):c.105212C>G (p.Ser35071Cys) rs3813249
NM_001267550.2(TTN):c.105225T>G (p.Ala35075=) rs769757318
NM_001267550.2(TTN):c.105228G>A (p.Ser35076=) rs55938627
NM_001267550.2(TTN):c.105336G>A (p.Lys35112=) rs546048021
NM_001267550.2(TTN):c.105339A>G (p.Ser35113=) rs886038721
NM_001267550.2(TTN):c.105375G>A (p.Thr35125=) rs780294413
NM_001267550.2(TTN):c.10537T>C (p.Phe3513Leu) rs771751290
NM_001267550.2(TTN):c.105383C>T (p.Ala35128Val) rs758458467
NM_001267550.2(TTN):c.105384A>G (p.Ala35128=) rs3813250
NM_001267550.2(TTN):c.105404C>T (p.Pro35135Leu)
NM_001267550.2(TTN):c.105406C>T (p.Arg35136Trp) rs372875128
NM_001267550.2(TTN):c.105412A>G (p.Met35138Val) rs368992068
NM_001267550.2(TTN):c.105413T>C (p.Met35138Thr) rs771741670
NM_001267550.2(TTN):c.105424G>A (p.Glu35142Lys)
NM_001267550.2(TTN):c.105468G>A (p.Pro35156=) rs55806007
NM_001267550.2(TTN):c.105512C>T (p.Thr35171Ile) rs774524898
NM_001267550.2(TTN):c.105514_105516del (p.Ser35172del) rs573843615
NM_001267550.2(TTN):c.105529G>A (p.Val35177Met) rs55865284
NM_001267550.2(TTN):c.105531G>A (p.Val35177=) rs727505323
NM_001267550.2(TTN):c.105582C>T (p.Ser35194=) rs3829749
NM_001267550.2(TTN):c.105653T>C (p.Ile35218Thr) rs143499441
NM_001267550.2(TTN):c.105719G>A (p.Arg35240Gln) rs530537991
NM_001267550.2(TTN):c.105737C>G (p.Ala35246Gly) rs370476812
NM_001267550.2(TTN):c.105769G>A (p.Glu35257Lys) rs56324595
NM_001267550.2(TTN):c.105780C>T (p.His35260=) rs373486593
NM_001267550.2(TTN):c.105782C>T (p.Pro35261Leu) rs16866380
NM_001267550.2(TTN):c.105787G>T (p.Ala35263Ser) rs67254537
NM_001267550.2(TTN):c.105787_105788delinsTT (p.Ala35263Phe) rs794729250
NM_001267550.2(TTN):c.105788C>T (p.Ala35263Val) rs66961115
NM_001267550.2(TTN):c.105790G>A (p.Val35264Ile) rs770730954
NM_001267550.2(TTN):c.105843A>T (p.Pro35281=) rs876657619
NM_001267550.2(TTN):c.105876G>A (p.Leu35292=) rs372521529
NM_001267550.2(TTN):c.105920T>C (p.Val35307Ala) rs780629996
NM_001267550.2(TTN):c.106020T>C (p.Gly35340=) rs148865574
NM_001267550.2(TTN):c.106087G>C (p.Gly35363Arg)
NM_001267550.2(TTN):c.106120T>A (p.Phe35374Ile) rs786205291
NM_001267550.2(TTN):c.106121T>A (p.Phe35374Tyr) rs727504609
NM_001267550.2(TTN):c.106127G>C (p.Gly35376Ala) rs752758517
NM_001267550.2(TTN):c.106133C>T (p.Ala35378Val) rs555476312
NM_001267550.2(TTN):c.106143T>C (p.Ser35381=) rs961119478
NM_001267550.2(TTN):c.106188T>C (p.Asp35396=) rs770681247
NM_001267550.2(TTN):c.106215C>T (p.Thr35405=) rs886038793
NM_001267550.2(TTN):c.106275G>C (p.Gly35425=) rs56207956
NM_001267550.2(TTN):c.106343G>A (p.Arg35448Gln) rs369703073
NM_001267550.2(TTN):c.106423T>A (p.Phe35475Ile) rs377463445
NM_001267550.2(TTN):c.106442A>G (p.Lys35481Arg) rs200716018
NM_001267550.2(TTN):c.106468T>C (p.Tyr35490His) rs199663911
NM_001267550.2(TTN):c.106476T>C (p.Cys35492=) rs6725673
NM_001267550.2(TTN):c.106482A>G (p.Val35494=) rs766024055
NM_001267550.2(TTN):c.106532-19del
NM_001267550.2(TTN):c.106532-266C>T
NM_001267550.2(TTN):c.106578T>A (p.Ser35526=) rs55838839
NM_001267550.2(TTN):c.106580A>T (p.Glu35527Val) rs55725279
NM_001267550.2(TTN):c.10659A>G (p.Thr3553=) rs748958021
NM_001267550.2(TTN):c.106619T>C (p.Ile35540Thr) rs55880440
NM_001267550.2(TTN):c.106675G>C (p.Glu35559Gln) rs199632397
NM_001267550.2(TTN):c.106787C>T (p.Thr35596Ile) rs55842557
NM_001267550.2(TTN):c.106788A>T (p.Thr35596=) rs369896045
NM_001267550.2(TTN):c.106820C>T (p.Ala35607Val) rs377337528
NM_001267550.2(TTN):c.106827T>G (p.Ile35609Met) rs727504540
NM_001267550.2(TTN):c.1068G>A (p.Glu356=) rs144716589
NM_001267550.2(TTN):c.106902T>G (p.Thr35634=) rs1236739074
NM_001267550.2(TTN):c.106911A>G (p.Lys35637=) rs767045071
NM_001267550.2(TTN):c.106920G>A (p.Leu35640=) rs183923129
NM_001267550.2(TTN):c.106955G>A (p.Arg35652Gln) rs200497615
NM_001267550.2(TTN):c.106974C>T (p.Ser35658=) rs761795663
NM_001267550.2(TTN):c.107049A>G (p.Glu35683=) rs1390069717
NM_001267550.2(TTN):c.107058C>T (p.Val35686=) rs767818722
NM_001267550.2(TTN):c.107061G>A (p.Lys35687=) rs113190638
NM_001267550.2(TTN):c.107080C>G (p.Leu35694Val) rs769369764
NM_001267550.2(TTN):c.107082G>A (p.Leu35694=) rs727505278
NM_001267550.2(TTN):c.107089G>C (p.Glu35697Gln) rs199531140
NM_001267550.2(TTN):c.107092C>T (p.Leu35698Phe) rs1435670489
NM_001267550.2(TTN):c.107097A>C (p.Ser35699=) rs771821464
NM_001267550.2(TTN):c.107134A>C (p.Asn35712His) rs727504949
NM_001267550.2(TTN):c.107157T>C (p.Val35719=) rs1553479771
NM_001267550.2(TTN):c.107161T>C (p.Phe35721Leu) rs794729251
NM_001267550.2(TTN):c.107230A>G (p.Ile35744Val) rs142336788
NM_001267550.2(TTN):c.107267T>C (p.Val35756Ala) rs16866378
NM_001267550.2(TTN):c.10726A>G (p.Thr3576Ala) rs6433728
NM_001267550.2(TTN):c.107289T>C (p.Asn35763=)
NM_001267550.2(TTN):c.107301C>A (p.Ser35767Arg) rs1558965303
NM_001267550.2(TTN):c.107319A>C (p.Thr35773=) rs1553479126
NM_001267550.2(TTN):c.107364C>T (p.Ser35788=) rs1057521273
NM_001267550.2(TTN):c.107377+14C>T rs367908657
NM_001267550.2(TTN):c.107393C>T (p.Pro35798Leu) rs886038722
NM_001267550.2(TTN):c.107397C>T (p.Ser35799=) rs371480338
NM_001267550.2(TTN):c.107559C>G (p.Ala35853=) rs1060503952
NM_001267550.2(TTN):c.107576T>C (p.Met35859Thr) rs72629793
NM_001267550.2(TTN):c.107591T>C (p.Val35864Ala) rs374859388
NM_001267550.2(TTN):c.107593G>A (p.Glu35865Lys) rs372841288
NM_001267550.2(TTN):c.107605A>G (p.Ser35869Gly) rs201835888
NM_001267550.2(TTN):c.107634A>G (p.Thr35878=) rs878854285
NM_001267550.2(TTN):c.107647T>G (p.Ser35883Ala) rs1553477432
NM_001267550.2(TTN):c.107657A>G (p.Lys35886Arg) rs727504465
NM_001267550.2(TTN):c.107680+19G>A rs771282051
NM_001267550.2(TTN):c.107681-21_107681-18del rs148707308
NM_001267550.2(TTN):c.107688G>A (p.Pro35896=) rs542575761
NM_001267550.2(TTN):c.107700A>G (p.Glu35900=) rs55832587
NM_001267550.2(TTN):c.10770G>A (p.Glu3590=) rs377401997
NM_001267550.2(TTN):c.107724T>C (p.Ile35908=) rs748517132
NM_001267550.2(TTN):c.107753G>A (p.Cys35918Tyr) rs193212275
NM_001267550.2(TTN):c.107766T>C (p.Gly35922=) rs147293964
NM_001267550.2(TTN):c.107915G>T (p.Ser35972Ile) rs397517478
NM_001267550.2(TTN):c.107961T>C (p.His35987=) rs377439315
NM_001267550.2(TTN):c.1079G>C (p.Arg360Thr) rs56128843
NM_001267550.2(TTN):c.10922T>C (p.Ile3641Thr) rs141027782
NM_001267550.2(TTN):c.10931G>A (p.Ser3644Asn) rs78535378
NM_001267550.2(TTN):c.10977G>A (p.Ala3659=) rs369327691
NM_001267550.2(TTN):c.10990C>T (p.Leu3664=) rs1445421739
NM_001267550.2(TTN):c.11063T>C (p.Phe3688Ser) rs377296133
NM_001267550.2(TTN):c.11066T>C (p.Ile3689Thr) rs527924868
NM_001267550.2(TTN):c.11103G>A (p.Glu3701=) rs762913656
NM_001267550.2(TTN):c.11109C>T (p.Ser3703=) rs879160199
NM_001267550.2(TTN):c.111G>C (p.Val37=) rs373923523
NM_001267550.2(TTN):c.11255-7A>G
NM_001267550.2(TTN):c.11311+1079_11311+1080del rs58651353
NM_001267550.2(TTN):c.11311+1080del rs58651353
NM_001267550.2(TTN):c.11311+1134C>T rs727505183
NM_001267550.2(TTN):c.11311+1135G>A rs149878929
NM_001267550.2(TTN):c.11311+1341T>C rs200284932
NM_001267550.2(TTN):c.11311+1350G>T rs370206902
NM_001267550.2(TTN):c.11311+1370G>A rs148115514
NM_001267550.2(TTN):c.11311+1372C>T rs141407971
NM_001267550.2(TTN):c.11311+1499C>T rs184395741
NM_001267550.2(TTN):c.11311+1641C>T rs140804168
NM_001267550.2(TTN):c.11311+1644T>C rs142585268
NM_001267550.2(TTN):c.11311+1788T>C rs727503672
NM_001267550.2(TTN):c.11311+1799G>C rs147314430
NM_001267550.2(TTN):c.11311+1977A>G rs374616494
NM_001267550.2(TTN):c.11311+1978T>A rs144209883
NM_001267550.2(TTN):c.11311+1994C>G rs777777663
NM_001267550.2(TTN):c.11311+2007G>C rs200816462
NM_001267550.2(TTN):c.11311+213T>C
NM_001267550.2(TTN):c.11311+2352A>G rs140246156
NM_001267550.2(TTN):c.11311+2573T>C rs72647897
NM_001267550.2(TTN):c.11311+2649G>A rs562072193
NM_001267550.2(TTN):c.11311+2731C>T rs200550488
NM_001267550.2(TTN):c.11311+2853A>G rs727503669
NM_001267550.2(TTN):c.11311+2877C>T rs200304872
NM_001267550.2(TTN):c.11311+2950G>A rs144690298
NM_001267550.2(TTN):c.11311+3111G>A rs142887857
NM_001267550.2(TTN):c.11311+3137A>C rs781665805
NM_001267550.2(TTN):c.11311+3423T>C rs185931752
NM_001267550.2(TTN):c.11311+3440C>T rs72647901
NM_001267550.2(TTN):c.11311+3483T>C rs772354003
NM_001267550.2(TTN):c.11311+3769C>A rs140064945
NM_001267550.2(TTN):c.11311+3847G>T rs72647902
NM_001267550.2(TTN):c.11311+3945G>A rs529300203
NM_001267550.2(TTN):c.11311+3968A>T rs770557290
NM_001267550.2(TTN):c.11311+4071A>G rs144539321
NM_001267550.2(TTN):c.11311+4088A>G rs142304137
NM_001267550.2(TTN):c.11311+4098T>C rs397517809
NM_001267550.2(TTN):c.11311+4338A>C rs139344272
NM_001267550.2(TTN):c.11311+4470A>G rs201945197
NM_001267550.2(TTN):c.11311+4523A>C rs200760091
NM_001267550.2(TTN):c.11311+4583A>C rs139172299
NM_001267550.2(TTN):c.11311+4587G>A rs77419653
NM_001267550.2(TTN):c.11311+4672C>T rs149748934
NM_001267550.2(TTN):c.11311+4802T>C rs139486133
NM_001267550.2(TTN):c.11311+4918T>A rs376557941
NM_001267550.2(TTN):c.11311+4938C>T rs147513899
NM_001267550.2(TTN):c.11311+5055G>C rs397517813
NM_001267550.2(TTN):c.11311+5123G>A rs565140436
NM_001267550.2(TTN):c.11311+5213A>G rs144905085
NM_001267550.2(TTN):c.11311+5217C>T rs876657620
NM_001267550.2(TTN):c.11311+5250T>A rs776361113
NM_001267550.2(TTN):c.11311+5340C>T rs148105798
NM_001267550.2(TTN):c.11311+5412T>C rs727503666
NM_001267550.2(TTN):c.11311+5478T>G rs72648908
NM_001267550.2(TTN):c.11311+5514C>G rs370038956
NM_001267550.2(TTN):c.11311+5536A>G rs145581345
NM_001267550.2(TTN):c.11311+860A>G
NM_001267550.2(TTN):c.11312-3593G>A
NM_001267550.2(TTN):c.11312-3866G>A rs145932311
NM_001267550.2(TTN):c.11312-3877G>A rs141624211
NM_001267550.2(TTN):c.11312-3895T>C rs876657622
NM_001267550.2(TTN):c.11312-4258G>A rs397517819
NM_001267550.2(TTN):c.11312-4319G>A rs72648913
NM_001267550.2(TTN):c.11312-4337G>A
NM_001267550.2(TTN):c.11312-4459T>C rs200378944
NM_001267550.2(TTN):c.11312-4478C>T rs151253841
NM_001267550.2(TTN):c.11312-4498G>A rs186841908
NM_001267550.2(TTN):c.11312-4819A>G rs876657621
NM_001267550.2(TTN):c.11312-4873C>T rs138122578
NM_001267550.2(TTN):c.11312-4894T>C rs149543721
NM_001267550.2(TTN):c.11312-5161T>C rs569499266
NM_001267550.2(TTN):c.11312-5194_11312-5162dup rs397517815
NM_001267550.2(TTN):c.11312-5199A>C rs141105907
NM_001267550.2(TTN):c.11312-5286C>T rs200953966
NM_001267550.2(TTN):c.11312-5363A>G rs1322304017
NM_001267550.2(TTN):c.11312-5534C>G
NM_001267550.2(TTN):c.11334T>C (p.Ser3778=) rs397517824
NM_001267550.2(TTN):c.11338G>A (p.Glu3780Lys) rs727504586
NM_001267550.2(TTN):c.11361C>T (p.Ala3787=) rs747366406
NM_001267550.2(TTN):c.11370A>G (p.Gln3790=) rs72648918
NM_001267550.2(TTN):c.1137A>G (p.Arg379=) rs55972547
NM_001267550.2(TTN):c.11391A>G (p.Thr3797=) rs373708340
NM_001267550.2(TTN):c.11392C>T (p.Leu3798Phe) rs370110992
NM_001267550.2(TTN):c.11415A>G (p.Pro3805=) rs561157636
NM_001267550.2(TTN):c.11440G>A (p.Glu3814Lys) rs375103237
NM_001267550.2(TTN):c.11475A>G (p.Glu3825=) rs1057523983
NM_001267550.2(TTN):c.11499G>A (p.Met3833Ile) rs756868500
NM_001267550.2(TTN):c.11502G>A (p.Gly3834=) rs777420658
NM_001267550.2(TTN):c.11506G>A (p.Val3836Met) rs397517825
NM_001267550.2(TTN):c.11565T>A (p.Phe3855Leu)
NM_001267550.2(TTN):c.11583C>T (p.Thr3861=) rs11899887
NM_001267550.2(TTN):c.11613C>T (p.Asp3871=) rs781329648
NM_001267550.2(TTN):c.11614G>A (p.Gly3872Ser) rs754936734
NM_001267550.2(TTN):c.1161C>T (p.Thr387=) rs753484667
NM_001267550.2(TTN):c.11672C>T (p.Thr3891Ile) rs148164929
NM_001267550.2(TTN):c.11676T>C (p.Cys3892=) rs879119259
NM_001267550.2(TTN):c.11712T>C (p.Ser3904=) rs553478382
NM_001267550.2(TTN):c.11719C>G (p.Leu3907Val) rs55853696
NM_001267550.2(TTN):c.11756C>A (p.Thr3919Asn) rs727503661
NM_001267550.2(TTN):c.11788G>A (p.Glu3930Lys) rs186624523
NM_001267550.2(TTN):c.11811T>C (p.Pro3937=) rs571602215
NM_001267550.2(TTN):c.11842C>T (p.Arg3948Cys) rs397517827
NM_001267550.2(TTN):c.11856G>T (p.Gly3952=) rs1057524094
NM_001267550.2(TTN):c.1185C>T (p.Ala395=) rs372346898
NM_001267550.2(TTN):c.11902A>G (p.Thr3968Ala)
NM_001267550.2(TTN):c.11910A>T (p.Thr3970=) rs727503660
NM_001267550.2(TTN):c.11959A>G (p.Ile3987Val) rs551387805
NM_001267550.2(TTN):c.11991T>C (p.Ile3997=) rs565546452
NM_001267550.2(TTN):c.11996A>G (p.Asn3999Ser) rs199844346
NM_001267550.2(TTN):c.12024C>T (p.Leu4008=) rs371694842
NM_001267550.2(TTN):c.12037G>A (p.Ala4013Thr) rs397517828
NM_001267550.2(TTN):c.12049T>G (p.Leu4017Val) rs367635055
NM_001267550.2(TTN):c.12078G>A (p.Leu4026=) rs926556907
NM_001267550.2(TTN):c.1208G>C (p.Ser403Thr) rs727505091
NM_001267550.2(TTN):c.1212C>T (p.Tyr404=) rs139187345
NM_001267550.2(TTN):c.12145C>T (p.Pro4049Ser) rs201888760
NM_001267550.2(TTN):c.12181G>A (p.Ala4061Thr) rs397517829
NM_001267550.2(TTN):c.12186T>A (p.Val4062=) rs1553940509
NM_001267550.2(TTN):c.12195T>C (p.Leu4065=) rs201129413
NM_001267550.2(TTN):c.12204G>A (p.Glu4068=) rs137896107
NM_001267550.2(TTN):c.12234C>G (p.Thr4078=) rs192857526
NM_001267550.2(TTN):c.12276A>G (p.Leu4092=) rs1553940209
NM_001267550.2(TTN):c.12294T>C (p.Ala4098=) rs1386491689
NM_001267550.2(TTN):c.12324T>C (p.Pro4108=) rs537284713
NM_001267550.2(TTN):c.12332C>G (p.Ala4111Gly) rs140289517
NM_001267550.2(TTN):c.12369C>T (p.Leu4123=) rs372053333
NM_001267550.2(TTN):c.12387G>A (p.Arg4129=) rs199546417
NM_001267550.2(TTN):c.12401T>A (p.Ile4134Asn) rs112009206
NM_001267550.2(TTN):c.12405T>C (p.Asn4135=) rs767823868
NM_001267550.2(TTN):c.12423G>A (p.Gln4141=) rs1310898352
NM_001267550.2(TTN):c.12446A>G (p.Asn4149Ser) rs768083269
NM_001267550.2(TTN):c.1245+15G>A rs778180261
NM_001267550.2(TTN):c.1245+20G>T rs371234481
NM_001267550.2(TTN):c.1246-14C>T rs753427490
NM_001267550.2(TTN):c.12498T>C (p.Ile4166=) rs756194386
NM_001267550.2(TTN):c.12543C>T (p.Thr4181=) rs764856949
NM_001267550.2(TTN):c.12547A>G (p.Lys4183Glu) rs201565932
NM_001267550.2(TTN):c.12558A>G (p.Pro4186=) rs72648921
NM_001267550.2(TTN):c.12580A>T (p.Ile4194Phe) rs34618570
NM_001267550.2(TTN):c.12653T>C (p.Ile4218Thr) rs374631591
NM_001267550.2(TTN):c.12679A>T (p.Thr4227Ser) rs1553939161
NM_001267550.2(TTN):c.12721G>A (p.Val4241Ile) rs1553939072
NM_001267550.2(TTN):c.12726T>C (p.Ser4242=) rs1191147375
NM_001267550.2(TTN):c.12733A>C (p.Asn4245His) rs199652066
NM_001267550.2(TTN):c.12741G>A (p.Glu4247=) rs879121745
NM_001267550.2(TTN):c.12743A>C (p.Gln4248Pro) rs770583611
NM_001267550.2(TTN):c.12748G>A (p.Val4250Met) rs201437752
NM_001267550.2(TTN):c.12855A>G (p.Val4285=) rs921588705
NM_001267550.2(TTN):c.12873C>G (p.Val4291=) rs747114179
NM_001267550.2(TTN):c.12889T>G (p.Cys4297Gly) rs377063950
NM_001267550.2(TTN):c.1288G>A (p.Val430Ile) rs371639583
NM_001267550.2(TTN):c.12955G>A (p.Ala4319Thr)
NM_001267550.2(TTN):c.12956C>T (p.Ala4319Val)
NM_001267550.2(TTN):c.12957G>A (p.Ala4319=) rs762330685
NM_001267550.2(TTN):c.12981C>G (p.Ser4327=) rs1553938292
NM_001267550.2(TTN):c.12986G>A (p.Arg4329Lys) rs199560188
NM_001267550.2(TTN):c.13023C>T (p.Leu4341=) rs377195944
NM_001267550.2(TTN):c.13044C>T (p.Asn4348=) rs879161892
NM_001267550.2(TTN):c.13048G>A (p.Val4350Met) rs781206839
NM_001267550.2(TTN):c.13062C>T (p.Asp4354=) rs1553938075
NM_001267550.2(TTN):c.13068C>A (p.Ile4356=) rs1553938065
NM_001267550.2(TTN):c.13071T>G (p.Ile4357Met) rs1553938053
NM_001267550.2(TTN):c.13086G>A (p.Glu4362=) rs753471578
NM_001267550.2(TTN):c.13090G>A (p.Val4364Met) rs201506104
NM_001267550.2(TTN):c.13194A>G (p.Gln4398=) rs375347596
NM_001267550.2(TTN):c.13202G>A (p.Arg4401Gln) rs200431386
NM_001267550.2(TTN):c.13213G>A (p.Ala4405Thr) rs794729253
NM_001267550.2(TTN):c.13227C>T (p.Ser4409=) rs571473566
NM_001267550.2(TTN):c.13262A>G (p.Asn4421Ser) rs72648922
NM_001267550.2(TTN):c.13282G>A (p.Glu4428Lys) rs528766978
NM_001267550.2(TTN):c.13287T>C (p.Ala4429=) rs370604524
NM_001267550.2(TTN):c.1332C>T (p.Ser444=) rs759520186
NM_001267550.2(TTN):c.1333G>A (p.Ala445Thr) rs142414432
NM_001267550.2(TTN):c.13340C>T (p.Ser4447Leu) rs777547090
NM_001267550.2(TTN):c.13361A>G (p.Glu4454Gly)
NM_001267550.2(TTN):c.13371C>T (p.Ile4457=) rs570991398
NM_001267550.2(TTN):c.13446T>C (p.Tyr4482=)
NM_001267550.2(TTN):c.13458C>T (p.Asp4486=) rs748885610
NM_001267550.2(TTN):c.13499A>G (p.Lys4500Arg) rs727503655
NM_001267550.2(TTN):c.13501A>G (p.Thr4501Ala) rs750320283
NM_001267550.2(TTN):c.13518A>G (p.Glu4506=) rs764376907
NM_001267550.2(TTN):c.13520T>C (p.Met4507Thr) rs191968963
NM_001267550.2(TTN):c.13584T>C (p.Tyr4528=) rs780863409
NM_001267550.2(TTN):c.13599A>G (p.Glu4533=) rs727503654
NM_001267550.2(TTN):c.13618G>A (p.Val4540Met) rs201046911
NM_001267550.2(TTN):c.13641G>A (p.Leu4547=) rs768023034
NM_001267550.2(TTN):c.1365G>A (p.Thr455=) rs145211131
NM_001267550.2(TTN):c.13689C>T (p.Asp4563=) rs369466156
NM_001267550.2(TTN):c.13700A>G (p.Asp4567Gly) rs745641339
NM_001267550.2(TTN):c.13701T>G (p.Asp4567Glu) rs200422152
NM_001267550.2(TTN):c.13782G>A (p.Gln4594=) rs188071134
NM_001267550.2(TTN):c.13786G>T (p.Ala4596Ser) rs1308710134
NM_001267550.2(TTN):c.13819A>G (p.Met4607Val) rs371275648
NM_001267550.2(TTN):c.13859G>A (p.Gly4620Asp) rs55857742
NM_001267550.2(TTN):c.13884C>T (p.Ser4628=) rs183328495
NM_001267550.2(TTN):c.13899A>G (p.Lys4633=) rs539117866
NM_001267550.2(TTN):c.13908T>C (p.Asn4636=) rs1553936091
NM_001267550.2(TTN):c.1398+12G>C rs1033605445
NM_001267550.2(TTN):c.1398+216_1398+237dup
NM_001267550.2(TTN):c.1398+4C>T rs368548209
NM_001267550.2(TTN):c.13G>A (p.Ala5Thr) rs552620474
NM_001267550.2(TTN):c.14002A>G (p.Thr4668Ala) rs758920941
NM_001267550.2(TTN):c.14004C>T (p.Thr4668=) rs201200682
NM_001267550.2(TTN):c.14022G>A (p.Glu4674=) rs761849101
NM_001267550.2(TTN):c.1402A>C (p.Arg468=) rs1554033812
NM_001267550.2(TTN):c.14049C>T (p.Ser4683=) rs370208081
NM_001267550.2(TTN):c.14092+20del rs560021681
NM_001267550.2(TTN):c.14093-16C>T rs1057523430
NM_001267550.2(TTN):c.14136A>C (p.Ala4712=) rs370115946
NM_001267550.2(TTN):c.14169C>T (p.Ile4723=) rs397517479
NM_001267550.2(TTN):c.14212C>A (p.Arg4738=) rs1311308523
NM_001267550.2(TTN):c.14232C>T (p.Asp4744=)
NM_001267550.2(TTN):c.14235G>A (p.Lys4745=) rs756868442
NM_001267550.2(TTN):c.14302G>A (p.Gly4768Ser) rs727503652
NM_001267550.2(TTN):c.14343C>T (p.Val4781=) rs570400005
NM_001267550.2(TTN):c.14371+8C>T rs751432909
NM_001267550.2(TTN):c.14372-73G>A
NM_001267550.2(TTN):c.14410C>G (p.Leu4804Val) rs1553932306
NM_001267550.2(TTN):c.14424G>C (p.Val4808=) rs374479775
NM_001267550.2(TTN):c.14451A>G (p.Thr4817=) rs370621465
NM_001267550.2(TTN):c.1449C>T (p.Ala483=) rs141617218
NM_001267550.2(TTN):c.14502A>G (p.Ala4834=) rs779926164
NM_001267550.2(TTN):c.1450G>A (p.Asp484Asn) rs768211726
NM_001267550.2(TTN):c.14525G>A (p.Arg4842Lys) rs2742347
NM_001267550.2(TTN):c.14532C>T (p.Ser4844=) rs977012928
NM_001267550.2(TTN):c.14535C>T (p.Asp4845=) rs184307461
NM_001267550.2(TTN):c.14583T>C (p.Asp4861=) rs1317422659
NM_001267550.2(TTN):c.14610C>T (p.Ser4870=) rs2742348
NM_001267550.2(TTN):c.14662C>G (p.Pro4888Ala) rs376799249
NM_001267550.2(TTN):c.14697C>T (p.Ser4899=) rs372740215
NM_001267550.2(TTN):c.14698G>A (p.Ala4900Thr) rs72648923
NM_001267550.2(TTN):c.14721T>C (p.Leu4907=) rs1470683370
NM_001267550.2(TTN):c.14759C>T (p.Thr4920Met) rs371455094
NM_001267550.2(TTN):c.14765G>A (p.Ser4922Asn) rs184740744
NM_001267550.2(TTN):c.14784C>A (p.Leu4928=) rs373875040
NM_001267550.2(TTN):c.14788C>A (p.Pro4930Thr) rs201744218
NM_001267550.2(TTN):c.14830A>G (p.Thr4944Ala) rs1479138931
NM_001267550.2(TTN):c.14850C>G (p.Ala4950=) rs376339761
NM_001267550.2(TTN):c.14869A>C (p.Thr4957Pro) rs780405420
NM_001267550.2(TTN):c.14870C>G (p.Thr4957Ser) rs72648925
NM_001267550.2(TTN):c.14898T>C (p.Ala4966=) rs370105333
NM_001267550.2(TTN):c.14911T>G (p.Cys4971Gly) rs537312655
NM_001267550.2(TTN):c.1492G>A (p.Val498Ile) rs72647851
NM_001267550.2(TTN):c.14935+14G>A rs1553931045
NM_001267550.2(TTN):c.14936-220T>G
NM_001267550.2(TTN):c.14949C>T (p.Phe4983=) rs758324605
NM_001267550.2(TTN):c.14973T>C (p.Tyr4991=) rs761666344
NM_001267550.2(TTN):c.14984C>G (p.Pro4995Arg) rs72648927
NM_001267550.2(TTN):c.14998C>T (p.Arg5000Cys) rs369933152
NM_001267550.2(TTN):c.15003C>G (p.Leu5001=) rs1430516736
NM_001267550.2(TTN):c.15006T>C (p.His5002=) rs771278620
NM_001267550.2(TTN):c.15032T>C (p.Ile5011Thr) rs794729607
NM_001267550.2(TTN):c.1506G>A (p.Lys502=) rs757142612
NM_001267550.2(TTN):c.15086G>A (p.Arg5029Gln) rs200792058
NM_001267550.2(TTN):c.15150G>T (p.Gly5050=)
NM_001267550.2(TTN):c.15178G>A (p.Val5060Ile) rs72648929
NM_001267550.2(TTN):c.15178G>C (p.Val5060Leu) rs72648929
NM_001267550.2(TTN):c.15180C>T (p.Val5060=) rs376217206
NM_001267550.2(TTN):c.15185G>A (p.Ser5062Asn) rs371687650
NM_001267550.2(TTN):c.151C>T (p.Leu51=) rs397517489
NM_001267550.2(TTN):c.15217+8T>C rs756060056
NM_001267550.2(TTN):c.1521C>T (p.His507=) rs372875660
NM_001267550.2(TTN):c.15318T>C (p.Ile5106=) rs537358981
NM_001267550.2(TTN):c.15333C>T (p.Asp5111=) rs368695667
NM_001267550.2(TTN):c.15354T>C (p.Ser5118=) rs964395276
NM_001267550.2(TTN):c.1537-18T>C rs1057520497
NM_001267550.2(TTN):c.1537-53T>G
NM_001267550.2(TTN):c.15388G>A (p.Val5130Met)
NM_001267550.2(TTN):c.15430G>A (p.Glu5144Lys) rs766612317
NM_001267550.2(TTN):c.15459C>T (p.Val5153=)
NM_001267550.2(TTN):c.15496+7G>T rs746995346
NM_001267550.2(TTN):c.15500C>A (p.Pro5167His) rs730880237
NM_001267550.2(TTN):c.15542G>C (p.Gly5181Ala) rs201185434
NM_001267550.2(TTN):c.15544G>A (p.Gly5182Arg) rs775552018
NM_001267550.2(TTN):c.15552C>T (p.Thr5184=) rs146353237
NM_001267550.2(TTN):c.15563A>C (p.Gln5188Pro) rs72648930
NM_001267550.2(TTN):c.15584A>G (p.Glu5195Gly) rs72648931
NM_001267550.2(TTN):c.15600A>G (p.Thr5200=) rs369464051
NM_001267550.2(TTN):c.15625A>C (p.Arg5209=) rs1392727449
NM_001267550.2(TTN):c.15650G>A (p.Ser5217Asn) rs1479096219
NM_001267550.2(TTN):c.15659A>G (p.Asn5220Ser)
NM_001267550.2(TTN):c.156C>G (p.Pro52=) rs72647842
NM_001267550.2(TTN):c.156C>T (p.Pro52=) rs72647842
NM_001267550.2(TTN):c.15717G>A (p.Thr5239=) rs72648932
NM_001267550.2(TTN):c.15775+14C>T rs151057960
NM_001267550.2(TTN):c.15775+15A>C rs776801864
NM_001267550.2(TTN):c.15775+22C>T
NM_001267550.2(TTN):c.15775+8T>C rs371673901
NM_001267550.2(TTN):c.15792T>C (p.Ile5264=) rs12993099
NM_001267550.2(TTN):c.15822A>T (p.Ala5274=) rs779456916
NM_001267550.2(TTN):c.15831C>T (p.Pro5277=) rs780784090
NM_001267550.2(TTN):c.1584C>T (p.Ser528=) rs267599093
NM_001267550.2(TTN):c.15850G>A (p.Val5284Met) rs66839174
NM_001267550.2(TTN):c.1585G>A (p.Ala529Thr) rs143030869
NM_001267550.2(TTN):c.15860C>T (p.Thr5287Met) rs148551876
NM_001267550.2(TTN):c.15861G>A (p.Thr5287=) rs370299812
NM_001267550.2(TTN):c.15901T>C (p.Leu5301=) rs727505349
NM_001267550.2(TTN):c.15906C>T (p.Val5302=) rs375179152
NM_001267550.2(TTN):c.15956A>C (p.Lys5319Thr) rs779733584
NM_001267550.2(TTN):c.15972G>A (p.Glu5324=) rs1057522988
NM_001267550.2(TTN):c.15978C>T (p.His5326=) rs397517482
NM_001267550.2(TTN):c.15986G>A (p.Gly5329Asp) rs202234492
NM_001267550.2(TTN):c.16055-16_16055-14del rs1064795240
NM_001267550.2(TTN):c.16055-9A>C rs368897883
NM_001267550.2(TTN):c.16057C>A (p.Arg5353=) rs267599069
NM_001267550.2(TTN):c.16071A>G (p.Pro5357=) rs1251542501
NM_001267550.2(TTN):c.16078A>G (p.Thr5360Ala) rs749081117
NM_001267550.2(TTN):c.16095C>T (p.Asn5365=) rs72648935
NM_001267550.2(TTN):c.16113T>C (p.Asn5371=) rs143845692
NM_001267550.2(TTN):c.16126C>A (p.Leu5376Met) rs72648936
NM_001267550.2(TTN):c.16157T>C (p.Met5386Thr) rs375417155
NM_001267550.2(TTN):c.1616T>A (p.Ile539Asn) rs774503024
NM_001267550.2(TTN):c.16275G>A (p.Gly5425=) rs772821743
NM_001267550.2(TTN):c.16303G>A (p.Val5435Met) rs72648937
NM_001267550.2(TTN):c.16313A>G (p.Lys5438Arg) rs190636272
NM_001267550.2(TTN):c.16339C>A (p.Gln5447Lys) rs1390008275
NM_001267550.2(TTN):c.16422A>G (p.Gln5474=) rs371026448
NM_001267550.2(TTN):c.16477G>A (p.Gly5493Ser) rs377042940
NM_001267550.2(TTN):c.16480G>A (p.Gly5494Arg) rs727504697
NM_001267550.2(TTN):c.16515T>C (p.Ser5505=) rs201625116
NM_001267550.2(TTN):c.16529A>G (p.Tyr5510Cys) rs72648939
NM_001267550.2(TTN):c.16546G>T (p.Asp5516Tyr) rs72648940
NM_001267550.2(TTN):c.16551G>A (p.Ser5517=) rs376037792
NM_001267550.2(TTN):c.16557G>A (p.Thr5519=) rs753480595
NM_001267550.2(TTN):c.16581C>T (p.Val5527=) rs373179717
NM_001267550.2(TTN):c.1662+42A>G
NM_001267550.2(TTN):c.1662+6T>A rs1057520818
NM_001267550.2(TTN):c.16621+8T>C rs1057524119
NM_001267550.2(TTN):c.16661T>G (p.Leu5554Arg)
NM_001267550.2(TTN):c.16716A>G (p.Pro5572=) rs367821526
NM_001267550.2(TTN):c.16738A>G (p.Asn5580Asp) rs376598696
NM_001267550.2(TTN):c.16751T>A (p.Ile5584Asn) rs779652311
NM_001267550.2(TTN):c.16752T>A (p.Ile5584=) rs758374634
NM_001267550.2(TTN):c.16790C>T (p.Ser5597Phe) rs754116386
NM_001267550.2(TTN):c.16863G>A (p.Glu5621=) rs727504441
NM_001267550.2(TTN):c.16891G>A (p.Val5631Ile)
NM_001267550.2(TTN):c.16956C>T (p.Tyr5652=) rs755186242
NM_001267550.2(TTN):c.16959T>C (p.Asp5653=) rs770260995
NM_001267550.2(TTN):c.16964T>C (p.Met5655Thr) rs886044306
NM_001267550.2(TTN):c.16989T>C (p.Thr5663=) rs879099217
NM_001267550.2(TTN):c.17048A>G (p.Tyr5683Cys) rs72648942
NM_001267550.2(TTN):c.17079C>T (p.Ser5693=) rs372588069
NM_001267550.2(TTN):c.17082G>T (p.Leu5694=) rs750996600
NM_001267550.2(TTN):c.1709C>T (p.Ala570Val) rs146690035
NM_001267550.2(TTN):c.17115C>T (p.Gly5705=) rs370036981
NM_001267550.2(TTN):c.17129G>A (p.Arg5710Gln) rs200018866
NM_001267550.2(TTN):c.17160C>T (p.Cys5720=) rs972381308
NM_001267550.2(TTN):c.17183-5G>A rs1553924621
NM_001267550.2(TTN):c.17184A>G (p.Glu5728=) rs200984007
NM_001267550.2(TTN):c.17217C>T (p.Thr5739=) rs1553924564
NM_001267550.2(TTN):c.17227C>T (p.Arg5743Trp) rs377193479
NM_001267550.2(TTN):c.17228G>A (p.Arg5743Gln) rs753892271
NM_001267550.2(TTN):c.17259G>A (p.Leu5753=) rs1060503934
NM_001267550.2(TTN):c.1728A>G (p.Lys576=) rs727503703
NM_001267550.2(TTN):c.17300G>A (p.Ser5767Asn) rs200692495
NM_001267550.2(TTN):c.17301C>T (p.Ser5767=) rs777677229
NM_001267550.2(TTN):c.17319C>T (p.Asp5773=) rs760724229
NM_001267550.2(TTN):c.17356A>C (p.Ser5786Arg) rs745386654
NM_001267550.2(TTN):c.1742C>T (p.Pro581Leu) rs199778910
NM_001267550.2(TTN):c.17442T>C (p.Ser5814=) rs770532942
NM_001267550.2(TTN):c.17478C>T (p.Thr5826=) rs376968974
NM_001267550.2(TTN):c.17488G>A (p.Val5830Met)
NM_001267550.2(TTN):c.1748C>T (p.Ala583Val) rs772836198
NM_001267550.2(TTN):c.17543G>A (p.Gly5848Glu) rs185962498
NM_001267550.2(TTN):c.17556T>C (p.Ile5852=) rs370776424
NM_001267550.2(TTN):c.17565A>G (p.Lys5855=) rs745763221
NM_001267550.2(TTN):c.17686G>A (p.Glu5896Lys) rs561557554
NM_001267550.2(TTN):c.17740+17T>C rs369532031
NM_001267550.2(TTN):c.17741-6G>A rs748443352
NM_001267550.2(TTN):c.1776T>C (p.Asp592=) rs147081804
NM_001267550.2(TTN):c.17787C>T (p.Asp5929=) rs1227964604
NM_001267550.2(TTN):c.177C>T (p.Ser59=) rs191057824
NM_001267550.2(TTN):c.17806A>G (p.Ile5936Val) rs72648945
NM_001267550.2(TTN):c.17833T>G (p.Ser5945Ala) rs776790387
NM_001267550.2(TTN):c.17888A>G (p.Glu5963Gly) rs146983095
NM_001267550.2(TTN):c.17893T>C (p.Tyr5965His) rs752226947
NM_001267550.2(TTN):c.178G>T (p.Asp60Tyr) rs35683768
NM_001267550.2(TTN):c.17928G>A (p.Leu5976=) rs373963067
NM_001267550.2(TTN):c.1800+10T>C rs767071465
NM_001267550.2(TTN):c.18029-9T>C
NM_001267550.2(TTN):c.18075C>T (p.Pro6025=) rs557350005
NM_001267550.2(TTN):c.18084G>A (p.Arg6028=) rs775372762
NM_001267550.2(TTN):c.180T>C (p.Asp60=) rs144750850
NM_001267550.2(TTN):c.18114T>C (p.Thr6038=) rs1221916366
NM_001267550.2(TTN):c.18172C>T (p.Arg6058Cys) rs189127014
NM_001267550.2(TTN):c.18231C>T (p.Thr6077=) rs377639910
NM_001267550.2(TTN):c.18249T>C (p.Ile6083=) rs1057522780
NM_001267550.2(TTN):c.18267T>A (p.Asp6089Glu)
NM_001267550.2(TTN):c.18307+12A>G rs376899412
NM_001267550.2(TTN):c.18307+13C>T rs201930482
NM_001267550.2(TTN):c.1830A>G (p.Val610=)
NM_001267550.2(TTN):c.18325A>G (p.Lys6109Glu) rs73973139
NM_001267550.2(TTN):c.1834A>G (p.Lys612Glu) rs727505256
NM_001267550.2(TTN):c.18363G>A (p.Gln6121=) rs375032616
NM_001267550.2(TTN):c.18379T>G (p.Cys6127Gly) rs370812788
NM_001267550.2(TTN):c.18390A>T (p.Thr6130=) rs66523653
NM_001267550.2(TTN):c.18407G>A (p.Arg6136Gln) rs117551279
NM_001267550.2(TTN):c.18437T>C (p.Ile6146Thr)
NM_001267550.2(TTN):c.18456T>C (p.His6152=) rs756540833
NM_001267550.2(TTN):c.18470T>C (p.Ile6157Thr) rs371882162
NM_001267550.2(TTN):c.18510A>G (p.Val6170=) rs761425332
NM_001267550.2(TTN):c.1851A>C (p.Thr617=) rs727504530
NM_001267550.2(TTN):c.18528T>C (p.Tyr6176=) rs375408819
NM_001267550.2(TTN):c.18531G>C (p.Val6177=) rs370684491
NM_001267550.2(TTN):c.18549C>T (p.Asp6183=) rs200549353
NM_001267550.2(TTN):c.18550G>A (p.Ala6184Thr) rs72648947
NM_001267550.2(TTN):c.18557C>T (p.Thr6186Met) rs200359082
NM_001267550.2(TTN):c.18561G>A (p.Ala6187=) rs377556808
NM_001267550.2(TTN):c.18590-14T>G rs781455893
NM_001267550.2(TTN):c.185G>A (p.Arg62His) rs758169489
NM_001267550.2(TTN):c.18609A>G (p.Arg6203=) rs777227340
NM_001267550.2(TTN):c.18645C>T (p.Asp6215=) rs372400829
NM_001267550.2(TTN):c.18657G>A (p.Glu6219=) rs1282711943
NM_001267550.2(TTN):c.18659G>C (p.Cys6220Ser) rs191692293
NM_001267550.2(TTN):c.18681G>A (p.Pro6227=) rs372273496
NM_001267550.2(TTN):c.18684T>C (p.Phe6228=) rs368427156
NM_001267550.2(TTN):c.1869A>G (p.Gln623=) rs750034931
NM_001267550.2(TTN):c.186C>T (p.Arg62=) rs528853682
NM_001267550.2(TTN):c.18717T>A (p.Ile6239=) rs765483284
NM_001267550.2(TTN):c.18719G>A (p.Arg6240Gln) rs761993856
NM_001267550.2(TTN):c.18720A>G (p.Arg6240=) rs201395913
NM_001267550.2(TTN):c.18744C>T (p.Thr6248=)
NM_001267550.2(TTN):c.18745G>A (p.Asp6249Asn) rs201263441
NM_001267550.2(TTN):c.18776C>G (p.Thr6259Ser) rs72648949
NM_001267550.2(TTN):c.18777C>A (p.Thr6259=) rs750180579
NM_001267550.2(TTN):c.18778A>C (p.Lys6260Gln) rs375652574
NM_001267550.2(TTN):c.1878A>G (p.Val626=) rs761672925
NM_001267550.2(TTN):c.18807C>T (p.Tyr6269=) rs189167196
NM_001267550.2(TTN):c.18810G>A (p.Gln6270=) rs727505012
NM_001267550.2(TTN):c.18816T>C (p.Ile6272=) rs146219199
NM_001267550.2(TTN):c.18824A>G (p.Asn6275Ser) rs184412722
NM_001267550.2(TTN):c.18856G>A (p.Val6286Ile) rs149131555
NM_001267550.2(TTN):c.18869-15C>T rs749315046
NM_001267550.2(TTN):c.18893T>C (p.Ile6298Thr) rs375571785
NM_001267550.2(TTN):c.18903C>T (p.Thr6301=) rs72648950
NM_001267550.2(TTN):c.18942C>T (p.Thr6314=) rs572285982
NM_001267550.2(TTN):c.1895G>A (p.Gly632Asp) rs150231219
NM_001267550.2(TTN):c.18961A>G (p.Ile6321Val) rs145204073
NM_001267550.2(TTN):c.18972C>T (p.Thr6324=) rs769659495
NM_001267550.2(TTN):c.18978A>G (p.Leu6326=) rs1315197288
NM_001267550.2(TTN):c.189T>C (p.Ala63=) rs1057520389
NM_001267550.2(TTN):c.189T>G (p.Ala63=) rs1057520389
NM_001267550.2(TTN):c.19004A>G (p.Asp6335Gly) rs72648951
NM_001267550.2(TTN):c.19008T>A (p.Asp6336Glu) rs1416824072
NM_001267550.2(TTN):c.19054A>G (p.Arg6352Gly) rs569003242
NM_001267550.2(TTN):c.19063G>T (p.Asp6355Tyr) rs188878341
NM_001267550.2(TTN):c.19148-13A>G
NM_001267550.2(TTN):c.19148-19A>G rs760577918
NM_001267550.2(TTN):c.1914A>G (p.Glu638=) rs727504691
NM_001267550.2(TTN):c.19150C>A (p.Pro6384Thr) rs72648953
NM_001267550.2(TTN):c.19152A>G (p.Pro6384=) rs956813031
NM_001267550.2(TTN):c.19153G>A (p.Ala6385Thr) rs1032273558
NM_001267550.2(TTN):c.19162G>A (p.Val6388Ile) rs550617268
NM_001267550.2(TTN):c.19180G>C (p.Val6394Leu)
NM_001267550.2(TTN):c.19191G>A (p.Thr6397=) rs140495148
NM_001267550.2(TTN):c.19204A>G (p.Met6402Val) rs72648954
NM_001267550.2(TTN):c.19263C>T (p.Asp6421=) rs552531581
NM_001267550.2(TTN):c.19301G>A (p.Ser6434Asn) rs11888217
NM_001267550.2(TTN):c.19317G>C (p.Val6439=) rs878854289
NM_001267550.2(TTN):c.19347G>A (p.Lys6449=) rs1553919623
NM_001267550.2(TTN):c.19356C>T (p.Ser6452=) rs369275615
NM_001267550.2(TTN):c.19368T>C (p.Thr6456=) rs1553919591
NM_001267550.2(TTN):c.1938+115C>T
NM_001267550.2(TTN):c.19383T>C (p.Asn6461=) rs76771282
NM_001267550.2(TTN):c.19389C>T (p.Phe6463=) rs267599062
NM_001267550.2(TTN):c.1939A>T (p.Met647Leu) rs1554027673
NM_001267550.2(TTN):c.19433A>G (p.Asn6478Ser) rs775984790
NM_001267550.2(TTN):c.1943G>C (p.Arg648Thr) rs550441902
NM_001267550.2(TTN):c.19485C>A (p.Gly6495=) rs780158564
NM_001267550.2(TTN):c.1953C>T (p.Ala651=) rs778742098
NM_001267550.2(TTN):c.19715-12_19715-11del rs748695304
NM_001267550.2(TTN):c.19715-4A>G rs375009631
NM_001267550.2(TTN):c.19715-7T>C rs532527175
NM_001267550.2(TTN):c.19728C>T (p.Phe6576=) rs751902051
NM_001267550.2(TTN):c.19738C>T (p.Pro6580Ser) rs116572520
NM_001267550.2(TTN):c.19770A>G (p.Thr6590=) rs775289296
NM_001267550.2(TTN):c.197C>T (p.Thr66Met) rs372755739
NM_001267550.2(TTN):c.19818A>G (p.Lys6606=) rs397517492
NM_001267550.2(TTN):c.19848A>G (p.Ser6616=) rs1345701707
NM_001267550.2(TTN):c.19881G>A (p.Ser6627=) rs371495674
NM_001267550.2(TTN):c.198G>A (p.Thr66=) rs764223195
NM_001267550.2(TTN):c.19914T>C (p.Ala6638=) rs1317197263
NM_001267550.2(TTN):c.19922C>A (p.Thr6641Asn) rs747240394
NM_001267550.2(TTN):c.19976C>T (p.Thr6659Met) rs16866475
NM_001267550.2(TTN):c.19977G>T (p.Thr6659=) rs1060503954
NM_001267550.2(TTN):c.19983G>A (p.Leu6661=) rs1383144902
NM_001267550.2(TTN):c.19995A>T (p.Glu6665Asp) rs146828735
NM_001267550.2(TTN):c.20025C>A (p.Ala6675=) rs373842558
NM_001267550.2(TTN):c.20085A>C (p.Pro6695=) rs1287032649
NM_001267550.2(TTN):c.20142C>T (p.Tyr6714=) rs535793314
NM_001267550.2(TTN):c.20169C>T (p.Ala6723=) rs727504776
NM_001267550.2(TTN):c.20175A>G (p.Ile6725Met) rs146627500
NM_001267550.2(TTN):c.20236G>A (p.Ala6746Thr) rs202108224
NM_001267550.2(TTN):c.20263G>C (p.Val6755Leu) rs876657599
NM_001267550.2(TTN):c.20275+136C>T
NM_001267550.2(TTN):c.20335A>T (p.Ser6779Cys) rs149470241
NM_001267550.2(TTN):c.20341G>A (p.Glu6781Lys) rs72648958
NM_001267550.2(TTN):c.20355G>A (p.Ser6785=) rs549470227
NM_001267550.2(TTN):c.20355G>C (p.Ser6785=) rs549470227
NM_001267550.2(TTN):c.2035A>G (p.Met679Val) rs1554027460
NM_001267550.2(TTN):c.20367G>A (p.Pro6789=) rs368422028
NM_001267550.2(TTN):c.20367G>T (p.Pro6789=) rs368422028
NM_001267550.2(TTN):c.20397G>A (p.Arg6799=) rs376573256
NM_001267550.2(TTN):c.20418A>C (p.Lys6806Asn) rs768932465
NM_001267550.2(TTN):c.20472C>T (p.Asp6824=) rs1418781337
NM_001267550.2(TTN):c.204C>T (p.Pro68=) rs201089861
NM_001267550.2(TTN):c.20554+10G>C rs1553915945
NM_001267550.2(TTN):c.20554+9A>C rs1060503960
NM_001267550.2(TTN):c.2061A>G (p.Gln687=) rs188680791
NM_001267550.2(TTN):c.20630T>C (p.Ile6877Thr) rs142794598
NM_001267550.2(TTN):c.20670G>A (p.Glu6890=) rs1553915541
NM_001267550.2(TTN):c.20736A>G (p.Leu6912=) rs876657600
NM_001267550.2(TTN):c.20743G>T (p.Ala6915Ser) rs201728165
NM_001267550.2(TTN):c.2076+13G>A rs778505099
NM_001267550.2(TTN):c.2076+13_2076+15del rs777562481
NM_001267550.2(TTN):c.2076+55A>C
NM_001267550.2(TTN):c.20772G>A (p.Lys6924=) rs369993514
NM_001267550.2(TTN):c.20792A>G (p.Asn6931Ser) rs200866883
NM_001267550.2(TTN):c.20798G>C (p.Gly6933Ala) rs200118743
NM_001267550.2(TTN):c.207C>T (p.Ala69=) rs150548328
NM_001267550.2(TTN):c.20808G>A (p.Arg6936=) rs773342572
NM_001267550.2(TTN):c.2082C>T (p.Asp694=) rs534874686
NM_001267550.2(TTN):c.20837-12G>A
NM_001267550.2(TTN):c.20861C>T (p.Ala6954Val) rs17355446
NM_001267550.2(TTN):c.20868G>A (p.Pro6956=) rs367929968
NM_001267550.2(TTN):c.20874G>A (p.Thr6958=)
NM_001267550.2(TTN):c.20880T>C (p.Thr6960=) rs1466462241
NM_001267550.2(TTN):c.20892G>A (p.Thr6964=) rs727504623
NM_001267550.2(TTN):c.20905T>C (p.Cys6969Arg) rs368762020
NM_001267550.2(TTN):c.20924C>T (p.Pro6975Leu) rs374493881
NM_001267550.2(TTN):c.20964G>A (p.Leu6988=) rs1553914054
NM_001267550.2(TTN):c.20999A>G (p.Asn7000Ser)
NM_001267550.2(TTN):c.21002A>G (p.Lys7001Arg) rs200594798
NM_001267550.2(TTN):c.21003A>G (p.Lys7001=) rs727504579
NM_001267550.2(TTN):c.21013T>C (p.Leu7005=) rs774841915
NM_001267550.2(TTN):c.21036G>T (p.Arg7012Ser)
NM_001267550.2(TTN):c.21044C>T (p.Ala7015Val) rs72648960
NM_001267550.2(TTN):c.21106G>A (p.Asp7036Asn) rs72648962
NM_001267550.2(TTN):c.21115+8C>T rs1199697682
NM_001267550.2(TTN):c.21116-4A>G rs375874660
NM_001267550.2(TTN):c.21116-4del rs1553913568
NM_001267550.2(TTN):c.21148C>T (p.Leu7050=) rs202089818
NM_001267550.2(TTN):c.21162T>G (p.Gly7054=) rs1553913456
NM_001267550.2(TTN):c.21173G>A (p.Gly7058Asp) rs72648964
NM_001267550.2(TTN):c.21246C>T (p.Thr7082=) rs1553913320
NM_001267550.2(TTN):c.21276C>T (p.Thr7092=) rs372264428
NM_001267550.2(TTN):c.21279A>G (p.Thr7093=) rs727504765
NM_001267550.2(TTN):c.21307T>A (p.Leu7103Met) rs1235519093
NM_001267550.2(TTN):c.21332T>C (p.Met7111Thr) rs374408615
NM_001267550.2(TTN):c.21363C>T (p.Val7121=) rs751090506
NM_001267550.2(TTN):c.21364G>A (p.Ala7122Thr) rs201394117
NM_001267550.2(TTN):c.21378A>C (p.Glu7126Asp) rs786205315
NM_001267550.2(TTN):c.21389T>C (p.Val7130Ala)
NM_001267550.2(TTN):c.21403+12G>C
NM_001267550.2(TTN):c.21489C>G (p.Thr7163=) rs376882041
NM_001267550.2(TTN):c.2151C>T (p.Pro717=) rs374570732
NM_001267550.2(TTN):c.21545G>A (p.Arg7182Gln) rs200447686
NM_001267550.2(TTN):c.21548G>A (p.Cys7183Tyr) rs189951108
NM_001267550.2(TTN):c.21555C>A (p.Ile7185=) rs201155967
NM_001267550.2(TTN):c.21573G>A (p.Val7191=) rs1553912562
NM_001267550.2(TTN):c.2157G>A (p.Glu719=) rs762041830
NM_001267550.2(TTN):c.21605C>G (p.Ser7202Cys) rs747376234
NM_001267550.2(TTN):c.21624C>T (p.Thr7208=) rs372818044
NM_001267550.2(TTN):c.21642C>T (p.Asn7214=) rs752620885
NM_001267550.2(TTN):c.21666C>A (p.Thr7222=) rs1041546705
NM_001267550.2(TTN):c.21668G>A (p.Arg7223His) rs138853909
NM_001267550.2(TTN):c.21689C>T (p.Ala7230Val) rs761223583
NM_001267550.2(TTN):c.21744T>C (p.Ile7248=) rs779975469
NM_001267550.2(TTN):c.21777T>A (p.Ile7259=) rs727505220
NM_001267550.2(TTN):c.21779C>A (p.Ser7260Tyr) rs187925021
NM_001267550.2(TTN):c.21800G>A (p.Gly7267Asp) rs375627540
NM_001267550.2(TTN):c.21906C>T (p.Cys7302=) rs370548693
NM_001267550.2(TTN):c.21961+17T>C
NM_001267550.2(TTN):c.21962-6C>T rs374870814
NM_001267550.2(TTN):c.21966G>A (p.Pro7322=) rs773546767
NM_001267550.2(TTN):c.21980C>T (p.Thr7327Met) rs727504975
NM_001267550.2(TTN):c.21981G>T (p.Thr7327=) rs775230627
NM_001267550.2(TTN):c.21993T>C (p.Pro7331=) rs373223049
NM_001267550.2(TTN):c.22074A>G (p.Lys7358=) rs34562585
NM_001267550.2(TTN):c.22077A>T (p.Gly7359=) rs202102237
NM_001267550.2(TTN):c.22080T>C (p.Asp7360=) rs16866473
NM_001267550.2(TTN):c.22111A>G (p.Thr7371Ala) rs1381030080
NM_001267550.2(TTN):c.22134C>T (p.Ala7378=) rs879172660
NM_001267550.2(TTN):c.22155G>A (p.Val7385=) rs767194863
NM_001267550.2(TTN):c.2218C>A (p.Arg740Ser) rs566299753
NM_001267550.2(TTN):c.22240+3G>A rs768904155
NM_001267550.2(TTN):c.22240+7A>C rs368101794
NM_001267550.2(TTN):c.22241-5T>C rs397517501
NM_001267550.2(TTN):c.2226C>A (p.Ser742=) rs151025677
NM_001267550.2(TTN):c.2226C>T (p.Ser742=) rs151025677
NM_001267550.2(TTN):c.2227G>A (p.Ala743Thr) rs370728359
NM_001267550.2(TTN):c.2229C>T (p.Ala743=) rs746990488
NM_001267550.2(TTN):c.2230G>A (p.Ala744Thr) rs144639994
NM_001267550.2(TTN):c.22383C>T (p.Asp7461=) rs376383610
NM_001267550.2(TTN):c.22384G>C (p.Asp7462His) rs12693166
NM_001267550.2(TTN):c.22439A>C (p.Gln7480Pro) rs201065037
NM_001267550.2(TTN):c.22440A>G (p.Gln7480=) rs1057521208
NM_001267550.2(TTN):c.2244G>A (p.Glu748=) rs6715406
NM_001267550.2(TTN):c.22510G>A (p.Ala7504Thr) rs753276275
NM_001267550.2(TTN):c.22536G>A (p.Lys7512=) rs1553910053
NM_001267550.2(TTN):c.22569T>C (p.Ser7523=) rs761651834
NM_001267550.2(TTN):c.22575T>A (p.Asp7525Glu) rs200061856
NM_001267550.2(TTN):c.22599T>C (p.Asp7533=) rs1553909923
NM_001267550.2(TTN):c.22611T>C (p.His7537=) rs16866469
NM_001267550.2(TTN):c.22620T>C (p.Gly7540=) rs1553909881
NM_001267550.2(TTN):c.22634G>A (p.Arg7545Gln) rs72648969
NM_001267550.2(TTN):c.2264C>T (p.Ser755Leu) rs533384820
NM_001267550.2(TTN):c.22653T>C (p.Asp7551=) rs371736246
NM_001267550.2(TTN):c.22692A>T (p.Thr7564=) rs187182557
NM_001267550.2(TTN):c.22734C>A (p.Gly7578=) rs747844754
NM_001267550.2(TTN):c.2274C>T (p.His758=) rs772664968
NM_001267550.2(TTN):c.22786G>C (p.Asp7596His) rs72648970
NM_001267550.2(TTN):c.2280C>T (p.Val760=) rs727505021
NM_001267550.2(TTN):c.22816+59A>T
NM_001267550.2(TTN):c.22817-42A>G
NM_001267550.2(TTN):c.22842A>G (p.Leu7614=) rs727504963
NM_001267550.2(TTN):c.22941C>T (p.Ser7647=) rs544355195
NM_001267550.2(TTN):c.22968C>T (p.Asn7656=) rs201904848
NM_001267550.2(TTN):c.23001G>A (p.Thr7667=) rs16866467
NM_001267550.2(TTN):c.2301A>G (p.Arg767=) rs746831560
NM_001267550.2(TTN):c.23029G>A (p.Gly7677Arg) rs367826445
NM_001267550.2(TTN):c.23052T>C (p.His7684=) rs1553908123
NM_001267550.2(TTN):c.23067C>T (p.Asp7689=) rs191854953
NM_001267550.2(TTN):c.23076C>T (p.Cys7692=) rs769505705
NM_001267550.2(TTN):c.23085G>T (p.Ala7695=) rs768936623
NM_001267550.2(TTN):c.23098+15G>T rs397517503
NM_001267550.2(TTN):c.23099-3T>C rs2562830
NM_001267550.2(TTN):c.23100A>T (p.Ala7700=) rs775508685
NM_001267550.2(TTN):c.2310G>T (p.Gln770His) rs541547610
NM_001267550.2(TTN):c.23114C>T (p.Thr7705Ile) rs772162626
NM_001267550.2(TTN):c.23121G>A (p.Lys7707=) rs72648971
NM_001267550.2(TTN):c.23177C>T (p.Ser7726Leu) rs17452588
NM_001267550.2(TTN):c.23178G>A (p.Ser7726=) rs753546095
NM_001267550.2(TTN):c.23214T>C (p.Asp7738=) rs727503648
NM_001267550.2(TTN):c.23215C>A (p.Arg7739=) rs372250586
NM_001267550.2(TTN):c.23223G>A (p.Gln7741=) rs2562831
NM_001267550.2(TTN):c.23232C>G (p.Asn7744Lys) rs72648972
NM_001267550.2(TTN):c.23250C>T (p.Ile7750=) rs1060503967
NM_001267550.2(TTN):c.23286T>A (p.Leu7762=) rs1553907203
NM_001267550.2(TTN):c.23301C>T (p.Ser7767=) rs73038337
NM_001267550.2(TTN):c.23302G>A (p.Asp7768Asn) rs72648973
NM_001267550.2(TTN):c.23382T>A (p.Pro7794=) rs768874223
NM_001267550.2(TTN):c.23387G>A (p.Arg7796Gln) rs267599059
NM_001267550.2(TTN):c.23423T>C (p.Ile7808Thr)
NM_001267550.2(TTN):c.23521A>T (p.Asn7841Tyr)
NM_001267550.2(TTN):c.23538C>G (p.Phe7846Leu) rs149523263
NM_001267550.2(TTN):c.23538C>T (p.Phe7846=) rs149523263
NM_001267550.2(TTN):c.23585A>C (p.Asn7862Thr) rs794729629
NM_001267550.2(TTN):c.23616C>T (p.Asn7872=) rs181206334
NM_001267550.2(TTN):c.23622T>C (p.Ala7874=) rs777752532
NM_001267550.2(TTN):c.2376G>A (p.Lys792=) rs727504854
NM_001267550.2(TTN):c.23814A>G (p.Thr7938=) rs566680341
NM_001267550.2(TTN):c.23844C>A (p.Ile7948=) rs536536380
NM_001267550.2(TTN):c.23853C>A (p.Ala7951=) rs201766927
NM_001267550.2(TTN):c.23853C>T (p.Ala7951=) rs201766927
NM_001267550.2(TTN):c.23898T>C (p.Ser7966=) rs773116614
NM_001267550.2(TTN):c.23901T>G (p.Val7967=) rs550995785
NM_001267550.2(TTN):c.23919T>C (p.Thr7973=) rs727504974
NM_001267550.2(TTN):c.2391A>G (p.Leu797=) rs147124267
NM_001267550.2(TTN):c.23925C>T (p.Ser7975=) rs374879942
NM_001267550.2(TTN):c.23939-24G>A
NM_001267550.2(TTN):c.23939-4A>G rs775692859
NM_001267550.2(TTN):c.23939-5C>T rs1214280183
NM_001267550.2(TTN):c.23965C>T (p.Arg7989Cys) rs201653851
NM_001267550.2(TTN):c.23970G>A (p.Lys7990=) rs1553905164
NM_001267550.2(TTN):c.2397G>A (p.Thr799=) rs369313128
NM_001267550.2(TTN):c.23997G>A (p.Gly7999=) rs1261213256
NM_001267550.2(TTN):c.24045A>T (p.Ser8015=) rs1060503946
NM_001267550.2(TTN):c.24075T>G (p.Ile8025Met) rs371496970
NM_001267550.2(TTN):c.240G>A (p.Leu80=) rs1554045220
NM_001267550.2(TTN):c.24114C>T (p.Asn8038=) rs199576800
NM_001267550.2(TTN):c.24156A>G (p.Thr8052=) rs749823104
NM_001267550.2(TTN):c.24165C>T (p.Tyr8055=) rs376896085
NM_001267550.2(TTN):c.24168G>A (p.Thr8056=) rs563766812
NM_001267550.2(TTN):c.24171T>C (p.Cys8057=) rs777482646
NM_001267550.2(TTN):c.24174G>T (p.Val8058=) rs1553904651
NM_001267550.2(TTN):c.24195C>T (p.Ser8065=) rs182425565
NM_001267550.2(TTN):c.24207A>G (p.Ser8069=) rs370099448
NM_001267550.2(TTN):c.24227-15C>T rs397517505
NM_001267550.2(TTN):c.2426C>G (p.Pro809Arg)
NM_001267550.2(TTN):c.2432C>T (p.Thr811Ile) rs35813871
NM_001267550.2(TTN):c.24431A>C (p.Glu8144Ala) rs16866465
NM_001267550.2(TTN):c.24453C>T (p.Leu8151=) rs772386098
NM_001267550.2(TTN):c.24505+13C>T rs534803807
NM_001267550.2(TTN):c.24506-17_24506-16del rs776041749
NM_001267550.2(TTN):c.24506-8C>G rs748675191
NM_001267550.2(TTN):c.24516C>T (p.Thr8172=) rs72648978
NM_001267550.2(TTN):c.24546T>A (p.Val8182=) rs397517508
NM_001267550.2(TTN):c.24588C>A (p.Gly8196=) rs1057523933
NM_001267550.2(TTN):c.24609C>T (p.Ser8203=) rs397517509
NM_001267550.2(TTN):c.24622G>A (p.Glu8208Lys) rs190192954
NM_001267550.2(TTN):c.24636A>G (p.Ser8212=) rs1553903322
NM_001267550.2(TTN):c.24652A>G (p.Ser8218Gly) rs72648980
NM_001267550.2(TTN):c.24719A>G (p.Gln8240Arg) rs747625896
NM_001267550.2(TTN):c.24729C>T (p.Cys8243=) rs751527077
NM_001267550.2(TTN):c.24756T>G (p.Asp8252Glu) rs764248656
NM_001267550.2(TTN):c.24785-3T>C rs771432456
NM_001267550.2(TTN):c.24795C>T (p.Tyr8265=) rs776344275
NM_001267550.2(TTN):c.24820G>A (p.Glu8274Lys) rs72648981
NM_001267550.2(TTN):c.24833G>C (p.Gly8278Ala) rs778611558
NM_001267550.2(TTN):c.24867A>G (p.Gly8289=) rs1553902696
NM_001267550.2(TTN):c.24879T>C (p.Ile8293=) rs1221548315
NM_001267550.2(TTN):c.24880A>G (p.Arg8294Gly) rs72648982
NM_001267550.2(TTN):c.24888T>C (p.Ser8296=) rs535603112
NM_001267550.2(TTN):c.24909G>A (p.Lys8303=) rs72648983
NM_001267550.2(TTN):c.24927A>G (p.Ala8309=) rs1179963628
NM_001267550.2(TTN):c.2493+119G>A
NM_001267550.2(TTN):c.2493+6_2493+8del rs1238359547
NM_001267550.2(TTN):c.24952G>A (p.Val8318Ile) rs200103997
NM_001267550.2(TTN):c.24957T>C (p.Ala8319=) rs758868965
NM_001267550.2(TTN):c.24960C>T (p.Ser8320=) rs1057522331
NM_001267550.2(TTN):c.24964G>T (p.Val8322Leu) rs201571580
NM_001267550.2(TTN):c.24972C>A (p.Asn8324Lys) rs879030954
NM_001267550.2(TTN):c.24973A>G (p.Lys8325Glu) rs72648984
NM_001267550.2(TTN):c.25002T>C (p.Tyr8334=) rs371334680
NM_001267550.2(TTN):c.25005A>C (p.Ser8335=) rs879229692
NM_001267550.2(TTN):c.25023T>A (p.Ser8341Arg) rs1221926854
NM_001267550.2(TTN):c.25041T>C (p.Ser8347=) rs397517512
NM_001267550.2(TTN):c.2505C>T (p.Ala835=) rs754725705
NM_001267550.2(TTN):c.25063+18C>T rs541890371
NM_001267550.2(TTN):c.25064C>A (p.Ala8355Glu) rs2627043
NM_001267550.2(TTN):c.25065G>A (p.Ala8355=) rs397517514
NM_001267550.2(TTN):c.25066C>T (p.Arg8356Cys) rs201810836
NM_001267550.2(TTN):c.25087G>T (p.Ala8363Ser) rs200972189
NM_001267550.2(TTN):c.25134A>G (p.Ala8378=) rs371819104
NM_001267550.2(TTN):c.25155C>T (p.Gly8385=) rs772383867
NM_001267550.2(TTN):c.25209T>C (p.Asp8403=) rs569860898
NM_001267550.2(TTN):c.25223C>T (p.Thr8408Ile) rs201432372
NM_001267550.2(TTN):c.25274G>A (p.Ser8425Asn) rs13390491
NM_001267550.2(TTN):c.25296C>T (p.Cys8432=) rs375720439
NM_001267550.2(TTN):c.25351+13C>G rs138362885
NM_001267550.2(TTN):c.25351+20del rs749062982
NM_001267550.2(TTN):c.25351+7A>G rs753224694
NM_001267550.2(TTN):c.25392A>C (p.Ser8464=) rs766560212
NM_001267550.2(TTN):c.25398T>A (p.Asp8466Glu) rs72648986
NM_001267550.2(TTN):c.25481G>A (p.Arg8494Gln) rs201418615
NM_001267550.2(TTN):c.25490G>A (p.Arg8497His) rs149855485
NM_001267550.2(TTN):c.25545T>C (p.Val8515=) rs397517515
NM_001267550.2(TTN):c.25546C>G (p.Leu8516Val)
NM_001267550.2(TTN):c.25563C>T (p.Gly8521=) rs556205722
NM_001267550.2(TTN):c.25569C>T (p.Ala8523=) rs375022009
NM_001267550.2(TTN):c.25600G>A (p.Ala8534Thr) rs779163897
NM_001267550.2(TTN):c.25619C>T (p.Ser8540Phe) rs201523784
NM_001267550.2(TTN):c.25626G>T (p.Gln8542His) rs2562832
NM_001267550.2(TTN):c.25637A>G (p.Gln8546Arg) rs548471822
NM_001267550.2(TTN):c.25639+11G>C rs1054934179
NM_001267550.2(TTN):c.25639+7G>C rs1365164180
NM_001267550.2(TTN):c.25640-247A>C
NM_001267550.2(TTN):c.25640-8T>C rs1184501172
NM_001267550.2(TTN):c.2568C>T (p.Thr856=) rs1282647790
NM_001267550.2(TTN):c.25704G>A (p.Arg8568=) rs150544093
NM_001267550.2(TTN):c.25707T>C (p.Tyr8569=) rs2742329
NM_001267550.2(TTN):c.25758C>T (p.Asp8586=) rs372802604
NM_001267550.2(TTN):c.25921+10C>T rs10183237
NM_001267550.2(TTN):c.25937G>A (p.Arg8646His) rs144587343
NM_001267550.2(TTN):c.2596C>A (p.Pro866Thr) rs1320484376
NM_001267550.2(TTN):c.25978G>A (p.Val8660Ile) rs141856116
NM_001267550.2(TTN):c.2599A>G (p.Ser867Gly) rs148631577
NM_001267550.2(TTN):c.26019C>T (p.His8673=) rs370266918
NM_001267550.2(TTN):c.26055C>T (p.Ser8685=) rs727505250
NM_001267550.2(TTN):c.26064G>A (p.Lys8688=) rs1057523745
NM_001267550.2(TTN):c.26067C>T (p.Tyr8689=) rs377125716
NM_001267550.2(TTN):c.2607T>C (p.Thr869=) rs143969192
NM_001267550.2(TTN):c.26091A>T (p.Leu8697=) rs2562836
NM_001267550.2(TTN):c.26094C>A (p.Thr8698=) rs1553897341
NM_001267550.2(TTN):c.26116G>A (p.Asp8706Asn) rs377074955
NM_001267550.2(TTN):c.2611G>T (p.Val871Leu) rs72647861
NM_001267550.2(TTN):c.26120C>T (p.Ala8707Val) rs773760649
NM_001267550.2(TTN):c.26148A>G (p.Lys8716=) rs778772942
NM_001267550.2(TTN):c.26157T>C (p.Asn8719=) rs878854294
NM_001267550.2(TTN):c.26161G>A (p.Val8721Met) rs777730788
NM_001267550.2(TTN):c.26169C>T (p.Ser8723=) rs1304915212
NM_001267550.2(TTN):c.26201-11dup rs727503644
NM_001267550.2(TTN):c.26201-13C>T rs727505138
NM_001267550.2(TTN):c.26221A>G (p.Lys8741Glu) rs538959125
NM_001267550.2(TTN):c.26245G>A (p.Val8749Ile) rs16866457
NM_001267550.2(TTN):c.26257G>A (p.Val8753Ile) rs373070956
NM_001267550.2(TTN):c.26281G>A (p.Gly8761Ser) rs369385294
NM_001267550.2(TTN):c.26283C>T (p.Gly8761=) rs376046284
NM_001267550.2(TTN):c.26289A>G (p.Glu8763=) rs2562838
NM_001267550.2(TTN):c.2629C>A (p.Pro877Thr) rs751640052
NM_001267550.2(TTN):c.26329G>A (p.Val8777Ile) rs376823283
NM_001267550.2(TTN):c.26380T>G (p.Leu8794Val)
NM_001267550.2(TTN):c.26397G>A (p.Val8799=) rs1445714877
NM_001267550.2(TTN):c.26408A>G (p.Asn8803Ser) rs12693164
NM_001267550.2(TTN):c.26439C>T (p.Asn8813=) rs200088963
NM_001267550.2(TTN):c.26463C>T (p.Phe8821=) rs551600321
NM_001267550.2(TTN):c.26466C>G (p.Ala8822=) rs140003804
NM_001267550.2(TTN):c.26468C>T (p.Thr8823Met) rs368151971
NM_001267550.2(TTN):c.26481C>T (p.Leu8827=)
NM_001267550.2(TTN):c.26483-7A>C rs1057524590
NM_001267550.2(TTN):c.26494A>G (p.Ile8832Val) rs72648989
NM_001267550.2(TTN):c.2649C>T (p.Phe883=) rs775588479
NM_001267550.2(TTN):c.2650G>A (p.Ala884Thr) rs772195446
NM_001267550.2(TTN):c.26528C>T (p.Thr8843Met) rs72648990
NM_001267550.2(TTN):c.26544C>T (p.Thr8848=) rs1185075181
NM_001267550.2(TTN):c.26553T>C (p.Cys8851=) rs1553895388
NM_001267550.2(TTN):c.2656A>G (p.Thr886Ala)
NM_001267550.2(TTN):c.26600G>A (p.Gly8867Glu) rs369142169
NM_001267550.2(TTN):c.26605G>A (p.Glu8869Lys)
NM_001267550.2(TTN):c.26652A>G (p.Val8884=) rs746179492
NM_001267550.2(TTN):c.26655C>T (p.Ser8885=) rs2562839
NM_001267550.2(TTN):c.26672A>G (p.Asn8891Ser) rs146057575
NM_001267550.2(TTN):c.26681C>T (p.Pro8894Leu) rs13398235
NM_001267550.2(TTN):c.26694G>T (p.Gly8898=) rs199525540
NM_001267550.2(TTN):c.26723T>C (p.Val8908Ala)
NM_001267550.2(TTN):c.26754G>A (p.Gln8918=) rs1060503939
NM_001267550.2(TTN):c.26762-10_26762-9insTTGTTTTGTA rs1553893826
NM_001267550.2(TTN):c.26762-12_26762-11insTTTTG
NM_001267550.2(TTN):c.26762-39TTTGT[12] rs71393436
NM_001267550.2(TTN):c.26762-39TTTGT[3] rs71393436
NM_001267550.2(TTN):c.26762-39TTTGT[4] rs71393436
NM_001267550.2(TTN):c.26762-39TTTGT[5] rs71393436
NM_001267550.2(TTN):c.26762-39TTTGT[7] rs71393436
NM_001267550.2(TTN):c.26762-39TTTGT[8] rs71393436
NM_001267550.2(TTN):c.26762-9A>G rs200821070
NM_001267550.2(TTN):c.267G>A (p.Ala89=) rs577716745
NM_001267550.2(TTN):c.26814A>G (p.Leu8938=) rs764770520
NM_001267550.2(TTN):c.26818G>A (p.Gly8940Ser) rs201005813
NM_001267550.2(TTN):c.2682T>C (p.Ala894=) rs727505299
NM_001267550.2(TTN):c.26831T>C (p.Val8944Ala)
NM_001267550.2(TTN):c.26849A>G (p.Tyr8950Cys) rs199557654
NM_001267550.2(TTN):c.26863A>G (p.Ile8955Val) rs72648994
NM_001267550.2(TTN):c.26868T>C (p.Ser8956=) rs778211975
NM_001267550.2(TTN):c.26869G>A (p.Val8957Ile) rs1008014872
NM_001267550.2(TTN):c.2686G>A (p.Val896Ile) rs376768790
NM_001267550.2(TTN):c.26916C>T (p.Tyr8972=) rs762329439
NM_001267550.2(TTN):c.26928G>A (p.Leu8976=) rs370973715
NM_001267550.2(TTN):c.26932G>C (p.Asp8978His) rs773744166
NM_001267550.2(TTN):c.26940T>A (p.Thr8980=) rs1060503948
NM_001267550.2(TTN):c.26958C>T (p.Asn8986=) rs1398273084
NM_001267550.2(TTN):c.26991A>C (p.Thr8997=) rs61232800
NM_001267550.2(TTN):c.26991A>G (p.Thr8997=) rs61232800
NM_001267550.2(TTN):c.27015T>C (p.Gly9005=) rs727503643
NM_001267550.2(TTN):c.27045G>A (p.Val9015=) rs769752606
NM_001267550.2(TTN):c.27049+10C>A rs780979988
NM_001267550.2(TTN):c.27050-6G>A rs765624428
NM_001267550.2(TTN):c.27050-9del rs888604866
NM_001267550.2(TTN):c.27123C>A (p.Ile9041=) rs890920556
NM_001267550.2(TTN):c.27193T>C (p.Cys9065Arg) rs201229221
NM_001267550.2(TTN):c.27198C>G (p.Asn9066Lys) rs369529493
NM_001267550.2(TTN):c.27246T>C (p.Asp9082=) rs183503760
NM_001267550.2(TTN):c.27261A>G (p.Gly9087=) rs878854295
NM_001267550.2(TTN):c.2730C>T (p.Thr910=) rs375432172
NM_001267550.2(TTN):c.2731G>A (p.Val911Ile) rs141961878
NM_001267550.2(TTN):c.27328+14C>T rs781624389
NM_001267550.2(TTN):c.27328+16C>T rs915309849
NM_001267550.2(TTN):c.27328+5G>A rs397517521
NM_001267550.2(TTN):c.27348G>A (p.Lys9116=) rs1057524151
NM_001267550.2(TTN):c.27366C>T (p.Ser9122=) rs771307666
NM_001267550.2(TTN):c.2744G>A (p.Arg915His) rs376922544
NM_001267550.2(TTN):c.27485C>T (p.Thr9162Met) rs199793620
NM_001267550.2(TTN):c.27498G>A (p.Ser9166=) rs372528823
NM_001267550.2(TTN):c.27498G>T (p.Ser9166=) rs372528823
NM_001267550.2(TTN):c.27524C>G (p.Thr9175Arg) rs1438488035
NM_001267550.2(TTN):c.27608-11C>G rs1553890853
NM_001267550.2(TTN):c.27608-21_27608-18del rs760040610
NM_001267550.2(TTN):c.2760C>T (p.His920=) rs138788406
NM_001267550.2(TTN):c.27618T>C (p.Tyr9206=) rs1457644440
NM_001267550.2(TTN):c.2761G>A (p.Gly921Arg) rs774924294
NM_001267550.2(TTN):c.27627G>A (p.Lys9209=) rs772596751
NM_001267550.2(TTN):c.27631T>C (p.Leu9211=) rs563954136
NM_001267550.2(TTN):c.27639G>A (p.Pro9213=) rs541105227
NM_001267550.2(TTN):c.2764C>T (p.Arg922Cys) rs72647862
NM_001267550.2(TTN):c.27654T>G (p.Val9218=) rs780101457
NM_001267550.2(TTN):c.27670C>T (p.Leu9224=)
NM_001267550.2(TTN):c.2767G>A (p.Glu923Lys) rs369195237
NM_001267550.2(TTN):c.27702T>C (p.Ile9234=) rs143368674
NM_001267550.2(TTN):c.27705G>A (p.Gly9235=) rs759964251
NM_001267550.2(TTN):c.27711C>A (p.Ser9237=) rs727504749
NM_001267550.2(TTN):c.27711C>T (p.Ser9237=) rs727504749
NM_001267550.2(TTN):c.2772C>A (p.Ala924=) rs1442322525
NM_001267550.2(TTN):c.2775+19G>T rs199707799
NM_001267550.2(TTN):c.2775+4G>A rs548681281
NM_001267550.2(TTN):c.2776-14T>C rs201611946
NM_001267550.2(TTN):c.2778A>G (p.Val926=) rs886038714
NM_001267550.2(TTN):c.27807T>C (p.Ile9269=) rs1553890363
NM_001267550.2(TTN):c.2781A>C (p.Thr927=) rs55892860
NM_001267550.2(TTN):c.27825T>C (p.Tyr9275=) rs375790254
NM_001267550.2(TTN):c.27846C>T (p.Ser9282=) rs182355009
NM_001267550.2(TTN):c.27847G>A (p.Val9283Met) rs727504515
NM_001267550.2(TTN):c.27849G>A (p.Val9283=) rs397517525
NM_001267550.2(TTN):c.27879C>T (p.Thr9293=) rs751693156
NM_001267550.2(TTN):c.27886+10A>G rs397517526
NM_001267550.2(TTN):c.27886+17T>C rs376389312
NM_001267550.2(TTN):c.27887-4A>T rs1553889394
NM_001267550.2(TTN):c.27887-7C>T rs1446519993
NM_001267550.2(TTN):c.27914G>A (p.Arg9305Gln) rs397517527
NM_001267550.2(TTN):c.27915A>G (p.Arg9305=) rs367900368
NM_001267550.2(TTN):c.27947T>G (p.Leu9316Arg) rs78643968
NM_001267550.2(TTN):c.27G>A (p.Thr9=) rs760305568
NM_001267550.2(TTN):c.28014C>A (p.Gly9338=) rs200655768
NM_001267550.2(TTN):c.28042C>G (p.Gln9348Glu) rs794727987
NM_001267550.2(TTN):c.28047A>G (p.Thr9349=) rs575817028
NM_001267550.2(TTN):c.28055T>C (p.Leu9352Ser) rs776487201
NM_001267550.2(TTN):c.28070C>T (p.Thr9357Ile) rs144930507
NM_001267550.2(TTN):c.2807T>C (p.Val936Ala) rs139567470
NM_001267550.2(TTN):c.28080T>A (p.Ile9360=) rs1220122597
NM_001267550.2(TTN):c.28127C>G (p.Thr9376Arg) rs749875409
NM_001267550.2(TTN):c.28131C>T (p.Asn9377=) rs72648997
NM_001267550.2(TTN):c.28135A>T (p.Ile9379Leu)
NM_001267550.2(TTN):c.28151C>G (p.Ser9384Cys) rs760466007
NM_001267550.2(TTN):c.28170C>T (p.Leu9390=) rs149910892
NM_001267550.2(TTN):c.28174+7G>C rs1478656719
NM_001267550.2(TTN):c.28175-10C>T rs748478445
NM_001267550.2(TTN):c.28187C>T (p.Pro9396Leu) rs373065549
NM_001267550.2(TTN):c.28262C>T (p.Thr9421Met) rs375209383
NM_001267550.2(TTN):c.28269A>G (p.Thr9423=) rs550056960
NM_001267550.2(TTN):c.28275G>A (p.Pro9425=) rs1448968221
NM_001267550.2(TTN):c.28299C>G (p.Asp9433Glu) rs372608982
NM_001267550.2(TTN):c.28313G>A (p.Arg9438Gln) rs72648998
NM_001267550.2(TTN):c.28320C>T (p.Gly9440=) rs375083775
NM_001267550.2(TTN):c.2841+198T>C
NM_001267550.2(TTN):c.28425G>T (p.Val9475=) rs727503642
NM_001267550.2(TTN):c.28446T>C (p.Ala9482=) rs1270390229
NM_001267550.2(TTN):c.28463-120G>A
NM_001267550.2(TTN):c.28463-201T>C
NM_001267550.2(TTN):c.28465C>A (p.Arg9489=) rs200489972
NM_001267550.2(TTN):c.28492A>G (p.Arg9498Gly)
NM_001267550.2(TTN):c.28507G>A (p.Val9503Ile) rs202160275
NM_001267550.2(TTN):c.28509A>G (p.Val9503=) rs756229382
NM_001267550.2(TTN):c.28542G>A (p.Glu9514=) rs370604793
NM_001267550.2(TTN):c.28547G>A (p.Arg9516His) rs374156904
NM_001267550.2(TTN):c.2854G>C (p.Val952Leu) rs373848402
NM_001267550.2(TTN):c.28641C>T (p.Asn9547=) rs727505185
NM_001267550.2(TTN):c.28644G>A (p.Thr9548=) rs376744914
NM_001267550.2(TTN):c.28648G>C (p.Val9550Leu) rs879094573
NM_001267550.2(TTN):c.28653G>C (p.Leu9551=) rs876657601
NM_001267550.2(TTN):c.28662G>A (p.Arg9554=) rs2742332
NM_001267550.2(TTN):c.28677C>T (p.Asn9559=) rs775065173
NM_001267550.2(TTN):c.28678G>A (p.Asp9560Asn) rs771843862
NM_001267550.2(TTN):c.28680C>T (p.Asp9560=) rs377713076
NM_001267550.2(TTN):c.28692C>T (p.Tyr9564=) rs749105848
NM_001267550.2(TTN):c.28710T>C (p.Asn9570=) rs727504991
NM_001267550.2(TTN):c.28726C>T (p.Leu9576=) rs780753483
NM_001267550.2(TTN):c.28741A>G (p.Ile9581Val) rs371826762
NM_001267550.2(TTN):c.28754-11T>C rs146738622
NM_001267550.2(TTN):c.28754-7A>T rs398124445
NM_001267550.2(TTN):c.28754A>G (p.Glu9585Gly) rs200856239
NM_001267550.2(TTN):c.28818C>T (p.Tyr9606=) rs374117152
NM_001267550.2(TTN):c.28819G>A (p.Val9607Met) rs375807609
NM_001267550.2(TTN):c.2883C>T (p.Thr961=) rs397517541
NM_001267550.2(TTN):c.28849G>A (p.Glu9617Lys) rs144025230
NM_001267550.2(TTN):c.28909A>G (p.Ser9637Gly) rs1160550023
NM_001267550.2(TTN):c.28924A>G (p.Ser9642Gly) rs367888853
NM_001267550.2(TTN):c.28939C>T (p.Leu9647=) rs879099128
NM_001267550.2(TTN):c.28970C>T (p.Ser9657Leu) rs200049911
NM_001267550.2(TTN):c.28971G>A (p.Ser9657=) rs370903846
NM_001267550.2(TTN):c.28983G>T (p.Val9661=) rs794727991
NM_001267550.2(TTN):c.289G>A (p.Val97Met) rs185921345
NM_001267550.2(TTN):c.29079G>A (p.Ala9693=) rs372997298
NM_001267550.2(TTN):c.29115G>A (p.Gln9705=) rs773659138
NM_001267550.2(TTN):c.29128G>A (p.Val9710Ile) rs72649002
NM_001267550.2(TTN):c.29134+33C>G
NM_001267550.2(TTN):c.29142T>C (p.Thr9714=) rs773838077
NM_001267550.2(TTN):c.29153T>C (p.Ile9718Thr) rs4893852
NM_001267550.2(TTN):c.29169T>C (p.Gly9723=) rs750700619
NM_001267550.2(TTN):c.2916G>A (p.Pro972=) rs757569345
NM_001267550.2(TTN):c.29178C>A (p.Ile9726=) rs72650003
NM_001267550.2(TTN):c.29230C>T (p.Arg9744Cys) rs375266859
NM_001267550.2(TTN):c.29238C>T (p.Phe9746=) rs727503640
NM_001267550.2(TTN):c.29313C>T (p.Cys9771=) rs375017037
NM_001267550.2(TTN):c.29314G>A (p.Val9772Met) rs563073635
NM_001267550.2(TTN):c.29382A>G (p.Gln9794=) rs1057523227
NM_001267550.2(TTN):c.29397C>T (p.Gly9799=) rs770084292
NM_001267550.2(TTN):c.2940C>T (p.Asp980=) rs201395853
NM_001267550.2(TTN):c.29420+10A>G rs759753042
NM_001267550.2(TTN):c.29420+234C>T
NM_001267550.2(TTN):c.29421-19del rs1064795938
NM_001267550.2(TTN):c.29421-7T>C rs1553879938
NM_001267550.2(TTN):c.29448_29450AGA[2] (p.Glu9820del) rs377232641
NM_001267550.2(TTN):c.2949C>T (p.Ile983=) rs56310516
NM_001267550.2(TTN):c.295+15A>C rs202157373
NM_001267550.2(TTN):c.295+6C>T rs1057524454
NM_001267550.2(TTN):c.29502A>G (p.Glu9834=) rs759468315
NM_001267550.2(TTN):c.29541C>T (p.Phe9847=) rs56812642
NM_001267550.2(TTN):c.29577A>G (p.Gln9859=) rs368780181
NM_001267550.2(TTN):c.29590G>C (p.Glu9864Gln)
NM_001267550.2(TTN):c.29604+7T>C rs727503639
NM_001267550.2(TTN):c.29637C>T (p.Asp9879=) rs375591605
NM_001267550.2(TTN):c.29763T>C (p.Ile9921=) rs2742343
NM_001267550.2(TTN):c.29799G>A (p.Ser9933=) rs2742344
NM_001267550.2(TTN):c.29812A>T (p.Thr9938Ser) rs72650006
NM_001267550.2(TTN):c.29815G>C (p.Glu9939Gln) rs727503638
NM_001267550.2(TTN):c.29864G>A (p.Arg9955Gln) rs182332374
NM_001267550.2(TTN):c.29938G>A (p.Ala9980Thr) rs189286381
NM_001267550.2(TTN):c.29943C>T (p.Ser9981=) rs543490348
NM_001267550.2(TTN):c.29960T>A (p.Ile9987Asn) rs376644553
NM_001267550.2(TTN):c.29963-13A>G rs72650008
NM_001267550.2(TTN):c.2998C>T (p.Leu1000Phe) rs140953779
NM_001267550.2(TTN):c.30022A>G (p.Met10008Val) rs1553877757
NM_001267550.2(TTN):c.3002T>C (p.Met1001Thr) rs148269839
NM_001267550.2(TTN):c.3002T>G (p.Met1001Arg) rs148269839
NM_001267550.2(TTN):c.30030C>T (p.Cys10010=) rs372290430
NM_001267550.2(TTN):c.30033A>G (p.Gln10011=) rs768497622
NM_001267550.2(TTN):c.30081C>T (p.Ile10027=) rs1553877658
NM_001267550.2(TTN):c.3010G>A (p.Glu1004Lys) rs200902055
NM_001267550.2(TTN):c.30117A>G (p.Glu10039=) rs772838964
NM_001267550.2(TTN):c.30129T>C (p.His10043=) rs764724866
NM_001267550.2(TTN):c.30181A>C (p.Lys10061Gln) rs184153985
NM_001267550.2(TTN):c.3021G>A (p.Ala1007=) rs147603843
NM_001267550.2(TTN):c.30223+204C>T
NM_001267550.2(TTN):c.30224-147A>G
NM_001267550.2(TTN):c.30224-41T>G
NM_001267550.2(TTN):c.30242C>G (p.Thr10081Arg)
NM_001267550.2(TTN):c.30274C>T (p.His10092Tyr) rs72650011
NM_001267550.2(TTN):c.30282T>G (p.Ser10094=) rs886042543
NM_001267550.2(TTN):c.30309T>C (p.Phe10103=) rs762141482
NM_001267550.2(TTN):c.30433+10T>C rs763058822
NM_001267550.2(TTN):c.30433+11T>G rs199848546
NM_001267550.2(TTN):c.30433+15A>T rs371872220
NM_001267550.2(TTN):c.30444G>A (p.Ser10148=) rs367901929
NM_001267550.2(TTN):c.30450C>T (p.Ile10150=) rs761922521
NM_001267550.2(TTN):c.30454C>T (p.Arg10152Trp)
NM_001267550.2(TTN):c.30485C>T (p.Thr10162Met) rs200593368
NM_001267550.2(TTN):c.30495G>A (p.Leu10165=) rs1553874949
NM_001267550.2(TTN):c.30512-16T>A rs1553874765
NM_001267550.2(TTN):c.30512-19dup rs397517532
NM_001267550.2(TTN):c.3051T>C (p.Ala1017=) rs1185928356
NM_001267550.2(TTN):c.30539-95A>C
NM_001267550.2(TTN):c.30588G>A (p.Val10196=) rs727504524
NM_001267550.2(TTN):c.30598+6A>G rs749100259
NM_001267550.2(TTN):c.30642A>G (p.Pro10214=) rs397517533
NM_001267550.2(TTN):c.30682+10C>T rs727505022
NM_001267550.2(TTN):c.30683-17_30683-8dup rs368277751
NM_001267550.2(TTN):c.30683-61G>A
NM_001267550.2(TTN):c.30683-6_30683-3delTTTT rs368277751
NM_001267550.2(TTN):c.30697G>T (p.Val10233Leu) rs1553868860
NM_001267550.2(TTN):c.3069C>T (p.Thr1023=) rs371447978
NM_001267550.2(TTN):c.3070G>A (p.Val1024Ile) rs368770038
NM_001267550.2(TTN):c.30718G>T (p.Val10240Phe) rs111671438
NM_001267550.2(TTN):c.30754+15C>A
NM_001267550.2(TTN):c.30754+8A>G rs1060503958
NM_001267550.2(TTN):c.30768G>A (p.Lys10256=) rs762404146
NM_001267550.2(TTN):c.3086A>G (p.Tyr1029Cys) rs774126306
NM_001267550.2(TTN):c.3087T>C (p.Tyr1029=) rs55863869
NM_001267550.2(TTN):c.30888A>G (p.Lys10296=) rs587780978
NM_001267550.2(TTN):c.30921C>T (p.His10307=) rs1553864476
NM_001267550.2(TTN):c.30930G>T (p.Lys10310Asn) rs879244158
NM_001267550.2(TTN):c.30951C>T (p.Phe10317=) rs952564944
NM_001267550.2(TTN):c.30952G>A (p.Glu10318Lys) rs73038324
NM_001267550.2(TTN):c.3100G>A (p.Val1034Met) rs142951505
NM_001267550.2(TTN):c.31014T>C (p.Tyr10338=) rs397517536
NM_001267550.2(TTN):c.31034A>G (p.Tyr10345Cys) rs794729236
NM_001267550.2(TTN):c.31070A>G (p.His10357Arg)
NM_001267550.2(TTN):c.31071C>T (p.His10357=) rs368973334
NM_001267550.2(TTN):c.31149G>A (p.Glu10383=) rs727504724
NM_001267550.2(TTN):c.31156G>A (p.Glu10386Lys) rs772195716
NM_001267550.2(TTN):c.31208-13G>A rs377135196
NM_001267550.2(TTN):c.31227T>G (p.Val10409=) rs748539440
NM_001267550.2(TTN):c.31270+12G>T rs564264476
NM_001267550.2(TTN):c.31271-13A>T rs1057523378
NM_001267550.2(TTN):c.31321G>A (p.Glu10441Lys)
NM_001267550.2(TTN):c.3132C>T (p.Ala1044=) rs777315600
NM_001267550.2(TTN):c.3133G>A (p.Val1045Met) rs72647868
NM_001267550.2(TTN):c.3138T>A (p.Thr1046=) rs1060503945
NM_001267550.2(TTN):c.31399G>A (p.Val10467Ile) rs72650019
NM_001267550.2(TTN):c.31422G>A (p.Val10474=) rs72650020
NM_001267550.2(TTN):c.31426+11T>C rs901251232
NM_001267550.2(TTN):c.31426+4_31426+5del rs763616324
NM_001267550.2(TTN):c.31441A>G (p.Thr10481Ala) rs370208651
NM_001267550.2(TTN):c.31456A>T (p.Ile10486Phe) rs772882862
NM_001267550.2(TTN):c.31505C>T (p.Ser10502Leu) rs768632287
NM_001267550.2(TTN):c.31518C>T (p.Pro10506=) rs746912694
NM_001267550.2(TTN):c.3151A>G (p.Thr1051Ala)
NM_001267550.2(TTN):c.31533A>G (p.Glu10511=) rs757499228
NM_001267550.2(TTN):c.31542T>C (p.Thr10514=) rs876657602
NM_001267550.2(TTN):c.31564A>G (p.Ile10522Val) rs2042995
NM_001267550.2(TTN):c.31566T>A (p.Ile10522=) rs200239159
NM_001267550.2(TTN):c.31569C>G (p.Ser10523=) rs766691593
NM_001267550.2(TTN):c.31594+16T>C rs552832521
NM_001267550.2(TTN):c.31594+7G>C rs1057524536
NM_001267550.2(TTN):c.31595-18G>A rs1477509887
NM_001267550.2(TTN):c.31595-9C>G
NM_001267550.2(TTN):c.31678+20A>G rs1057508878
NM_001267550.2(TTN):c.31679-12G>A rs372575606
NM_001267550.2(TTN):c.3169G>A (p.Val1057Ile) rs780035225
NM_001267550.2(TTN):c.31731G>A (p.Val10577=) rs751447529
NM_001267550.2(TTN):c.31737G>A (p.Lys10579=) rs763013094
NM_001267550.2(TTN):c.31757C>A (p.Pro10586Gln) rs200459347
NM_001267550.2(TTN):c.31762+5_31762+7del rs397517538
NM_001267550.2(TTN):c.31763-20T>G rs1553853679
NM_001267550.2(TTN):c.31764C>T (p.Val10588=) rs766441395
NM_001267550.2(TTN):c.31791T>G (p.Pro10597=) rs397517539
NM_001267550.2(TTN):c.31806C>T (p.Pro10602=) rs370080995
NM_001267550.2(TTN):c.31807G>A (p.Val10603Ile) rs139790668
NM_001267550.2(TTN):c.31837C>G (p.Pro10613Ala) rs200213832
NM_001267550.2(TTN):c.31841C>A (p.Ala10614Asp) rs376754004
NM_001267550.2(TTN):c.31846+17C>T rs900359869
NM_001267550.2(TTN):c.31846+20A>G rs886038715
NM_001267550.2(TTN):c.31846+5A>G rs760788961
NM_001267550.2(TTN):c.31847-12T>C rs371372951
NM_001267550.2(TTN):c.31864G>A (p.Gly10622Arg) rs2244492
NM_001267550.2(TTN):c.31875A>C (p.Thr10625=) rs182934463
NM_001267550.2(TTN):c.31941A>G (p.Pro10647=) rs528062079
NM_001267550.2(TTN):c.31970C>T (p.Pro10657Leu)
NM_001267550.2(TTN):c.31989A>G (p.Glu10663=) rs1276917315
NM_001267550.2(TTN):c.3201T>C (p.Thr1067=) rs876657603
NM_001267550.2(TTN):c.32020C>G (p.Leu10674Val) rs766003250
NM_001267550.2(TTN):c.32025T>C (p.Pro10675=) rs369365087
NM_001267550.2(TTN):c.32035G>A (p.Val10679Ile) rs369932282
NM_001267550.2(TTN):c.32049A>G (p.Lys10683=) rs375408527
NM_001267550.2(TTN):c.32071G>A (p.Ala10691Thr) rs371452173
NM_001267550.2(TTN):c.32088T>C (p.Pro10696=) rs543069197
NM_001267550.2(TTN):c.32093G>A (p.Arg10698Gln) rs200161147
NM_001267550.2(TTN):c.32095+20T>C rs768705255
NM_001267550.2(TTN):c.32096-37C>A
NM_001267550.2(TTN):c.32152C>G (p.Leu10718Val)
NM_001267550.2(TTN):c.32186C>T (p.Thr10729Met) rs115119858
NM_001267550.2(TTN):c.32189G>A (p.Arg10730Gln) rs771054923
NM_001267550.2(TTN):c.32197+11G>A rs369265969
NM_001267550.2(TTN):c.32198-10T>C rs371121439
NM_001267550.2(TTN):c.32199A>T (p.Val10733=) rs769008912
NM_001267550.2(TTN):c.32218A>T (p.Ser10740Cys) rs758825292
NM_001267550.2(TTN):c.32225C>T (p.Ser10742Leu) rs777586144
NM_001267550.2(TTN):c.32254G>A (p.Val10752Ile) rs72650028
NM_001267550.2(TTN):c.32263_32265GAA[2] (p.Glu10757del)
NM_001267550.2(TTN):c.3228T>C (p.Pro1076=) rs876657604
NM_001267550.2(TTN):c.32311+283A>G
NM_001267550.2(TTN):c.32393-12A>G rs16866434
NM_001267550.2(TTN):c.32419G>A (p.Val10807Ile) rs1553846469
NM_001267550.2(TTN):c.3241G>A (p.Ala1081Thr) rs55914517
NM_001267550.2(TTN):c.3241G>T (p.Ala1081Ser) rs55914517
NM_001267550.2(TTN):c.32462C>T (p.Pro10821Leu) rs146400809
NM_001267550.2(TTN):c.32477A>C (p.Glu10826Ala)
NM_001267550.2(TTN):c.32480C>T (p.Ala10827Val) rs72650030
NM_001267550.2(TTN):c.32515G>T (p.Ala10839Ser) rs727503635
NM_001267550.2(TTN):c.32546C>G (p.Pro10849Arg)
NM_001267550.2(TTN):c.32554+5_32554+6del rs771419718
NM_001267550.2(TTN):c.32555-12G>T rs397517540
NM_001267550.2(TTN):c.32557C>T (p.Pro10853Ser) rs201738153
NM_001267550.2(TTN):c.32593G>C (p.Val10865Leu) rs150733188
NM_001267550.2(TTN):c.32624C>T (p.Pro10875Leu) rs72650031
NM_001267550.2(TTN):c.32648G>A (p.Arg10883Lys) rs116676813
NM_001267550.2(TTN):c.32659A>G (p.Ile10887Val)
NM_001267550.2(TTN):c.32694T>C (p.Thr10898=) rs1553844266
NM_001267550.2(TTN):c.32701G>C (p.Glu10901Gln)
NM_001267550.2(TTN):c.32703G>A (p.Glu10901=) rs397517542
NM_001267550.2(TTN):c.32706G>A (p.Ala10902=) rs372124201
NM_001267550.2(TTN):c.32722+8C>T rs765936606
NM_001267550.2(TTN):c.32731G>A (p.Glu10911Lys) rs199620003
NM_001267550.2(TTN):c.32743G>C (p.Ala10915Pro) rs72650032
NM_001267550.2(TTN):c.32806+5A>G rs755370435
NM_001267550.2(TTN):c.32807-10T>A rs138192315
NM_001267550.2(TTN):c.32881A>G (p.Ile10961Val) rs886055284
NM_001267550.2(TTN):c.32888-19G>A rs141514650
NM_001267550.2(TTN):c.32888-7G>A
NM_001267550.2(TTN):c.32953C>T (p.Arg10985Trp) rs201991864
NM_001267550.2(TTN):c.32954G>A (p.Arg10985Gln) rs181395238
NM_001267550.2(TTN):c.3295G>A (p.Val1099Met) rs368282893
NM_001267550.2(TTN):c.32970_32987del (p.10987_10989EEY[1]) rs766756026
NM_001267550.2(TTN):c.33018A>G (p.Thr11006=) rs765492188
NM_001267550.2(TTN):c.33030C>T (p.Asp11010=)
NM_001267550.2(TTN):c.33053G>A (p.Arg11018Gln) rs72650034
NM_001267550.2(TTN):c.33059A>G (p.Tyr11020Cys) rs72650035
NM_001267550.2(TTN):c.33063A>G (p.Glu11021=) rs115744476
NM_001267550.2(TTN):c.330G>A (p.Leu110=) rs778271204
NM_001267550.2(TTN):c.33111C>T (p.Ile11037=) rs374779534
NM_001267550.2(TTN):c.33113C>T (p.Pro11038Leu)
NM_001267550.2(TTN):c.33126C>T (p.Val11042=) rs72650036
NM_001267550.2(TTN):c.33127C>T (p.Pro11043Ser)
NM_001267550.2(TTN):c.33165G>A (p.Pro11055=) rs756152512
NM_001267550.2(TTN):c.33172+15del rs559323758
NM_001267550.2(TTN):c.33172+4G>A rs756475184
NM_001267550.2(TTN):c.33188T>A (p.Val11063Asp)
NM_001267550.2(TTN):c.3318C>T (p.Gly1106=) rs141768043
NM_001267550.2(TTN):c.33206C>T (p.Pro11069Leu)
NM_001267550.2(TTN):c.33225A>G (p.Lys11075=) rs1553836388
NM_001267550.2(TTN):c.33276G>A (p.Glu11092=) rs1057523198
NM_001267550.2(TTN):c.33286C>T (p.Arg11096Cys)
NM_001267550.2(TTN):c.33287G>A (p.Arg11096His) rs36051007
NM_001267550.2(TTN):c.33366C>T (p.Val11122=) rs878915517
NM_001267550.2(TTN):c.33416G>C (p.Arg11139Thr) rs72650040
NM_001267550.2(TTN):c.33418+12C>A rs199772748
NM_001267550.2(TTN):c.33498T>C (p.Leu11166=) rs886038884
NM_001267550.2(TTN):c.33501_33503AGA[4] (p.Glu11172del) rs368327166
NM_001267550.2(TTN):c.33501_33503AGA[6] (p.Glu11172dup) rs368327166
NM_001267550.2(TTN):c.33561G>T (p.Val11187=) rs763629416
NM_001267550.2(TTN):c.33573A>G (p.Pro11191=) rs1057520961
NM_001267550.2(TTN):c.33594C>T (p.Pro11198=) rs1553829479
NM_001267550.2(TTN):c.33657G>A (p.Pro11219=) rs754038093
NM_001267550.2(TTN):c.33732G>A (p.Pro11244=) rs190604150
NM_001267550.2(TTN):c.33742+8C>T rs375939001
NM_001267550.2(TTN):c.33743-15T>C rs112313732
NM_001267550.2(TTN):c.33753G>A (p.Val11251=) rs1366489829
NM_001267550.2(TTN):c.33762A>G (p.Lys11254=) rs749466171
NM_001267550.2(TTN):c.3380+9A>G rs770149480
NM_001267550.2(TTN):c.3381-275T>A
NM_001267550.2(TTN):c.33826+4C>T rs750851792
NM_001267550.2(TTN):c.33826+7G>A rs752099208
NM_001267550.2(TTN):c.33834G>A (p.Glu11278=) rs35112591
NM_001267550.2(TTN):c.33838C>T (p.Pro11280Ser) rs374449452
NM_001267550.2(TTN):c.33856G>A (p.Glu11286Lys) rs376874956
NM_001267550.2(TTN):c.33894G>A (p.Glu11298=) rs760806455
NM_001267550.2(TTN):c.33966G>A (p.Pro11322=) rs373083865
NM_001267550.2(TTN):c.33976G>C (p.Glu11326Gln)
NM_001267550.2(TTN):c.33995-5T>C rs774359312
NM_001267550.2(TTN):c.33G>A (p.Pro11=) rs138331646
NM_001267550.2(TTN):c.34026T>C (p.Pro11342=) rs775256061
NM_001267550.2(TTN):c.34038T>G (p.Pro11346=) rs375714279
NM_001267550.2(TTN):c.34051G>A (p.Val11351Ile)
NM_001267550.2(TTN):c.34062A>G (p.Glu11354=) rs886055281
NM_001267550.2(TTN):c.34098_34118GGAAGAGGAAGTTCTACCTGA[1] (p.11363_11369VLPEEEE[3]) rs397517548
NM_001267550.2(TTN):c.3409G>C (p.Gly1137Arg) rs72647870
NM_001267550.2(TTN):c.34132C>T (p.Leu11378=) rs960128787
NM_001267550.2(TTN):c.34134A>G (p.Leu11378=) rs575740245
NM_001267550.2(TTN):c.34140A>G (p.Glu11380=) rs147418835
NM_001267550.2(TTN):c.34192G>T (p.Val11398Phe) rs551911856
NM_001267550.2(TTN):c.34200C>T (p.Pro11400=) rs750587024
NM_001267550.2(TTN):c.34216C>A (p.Pro11406Thr) rs532102837
NM_001267550.2(TTN):c.34230A>G (p.Glu11410=) rs762363574
NM_001267550.2(TTN):c.34241_34243AAG[2] (p.Glu11416del) rs397517549
NM_001267550.2(TTN):c.34251C>G (p.Val11417=) rs368972294
NM_001267550.2(TTN):c.34314T>C (p.Pro11438=) rs993206696
NM_001267550.2(TTN):c.34341C>T (p.Pro11447=) rs369715093
NM_001267550.2(TTN):c.34379-14T>C rs727505341
NM_001267550.2(TTN):c.34379-15A>G rs764544769
NM_001267550.2(TTN):c.34391A>G (p.Lys11464Arg) rs786205396
NM_001267550.2(TTN):c.34412A>T (p.Lys11471Ile)
NM_001267550.2(TTN):c.34453+12C>A rs74930148
NM_001267550.2(TTN):c.34453+13C>T rs771926210
NM_001267550.2(TTN):c.34453+14G>A rs397517550
NM_001267550.2(TTN):c.3445G>A (p.Asp1149Asn) rs368967197
NM_001267550.2(TTN):c.34538-110T>C
NM_001267550.2(TTN):c.34566A>C (p.Glu11522Asp) rs140640738
NM_001267550.2(TTN):c.34571G>A (p.Arg11524Gln) rs201622536
NM_001267550.2(TTN):c.34581C>G (p.Leu11527=) rs781699559
NM_001267550.2(TTN):c.34601T>C (p.Leu11534Pro) rs376836503
NM_001267550.2(TTN):c.34612+250T>C
NM_001267550.2(TTN):c.34613-18A>G rs372828399
NM_001267550.2(TTN):c.34623G>A (p.Glu11541=) rs1553814697
NM_001267550.2(TTN):c.34641T>C (p.Ile11547=)
NM_001267550.2(TTN):c.34660_34662GAA[1] (p.Glu11555del) rs763098227
NM_001267550.2(TTN):c.34675A>G (p.Ile11559Val) rs752903377
NM_001267550.2(TTN):c.34695G>A (p.Val11565=) rs372341590
NM_001267550.2(TTN):c.34708+8C>T rs762808097
NM_001267550.2(TTN):c.34708+9G>T rs397517551
NM_001267550.2(TTN):c.34734A>G (p.Val11578=) rs866407525
NM_001267550.2(TTN):c.34735C>T (p.Pro11579Ser) rs754511830
NM_001267550.2(TTN):c.34769A>G (p.Glu11590Gly) rs201167067
NM_001267550.2(TTN):c.34841C>A (p.Ala11614Glu) rs1553810486
NM_001267550.2(TTN):c.34845C>T (p.Pro11615=) rs368781863
NM_001267550.2(TTN):c.34855+7C>T rs397517552
NM_001267550.2(TTN):c.34855+9_34855+11del rs1196572661
NM_001267550.2(TTN):c.34864G>A (p.Val11622Ile) rs202014478
NM_001267550.2(TTN):c.34931-13G>C rs1057524496
NM_001267550.2(TTN):c.34947A>G (p.Glu11649=) rs727504514
NM_001267550.2(TTN):c.34970G>A (p.Arg11657His) rs59887778
NM_001267550.2(TTN):c.35037G>A (p.Pro11679=) rs369095270
NM_001267550.2(TTN):c.35079A>G (p.Glu11693=) rs779550415
NM_001267550.2(TTN):c.35083G>A (p.Glu11695Lys) rs376117402
NM_001267550.2(TTN):c.35124T>C (p.His11708=) rs1553809060
NM_001267550.2(TTN):c.35212A>G (p.Lys11738Glu) rs1553808816
NM_001267550.2(TTN):c.3523+11C>G rs397517569
NM_001267550.2(TTN):c.3523+9A>C rs727503700
NM_001267550.2(TTN):c.3523G>A (p.Ala1175Thr) rs397517570
NM_001267550.2(TTN):c.3524-3T>C rs762717963
NM_001267550.2(TTN):c.35264A>C (p.Lys11755Thr) rs189966800
NM_001267550.2(TTN):c.35268G>A (p.Pro11756=)
NM_001267550.2(TTN):c.35292A>G (p.Lys11764=) rs750096348
NM_001267550.2(TTN):c.35313G>A (p.Pro11771=) rs369739111
NM_001267550.2(TTN):c.35319G>A (p.Val11773=) rs879029141
NM_001267550.2(TTN):c.35371G>T (p.Val11791Phe)
NM_001267550.2(TTN):c.35374C>T (p.Pro11792Ser) rs727505111
NM_001267550.2(TTN):c.35493T>C (p.Ser11831=) rs1553803616
NM_001267550.2(TTN):c.3549C>T (p.Ser1183=)
NM_001267550.2(TTN):c.35548T>A (p.Tyr11850Asn) rs145670920
NM_001267550.2(TTN):c.3577G>A (p.Val1193Met) rs727503699
NM_001267550.2(TTN):c.35876-45C>T
NM_001267550.2(TTN):c.35876-9T>C rs572783607
NM_001267550.2(TTN):c.3601A>G (p.Lys1201Glu) rs10497520
NM_001267550.2(TTN):c.3605T>C (p.Val1202Ala) rs150667217
NM_001267550.2(TTN):c.36159G>A (p.Thr12053=) rs773862719
NM_001267550.2(TTN):c.3619C>A (p.Pro1207Thr) rs373753003
NM_001267550.2(TTN):c.36202+10G>T rs765321861
NM_001267550.2(TTN):c.36254A>G (p.Gln12085Arg) rs183220684
NM_001267550.2(TTN):c.36347A>G (p.Glu12116Gly) rs200513156
NM_001267550.2(TTN):c.36405G>A (p.Val12135=) rs373815877
NM_001267550.2(TTN):c.36489G>A (p.Ala12163=) rs115493456
NM_001267550.2(TTN):c.36509A>T (p.Glu12170Val) rs200840285
NM_001267550.2(TTN):c.36618C>T (p.Val12206=) rs777734136
NM_001267550.2(TTN):c.36676A>G (p.Lys12226Glu) rs200815663
NM_001267550.2(TTN):c.36701-16A>G rs577899845
NM_001267550.2(TTN):c.36708A>T (p.Glu12236Asp) rs796478043
NM_001267550.2(TTN):c.36750G>A (p.Pro12250=) rs777458053
NM_001267550.2(TTN):c.36753G>A (p.Val12251=) rs1553788597
NM_001267550.2(TTN):c.3680A>G (p.Lys1227Arg) rs541811273
NM_001267550.2(TTN):c.36810A>G (p.Glu12270=) rs900028908
NM_001267550.2(TTN):c.36816A>T (p.Val12272=) rs1466177296
NM_001267550.2(TTN):c.36855G>A (p.Pro12285=) rs535294541
NM_001267550.2(TTN):c.36958+9C>T rs1060503964
NM_001267550.2(TTN):c.37202-9T>C rs771757256
NM_001267550.2(TTN):c.37247C>T (p.Ser12416Leu) rs370765948
NM_001267550.2(TTN):c.37248G>A (p.Ser12416=) rs201654513
NM_001267550.2(TTN):c.37369+8C>A rs1489244862
NM_001267550.2(TTN):c.37370-12A>G rs1553782234
NM_001267550.2(TTN):c.37378G>T (p.Val12460Leu) rs202241329
NM_001267550.2(TTN):c.37414G>A (p.Glu12472Lys) rs1553782108
NM_001267550.2(TTN):c.37421T>C (p.Ile12474Thr) rs72650057
NM_001267550.2(TTN):c.37473G>C (p.Pro12491=) rs556414069
NM_001267550.2(TTN):c.37525G>A (p.Glu12509Lys) rs201797790
NM_001267550.2(TTN):c.37683C>A (p.Ile12561=) rs1553780447
NM_001267550.2(TTN):c.37722T>C (p.Val12574=) rs377422414
NM_001267550.2(TTN):c.37734C>T (p.Ala12578=) rs1280095100
NM_001267550.2(TTN):c.37735G>A (p.Ala12579Thr) rs74176588
NM_001267550.2(TTN):c.37758T>A (p.Ala12586=) rs1308714314
NM_001267550.2(TTN):c.37788C>T (p.Val12596=) rs1060503943
NM_001267550.2(TTN):c.37793-12_37793-10del rs770966939
NM_001267550.2(TTN):c.37860C>T (p.Ala12620=) rs1446730289
NM_001267550.2(TTN):c.37873+9T>A rs1060503931
NM_001267550.2(TTN):c.37956G>T (p.Val12652=) rs541757326
NM_001267550.2(TTN):c.38001G>A (p.Ser12667=) rs201179474
NM_001267550.2(TTN):c.38031T>C (p.Pro12677=) rs1060503972
NM_001267550.2(TTN):c.38088T>G (p.Pro12696=) rs1553777636
NM_001267550.2(TTN):c.38161G>T (p.Val12721Leu) rs794729416
NM_001267550.2(TTN):c.38185C>T (p.Pro12729Ser) rs200495902
NM_001267550.2(TTN):c.38226G>T (p.Pro12742=) rs965565085
NM_001267550.2(TTN):c.38311A>G (p.Lys12771Glu) rs551811137
NM_001267550.2(TTN):c.38380+29T>A
NM_001267550.2(TTN):c.38505C>T (p.Pro12835=) rs745664297
NM_001267550.2(TTN):c.38545+33G>C
NM_001267550.2(TTN):c.38598C>T (p.Pro12866=) rs1553775431
NM_001267550.2(TTN):c.38707+7G>T rs752801232
NM_001267550.2(TTN):c.38708-27C>T
NM_001267550.2(TTN):c.38739A>G (p.Glu12913=) rs759128215
NM_001267550.2(TTN):c.38876-8C>T rs1060503949
NM_001267550.2(TTN):c.38898T>A (p.Val12966=) rs200432936
NM_001267550.2(TTN):c.38902C>T (p.Pro12968Ser) rs192528655
NM_001267550.2(TTN):c.38929C>T (p.Pro12977Ser) rs150223722
NM_001267550.2(TTN):c.38959+8T>G rs769254204
NM_001267550.2(TTN):c.39044-14T>C rs1177294449
NM_001267550.2(TTN):c.39044-15C>T rs749495580
NM_001267550.2(TTN):c.39044-9T>A rs184888200
NM_001267550.2(TTN):c.39045G>C (p.Val13015=) rs192464868
NM_001267550.2(TTN):c.39050A>G (p.Glu13017Gly) rs368056479
NM_001267550.2(TTN):c.39057G>A (p.Pro13019=) rs371945519
NM_001267550.2(TTN):c.39082G>A (p.Val13028Met) rs73038314
NM_001267550.2(TTN):c.39085C>A (p.Pro13029Thr) rs397517553
NM_001267550.2(TTN):c.39090G>A (p.Ala13030=) rs375519815
NM_001267550.2(TTN):c.39099T>C (p.Pro13033=) rs755793186
NM_001267550.2(TTN):c.39128-14T>C rs200916144
NM_001267550.2(TTN):c.39128-16A>G rs769738352
NM_001267550.2(TTN):c.39143A>G (p.Lys13048Arg)
NM_001267550.2(TTN):c.39166G>T (p.Val13056Leu) rs727504201
NM_001267550.2(TTN):c.39183T>A (p.Pro13061=) rs12474306
NM_001267550.2(TTN):c.39211+13A>T rs756966122
NM_001267550.2(TTN):c.39211+16G>T rs753691920
NM_001267550.2(TTN):c.39212-9C>A rs373056460
NM_001267550.2(TTN):c.39219G>A (p.Glu13073=) rs777607934
NM_001267550.2(TTN):c.39230T>C (p.Val13077Ala) rs398124449
NM_001267550.2(TTN):c.39237C>A (p.Val13079=) rs1044693629
NM_001267550.2(TTN):c.39255T>C (p.Pro13085=) rs573657954
NM_001267550.2(TTN):c.39276G>A (p.Pro13092=) rs369002632
NM_001267550.2(TTN):c.39282T>C (p.Ser13094=) rs773883685
NM_001267550.2(TTN):c.39295+16T>C rs371747911
NM_001267550.2(TTN):c.39296-18G>T rs748134833
NM_001267550.2(TTN):c.39296-4A>G rs368641171
NM_001267550.2(TTN):c.39300C>T (p.Phe13100=) rs569579388
NM_001267550.2(TTN):c.39301G>A (p.Glu13101Lys) rs201035457
NM_001267550.2(TTN):c.39366G>A (p.Ala13122=) rs769494020
NM_001267550.2(TTN):c.39368C>T (p.Ala13123Val) rs761828404
NM_001267550.2(TTN):c.39396G>A (p.Lys13132=) rs1553770142
NM_001267550.2(TTN):c.39430G>A (p.Val13144Ile) rs374394719
NM_001267550.2(TTN):c.39463+11C>T
NM_001267550.2(TTN):c.39463+16A>G rs1553769902
NM_001267550.2(TTN):c.39463+18T>G rs550378650
NM_001267550.2(TTN):c.39464-17A>G
NM_001267550.2(TTN):c.39464-7T>C rs1218973879
NM_001267550.2(TTN):c.39466C>A (p.Pro13156Thr) rs72650064
NM_001267550.2(TTN):c.39469G>A (p.Glu13157Lys) rs761974767
NM_001267550.2(TTN):c.39473T>C (p.Val13158Ala) rs1553769611
NM_001267550.2(TTN):c.39477C>T (p.Pro13159=) rs397517557
NM_001267550.2(TTN):c.39493G>A (p.Glu13165Lys) rs747566528
NM_001267550.2(TTN):c.39504G>T (p.Val13168=) rs397517558
NM_001267550.2(TTN):c.39547+19T>C rs559113689
NM_001267550.2(TTN):c.39548-8A>G rs369594816
NM_001267550.2(TTN):c.39556G>A (p.Val13186Ile) rs750201663
NM_001267550.2(TTN):c.39578A>G (p.Glu13193Gly) rs190461403
NM_001267550.2(TTN):c.39597C>A (p.Pro13199=) rs776088323
NM_001267550.2(TTN):c.39606A>G (p.Pro13202=) rs372356060
NM_001267550.2(TTN):c.39616C>T (p.Pro13206Ser) rs186404793
NM_001267550.2(TTN):c.39626-4A>G rs559564145
NM_001267550.2(TTN):c.39652T>C (p.Leu13218=) rs727505145
NM_001267550.2(TTN):c.39663A>T (p.Lys13221Asn)
NM_001267550.2(TTN):c.39689C>T (p.Ala13230Val) rs148140756
NM_001267550.2(TTN):c.39690G>A (p.Ala13230=) rs528832388
NM_001267550.2(TTN):c.39704C>G (p.Pro13235Arg) rs72650066
NM_001267550.2(TTN):c.39709+14C>T rs760314415
NM_001267550.2(TTN):c.39709+7G>A rs750763722
NM_001267550.2(TTN):c.39710-15C>T rs1057522986
NM_001267550.2(TTN):c.39731_39748TTGCTCCTGAAGAGGAAA[1] (p.13244_13249IAPEEE[1]) rs139512154
NM_001267550.2(TTN):c.39786A>G (p.Glu13262=) rs398124450
NM_001267550.2(TTN):c.39802G>T (p.Val13268Phe) rs759268958
NM_001267550.2(TTN):c.39813A>G (p.Pro13271=) rs373429851
NM_001267550.2(TTN):c.39818-9T>C rs368834130
NM_001267550.2(TTN):c.39885G>A (p.Pro13295=) rs756518824
NM_001267550.2(TTN):c.39895+16del rs761838184
NM_001267550.2(TTN):c.39895+65G>A rs72650068
NM_001267550.2(TTN):c.39895+8T>C rs990600164
NM_001267550.2(TTN):c.39936C>T (p.Val13312=) rs1259485774
NM_001267550.2(TTN):c.40017T>C (p.Pro13339=) rs1553766018
NM_001267550.2(TTN):c.40223-208G>T
NM_001267550.2(TTN):c.40227T>C (p.Arg13409=) rs3754951
NM_001267550.2(TTN):c.40250C>T (p.Pro13417Leu) rs537578226
NM_001267550.2(TTN):c.40297+8A>G rs192127273
NM_001267550.2(TTN):c.40335C>T (p.Leu13445=) rs727504696
NM_001267550.2(TTN):c.40395A>G (p.Ile13465Met) rs766145596
NM_001267550.2(TTN):c.40408+20A>G
NM_001267550.2(TTN):c.40408+3dup rs727504922
NM_001267550.2(TTN):c.40408+7_40408+10dup rs397517560
NM_001267550.2(TTN):c.40408+8del rs727504922
NM_001267550.2(TTN):c.40477+7C>G rs1553759307
NM_001267550.2(TTN):c.40478-8C>A rs1553756571
NM_001267550.2(TTN):c.40498G>T (p.Val13500Phe) rs201944202
NM_001267550.2(TTN):c.40515G>A (p.Pro13505=) rs367958537
NM_001267550.2(TTN):c.40521T>G (p.Arg13507=) rs1553756369
NM_001267550.2(TTN):c.40557C>T (p.Ser13519=) rs371178429
NM_001267550.2(TTN):c.40558G>A (p.Val13520Ile) rs587780488
NM_001267550.2(TTN):c.40576_40578GAA[3] (p.Glu13529del) rs727504199
NM_001267550.2(TTN):c.40581A>G (p.Glu13527=) rs775954427
NM_001267550.2(TTN):c.40587A>G (p.Glu13529=) rs370597107
NM_001267550.2(TTN):c.40595T>C (p.Val13532Ala) rs756446770
NM_001267550.2(TTN):c.40633+132del
NM_001267550.2(TTN):c.40650T>C (p.Pro13550=) rs1553754047
NM_001267550.2(TTN):c.40701G>A (p.Arg13567=) rs750761966
NM_001267550.2(TTN):c.40757C>T (p.Ala13586Val) rs374936958
NM_001267550.2(TTN):c.40773A>G (p.Pro13591=) rs368521608
NM_001267550.2(TTN):c.40788A>G (p.Glu13596=) rs886042511
NM_001267550.2(TTN):c.40812T>C (p.Pro13604=) rs879235662
NM_001267550.2(TTN):c.40869G>A (p.Lys13623=) rs1553752615
NM_001267550.2(TTN):c.40903G>A (p.Ala13635Thr) rs191699632
NM_001267550.2(TTN):c.40928-12_40928-8del rs1064795940
NM_001267550.2(TTN):c.40928-15T>C rs766374526
NM_001267550.2(TTN):c.40929T>C (p.Gly13643=) rs773615100
NM_001267550.2(TTN):c.40935C>T (p.Pro13645=) rs1553748565
NM_001267550.2(TTN):c.40939A>G (p.Lys13647Glu) rs777187629
NM_001267550.2(TTN):c.40973A>G (p.Lys13658Arg) rs184713215
NM_001267550.2(TTN):c.41010T>C (p.Asp13670=) rs193191368
NM_001267550.2(TTN):c.41019G>A (p.Pro13673=) rs762470432
NM_001267550.2(TTN):c.41022C>T (p.Phe13674=) rs1057522146
NM_001267550.2(TTN):c.41097C>T (p.Phe13699=) rs377131448
NM_001267550.2(TTN):c.41103C>T (p.Gly13701=) rs72650077
NM_001267550.2(TTN):c.41166C>T (p.Asp13722=) rs143049740
NM_001267550.2(TTN):c.41193G>A (p.Lys13731=) rs559968058
NM_001267550.2(TTN):c.41253C>T (p.Ser13751=) rs772643931
NM_001267550.2(TTN):c.41310G>A (p.Thr13770=) rs556498170
NM_001267550.2(TTN):c.41329+9T>C rs779075177
NM_001267550.2(TTN):c.41330-6C>T rs776172577
NM_001267550.2(TTN):c.41402G>A (p.Ser13801Asn) rs757590541
NM_001267550.2(TTN):c.41419G>C (p.Glu13807Gln)
NM_001267550.2(TTN):c.41487C>T (p.Gly13829=) rs531726095
NM_001267550.2(TTN):c.41488G>A (p.Val13830Ile) rs149059189
NM_001267550.2(TTN):c.41490C>T (p.Val13830=) rs397517564
NM_001267550.2(TTN):c.41508T>C (p.Ala13836=) rs55847232
NM_001267550.2(TTN):c.41521G>A (p.Asp13841Asn) rs201257644
NM_001267550.2(TTN):c.41562G>C (p.Val13854=) rs1553746360
NM_001267550.2(TTN):c.41568C>T (p.Asn13856=) rs559906667
NM_001267550.2(TTN):c.41596G>A (p.Val13866Ile) rs375474669
NM_001267550.2(TTN):c.415C>A (p.Arg139=)
NM_001267550.2(TTN):c.41609-6A>G rs754210075
NM_001267550.2(TTN):c.41703T>C (p.Thr13901=) rs756282138
NM_001267550.2(TTN):c.41744C>T (p.Ala13915Val) rs371426048
NM_001267550.2(TTN):c.41810C>T (p.Ala13937Val) rs545806408
NM_001267550.2(TTN):c.41812A>G (p.Met13938Val) rs201725483
NM_001267550.2(TTN):c.41862C>T (p.Tyr13954=) rs1553745330
NM_001267550.2(TTN):c.41920G>A (p.Val13974Ile) rs373881831
NM_001267550.2(TTN):c.41931T>C (p.Tyr13977=) rs369128249
NM_001267550.2(TTN):c.41946A>G (p.Ala13982=) rs1553744923
NM_001267550.2(TTN):c.41958A>G (p.Ala13986=) rs186699871
NM_001267550.2(TTN):c.41982T>C (p.Pro13994=) rs777609108
NM_001267550.2(TTN):c.42051A>T (p.Gly14017=)
NM_001267550.2(TTN):c.42056G>A (p.Arg14019His) rs374683153
NM_001267550.2(TTN):c.42071A>G (p.His14024Arg) rs2288563
NM_001267550.2(TTN):c.42151+17A>G rs546392087
NM_001267550.2(TTN):c.42219C>T (p.Phe14073=) rs150612172
NM_001267550.2(TTN):c.42270T>C (p.Asp14090=) rs753099769
NM_001267550.2(TTN):c.42292T>C (p.Phe14098Leu)
NM_001267550.2(TTN):c.42304G>A (p.Ala14102Thr) rs72650080
NM_001267550.2(TTN):c.42329T>C (p.Val14110Ala) rs34706299
NM_001267550.2(TTN):c.42365A>G (p.Tyr14122Cys) rs756627487
NM_001267550.2(TTN):c.42468T>C (p.Gly14156=) rs774061049
NM_001267550.2(TTN):c.42483T>C (p.Phe14161=)
NM_001267550.2(TTN):c.42486T>C (p.Val14162=) rs763151045
NM_001267550.2(TTN):c.42561A>C (p.Val14187=) rs1057521315
NM_001267550.2(TTN):c.42672G>T (p.Leu14224=) rs368155350
NM_001267550.2(TTN):c.42687C>T (p.Ala14229=) rs775889693
NM_001267550.2(TTN):c.42688G>A (p.Asp14230Asn) rs371995464
NM_001267550.2(TTN):c.426C>T (p.Ala142=) rs56137037
NM_001267550.2(TTN):c.42750G>A (p.Leu14250=) rs1273953637
NM_001267550.2(TTN):c.42762G>C (p.Val14254=) rs747807093
NM_001267550.2(TTN):c.42783A>G (p.Lys14261=) rs16866425
NM_001267550.2(TTN):c.42795T>C (p.Asp14265=) rs750211026
NM_001267550.2(TTN):c.42807T>C (p.Ile14269=) rs778681091
NM_001267550.2(TTN):c.42840T>G (p.Asp14280Glu) rs760643071
NM_001267550.2(TTN):c.42891C>T (p.Gly14297=) rs550471556
NM_001267550.2(TTN):c.42892G>A (p.Glu14298Lys) rs778634417
NM_001267550.2(TTN):c.42933T>C (p.Asn14311=) rs148528251
NM_001267550.2(TTN):c.42940G>A (p.Val14314Ile) rs376881525
NM_001267550.2(TTN):c.42946+11C>T rs372909189
NM_001267550.2(TTN):c.42958A>G (p.Lys14320Glu) rs6723526
NM_001267550.2(TTN):c.42978C>T (p.Tyr14326=) rs369959066
NM_001267550.2(TTN):c.429A>G (p.Glu143=) rs878966869
NM_001267550.2(TTN):c.42C>T (p.Ser14=) rs925948430
NM_001267550.2(TTN):c.43002A>C (p.Glu14334Asp) rs794729237
NM_001267550.2(TTN):c.43044C>T (p.His14348=) rs1060503970
NM_001267550.2(TTN):c.43138T>C (p.Cys14380Arg) rs557125278
NM_001267550.2(TTN):c.43146G>A (p.Leu14382=) rs751236287
NM_001267550.2(TTN):c.43167C>T (p.Ser14389=) rs375780439
NM_001267550.2(TTN):c.43170C>T (p.Phe14390=) rs776508398
NM_001267550.2(TTN):c.43185C>T (p.Ala14395=) rs1057519234
NM_001267550.2(TTN):c.43188A>G (p.Lys14396=) rs1057523718
NM_001267550.2(TTN):c.43213+16C>T rs1057520390
NM_001267550.2(TTN):c.43244G>A (p.Ser14415Asn) rs370342831
NM_001267550.2(TTN):c.43260C>T (p.Phe14420=) rs372382546
NM_001267550.2(TTN):c.43281T>C (p.Phe14427=) rs368161055
NM_001267550.2(TTN):c.43417G>C (p.Asp14473His) rs397517573
NM_001267550.2(TTN):c.43480+19T>C rs1346343042
NM_001267550.2(TTN):c.43481-16dup rs730880350
NM_001267550.2(TTN):c.43488G>A (p.Arg14496=) rs56034831
NM_001267550.2(TTN):c.43502C>G (p.Thr14501Ser) rs115825044
NM_001267550.2(TTN):c.43521T>C (p.Thr14507=) rs762655778
NM_001267550.2(TTN):c.43565A>G (p.His14522Arg) rs374085402
NM_001267550.2(TTN):c.43577G>A (p.Arg14526Gln) rs373491468
NM_001267550.2(TTN):c.43596T>C (p.Asn14532=) rs16866423
NM_001267550.2(TTN):c.43603C>T (p.Arg14535Cys) rs12471771
NM_001267550.2(TTN):c.43623G>A (p.Ser14541=) rs369434563
NM_001267550.2(TTN):c.43656G>A (p.Ser14552=) rs376851369
NM_001267550.2(TTN):c.43690T>A (p.Ser14564Thr) rs181189778
NM_001267550.2(TTN):c.43704A>G (p.Val14568=) rs368783829
NM_001267550.2(TTN):c.43748-4G>A rs1301078575
NM_001267550.2(TTN):c.43748-7C>T rs771927358
NM_001267550.2(TTN):c.43755C>T (p.Asp14585=) rs759486529
NM_001267550.2(TTN):c.43761T>C (p.Tyr14587=) rs397517574
NM_001267550.2(TTN):c.43836A>G (p.Ala14612=) rs755492644
NM_001267550.2(TTN):c.43986T>G (p.Asp14662Glu) rs201390600
NM_001267550.2(TTN):c.43G>A (p.Val15Ile) rs201857541
NM_001267550.2(TTN):c.44014+15A>C rs876657605
NM_001267550.2(TTN):c.44036G>A (p.Arg14679Gln) rs369709751
NM_001267550.2(TTN):c.44040C>A (p.Pro14680=) rs397517575
NM_001267550.2(TTN):c.44076A>T (p.Ala14692=) rs535734890
NM_001267550.2(TTN):c.44077C>T (p.Arg14693Cys) rs200445568
NM_001267550.2(TTN):c.44088C>G (p.Thr14696=) rs749706106
NM_001267550.2(TTN):c.44112C>T (p.His14704=) rs754693395
NM_001267550.2(TTN):c.44155-10G>C rs1044877599
NM_001267550.2(TTN):c.44157T>C (p.Asp14719=) rs760908766
NM_001267550.2(TTN):c.44210G>T (p.Arg14737Leu) rs373298007
NM_001267550.2(TTN):c.44281+14A>G rs745533972
NM_001267550.2(TTN):c.44281+170G>A
NM_001267550.2(TTN):c.44281+8T>C rs369121980
NM_001267550.2(TTN):c.44281C>T (p.Pro14761Ser) rs192766485
NM_001267550.2(TTN):c.44282-150G>A
NM_001267550.2(TTN):c.44282-8T>C rs776808322
NM_001267550.2(TTN):c.44319C>A (p.Val14773=) rs1057522804
NM_001267550.2(TTN):c.44323G>C (p.Val14775Leu)
NM_001267550.2(TTN):c.44331A>G (p.Ala14777=) rs1316025017
NM_001267550.2(TTN):c.44349C>T (p.Phe14783=) rs367744803
NM_001267550.2(TTN):c.44367C>T (p.Tyr14789=) rs750270873
NM_001267550.2(TTN):c.44418C>T (p.Ser14806=) rs368005198
NM_001267550.2(TTN):c.44423A>C (p.Lys14808Thr) rs374419129
NM_001267550.2(TTN):c.44490T>C (p.Ala14830=) rs1060503932
NM_001267550.2(TTN):c.44497G>A (p.Val14833Ile) rs373168798
NM_001267550.2(TTN):c.44529C>T (p.His14843=) rs55973744
NM_001267550.2(TTN):c.44548+9A>G rs372725070
NM_001267550.2(TTN):c.44589G>A (p.Thr14863=) rs369800903
NM_001267550.2(TTN):c.44592C>T (p.Val14864=) rs397517578
NM_001267550.2(TTN):c.44593G>A (p.Glu14865Lys) rs543102139
NM_001267550.2(TTN):c.44599G>A (p.Gly14867Arg) rs144848584
NM_001267550.2(TTN):c.44645A>C (p.Lys14882Thr)
NM_001267550.2(TTN):c.44667G>C (p.Gly14889=) rs746287950
NM_001267550.2(TTN):c.44691G>A (p.Lys14897=) rs755769210
NM_001267550.2(TTN):c.44706T>C (p.Ala14902=) rs766958603
NM_001267550.2(TTN):c.44745C>A (p.Thr14915=) rs762145326
NM_001267550.2(TTN):c.44775T>C (p.Asp14925=) rs879210476
NM_001267550.2(TTN):c.44784T>C (p.Asp14928=) rs186105748
NM_001267550.2(TTN):c.44813T>C (p.Val14938Ala) rs571522834
NM_001267550.2(TTN):c.44815+175A>T
NM_001267550.2(TTN):c.44815+176A>C
NM_001267550.2(TTN):c.44816-11T>C rs1553721449
NM_001267550.2(TTN):c.44833T>C (p.Leu14945=) rs746441554
NM_001267550.2(TTN):c.44890G>A (p.Glu14964Lys)
NM_001267550.2(TTN):c.44900G>A (p.Arg14967Gln) rs752671402
NM_001267550.2(TTN):c.44916T>A (p.Val14972=) rs373390402
NM_001267550.2(TTN):c.44937T>C (p.Ala14979=) rs370413913
NM_001267550.2(TTN):c.44937T>G (p.Ala14979=) rs370413913
NM_001267550.2(TTN):c.44978G>A (p.Gly14993Glu) rs200931793
NM_001267550.2(TTN):c.45003C>T (p.Asn15001=) rs727505079
NM_001267550.2(TTN):c.45053C>A (p.Ala15018Glu) rs72677221
NM_001267550.2(TTN):c.45053C>T (p.Ala15018Val) rs72677221
NM_001267550.2(TTN):c.45054G>A (p.Ala15018=) rs781392140
NM_001267550.2(TTN):c.45083-12C>T rs377143579
NM_001267550.2(TTN):c.45083-19_45083-15del rs781409618
NM_001267550.2(TTN):c.45120T>C (p.Ile15040=) rs74580375
NM_001267550.2(TTN):c.45174C>T (p.Gly15058=) rs372609980
NM_001267550.2(TTN):c.45175G>A (p.Ala15059Thr) rs144668626
NM_001267550.2(TTN):c.45206A>T (p.Glu15069Val) rs114331773
NM_001267550.2(TTN):c.45273C>T (p.Asn15091=) rs72677223
NM_001267550.2(TTN):c.45310C>T (p.Leu15104Phe) rs370782950
NM_001267550.2(TTN):c.45328G>A (p.Asp15110Asn) rs17354992
NM_001267550.2(TTN):c.45350-11T>C rs940979956
NM_001267550.2(TTN):c.45408G>T (p.Lys15136Asn) rs72677225
NM_001267550.2(TTN):c.45414A>G (p.Glu15138=) rs1559878378
NM_001267550.2(TTN):c.45499G>A (p.Val15167Ile) rs183245562
NM_001267550.2(TTN):c.45526C>T (p.Leu15176=) rs61004744
NM_001267550.2(TTN):c.45546A>G (p.Thr15182=) rs1553717666
NM_001267550.2(TTN):c.45585C>T (p.Ala15195=) rs780415755
NM_001267550.2(TTN):c.45591A>G (p.Arg15197=) rs777451653
NM_001267550.2(TTN):c.45598G>A (p.Ala15200Thr) rs752318420
NM_001267550.2(TTN):c.45606G>A (p.Leu15202=) rs397517581
NM_001267550.2(TTN):c.45615T>A (p.Ile15205=) rs570314896
NM_001267550.2(TTN):c.45630C>T (p.Ile15210=)
NM_001267550.2(TTN):c.45631G>A (p.Val15211Ile) rs1387120198
NM_001267550.2(TTN):c.45673G>A (p.Val15225Ile)
NM_001267550.2(TTN):c.45738T>C (p.Ala15246=) rs2303829
NM_001267550.2(TTN):c.45759C>T (p.Tyr15253=) rs760747130
NM_001267550.2(TTN):c.45760A>T (p.Ile15254Phe) rs72677226
NM_001267550.2(TTN):c.45779T>C (p.Leu15260Pro) rs552053581
NM_001267550.2(TTN):c.45895+10T>A rs373140286
NM_001267550.2(TTN):c.45945G>A (p.Glu15315=) rs774122600
NM_001267550.2(TTN):c.45994C>T (p.Leu15332=) rs765663809
NM_001267550.2(TTN):c.46035C>T (p.Asn15345=)
NM_001267550.2(TTN):c.46142T>C (p.Val15381Ala) rs369269320
NM_001267550.2(TTN):c.46147G>C (p.Glu15383Gln) rs773073914
NM_001267550.2(TTN):c.46222G>A (p.Ala15408Thr) rs730880239
NM_001267550.2(TTN):c.46273A>C (p.Arg15425=) rs753808735
NM_001267550.2(TTN):c.46351G>T (p.Asp15451Tyr)
NM_001267550.2(TTN):c.46353T>C (p.Asp15451=) rs373160538
NM_001267550.2(TTN):c.46359G>A (p.Arg15453=) rs1553714751
NM_001267550.2(TTN):c.46362G>C (p.Leu15454=) rs964036554
NM_001267550.2(TTN):c.46386C>T (p.Cys15462=) rs147703145
NM_001267550.2(TTN):c.46429+12G>A rs1057524124
NM_001267550.2(TTN):c.46429+8T>C rs1392048853
NM_001267550.2(TTN):c.46430-8C>T rs773395217
NM_001267550.2(TTN):c.46451G>A (p.Arg15484Lys) rs72677229
NM_001267550.2(TTN):c.46489G>T (p.Val15497Phe) rs371299188
NM_001267550.2(TTN):c.46557T>G (p.Val15519=) rs727503626
NM_001267550.2(TTN):c.46569T>C (p.Asp15523=) rs1553713980
NM_001267550.2(TTN):c.46580T>A (p.Met15527Lys) rs77496539
NM_001267550.2(TTN):c.46659C>G (p.Ala15553=) rs876657606
NM_001267550.2(TTN):c.46677A>G (p.Arg15559=) rs1057522659
NM_001267550.2(TTN):c.46693G>T (p.Ala15565Ser) rs145520397
NM_001267550.2(TTN):c.46697-14A>C rs371310030
NM_001267550.2(TTN):c.46697-19_46697-18del rs530484268
NM_001267550.2(TTN):c.46746C>A (p.Gly15582=) rs759938870
NM_001267550.2(TTN):c.46823T>C (p.Leu15608Ser) rs397517588
NM_001267550.2(TTN):c.46847C>T (p.Thr15616Met) rs368057764
NM_001267550.2(TTN):c.46880C>T (p.Ala15627Val) rs115813214
NM_001267550.2(TTN):c.46884G>A (p.Lys15628=) rs760251812
NM_001267550.2(TTN):c.46899G>A (p.Gly15633=) rs727504195
NM_001267550.2(TTN):c.46928A>G (p.His15643Arg) rs368502650
NM_001267550.2(TTN):c.47077G>A (p.Val15693Ile) rs201717871
NM_001267550.2(TTN):c.47128C>T (p.Arg15710Cys) rs370669650
NM_001267550.2(TTN):c.47129G>A (p.Arg15710His)
NM_001267550.2(TTN):c.47133A>G (p.Ala15711=) rs573218266
NM_001267550.2(TTN):c.47191C>T (p.Arg15731Cys) rs72677231
NM_001267550.2(TTN):c.47196G>C (p.Val15732=) rs369979598
NM_001267550.2(TTN):c.47217C>T (p.Gly15739=) rs373305832
NM_001267550.2(TTN):c.47248G>A (p.Val15750Ile) rs72677232
NM_001267550.2(TTN):c.47269+10T>G rs1060503966
NM_001267550.2(TTN):c.47315G>A (p.Arg15772Gln) rs72677233
NM_001267550.2(TTN):c.47316A>G (p.Arg15772=) rs367818218
NM_001267550.2(TTN):c.47379C>T (p.Tyr15793=) rs374281025
NM_001267550.2(TTN):c.47380G>A (p.Val15794Ile) rs727504878
NM_001267550.2(TTN):c.47400G>A (p.Lys15800=) rs114145817
NM_001267550.2(TTN):c.47430T>C (p.Thr15810=) rs373878153
NM_001267550.2(TTN):c.47458G>C (p.Val15820Leu) rs1553710237
NM_001267550.2(TTN):c.47481G>A (p.Gln15827=)
NM_001267550.2(TTN):c.474C>G (p.Leu158=) rs149574119
NM_001267550.2(TTN):c.47513G>A (p.Arg15838Gln) rs199640194
NM_001267550.2(TTN):c.47545C>A (p.Pro15849Thr) rs146181477
NM_001267550.2(TTN):c.47573-62C>T
NM_001267550.2(TTN):c.47598A>G (p.Leu15866=) rs879099244
NM_001267550.2(TTN):c.47676A>G (p.Leu15892=) rs761412068
NM_001267550.2(TTN):c.47712T>C (p.Asp15904=) rs1397706325
NM_001267550.2(TTN):c.47737C>T (p.Leu15913Phe) rs138576504
NM_001267550.2(TTN):c.47767G>A (p.Gly15923Arg) rs371943746
NM_001267550.2(TTN):c.47802A>C (p.Val15934=) rs1553708481
NM_001267550.2(TTN):c.47859C>T (p.Thr15953=) rs769989672
NM_001267550.2(TTN):c.47875+8G>A rs144688960
NM_001267550.2(TTN):c.47936C>T (p.Pro15979Leu) rs184815126
NM_001267550.2(TTN):c.47955A>G (p.Pro15985=) rs192953152
NM_001267550.2(TTN):c.47978C>A (p.Thr15993Asn) rs727503622
NM_001267550.2(TTN):c.47998G>C (p.Asp16000His) rs201388509
NM_001267550.2(TTN):c.48021C>T (p.Asp16007=) rs368404578
NM_001267550.2(TTN):c.48054C>T (p.Ala16018=) rs779940754
NM_001267550.2(TTN):c.48143T>C (p.Ile16048Thr) rs749678590
NM_001267550.2(TTN):c.48161-11dup rs730880371
NM_001267550.2(TTN):c.48161-4del rs730880371
NM_001267550.2(TTN):c.48213A>C (p.Ser16071=) rs763351197
NM_001267550.2(TTN):c.48246T>C (p.Asp16082=) rs771542149
NM_001267550.2(TTN):c.48268T>A (p.Tyr16090Asn) rs1553706860
NM_001267550.2(TTN):c.48270C>T (p.Tyr16090=) rs397517592
NM_001267550.2(TTN):c.48271G>A (p.Val16091Ile) rs369143612
NM_001267550.2(TTN):c.48312+173A>G
NM_001267550.2(TTN):c.48353A>G (p.Asp16118Gly) rs376273101
NM_001267550.2(TTN):c.48394C>T (p.Arg16132Cys) rs2303830
NM_001267550.2(TTN):c.48432T>C (p.Asp16144=) rs776643336
NM_001267550.2(TTN):c.48451A>G (p.Thr16151Ala) rs186497293
NM_001267550.2(TTN):c.48461-7G>A rs548241708
NM_001267550.2(TTN):c.48462G>A (p.Thr16154=) rs202141158
NM_001267550.2(TTN):c.48478G>A (p.Glu16160Lys)
NM_001267550.2(TTN):c.48509A>G (p.Asn16170Ser) rs370809363
NM_001267550.2(TTN):c.48589C>T (p.Arg16197Cys) rs748917057
NM_001267550.2(TTN):c.48624T>C (p.Pro16208=) rs72677240
NM_001267550.2(TTN):c.48639-15T>G rs886038716
NM_001267550.2(TTN):c.48683G>A (p.Arg16228His) rs368806005
NM_001267550.2(TTN):c.48727C>T (p.Pro16243Ser) rs72677242
NM_001267550.2(TTN):c.48760+11T>C rs759878678
NM_001267550.2(TTN):c.48768A>G (p.Pro16256=)
NM_001267550.2(TTN):c.48781G>A (p.Asp16261Asn) rs764203042
NM_001267550.2(TTN):c.48783T>C (p.Asp16261=) rs574915586
NM_001267550.2(TTN):c.48843C>T (p.Thr16281=) rs547682223
NM_001267550.2(TTN):c.48849C>T (p.Thr16283=) rs768147224
NM_001267550.2(TTN):c.48879A>T (p.Thr16293=) rs1553703542
NM_001267550.2(TTN):c.48915T>A (p.Ile16305=) rs752761527
NM_001267550.2(TTN):c.48952A>G (p.Ile16318Val) rs962564634
NM_001267550.2(TTN):c.48953T>C (p.Ile16318Thr) rs72677243
NM_001267550.2(TTN):c.48960T>C (p.Asp16320=) rs1057523898
NM_001267550.2(TTN):c.48987T>C (p.Tyr16329=) rs773944885
NM_001267550.2(TTN):c.48996G>A (p.Glu16332=) rs72677244
NM_001267550.2(TTN):c.49008G>A (p.Val16336=) rs781078888
NM_001267550.2(TTN):c.49015C>T (p.Arg16339Trp) rs201793958
NM_001267550.2(TTN):c.49041C>T (p.Asn16347=) rs369981635
NM_001267550.2(TTN):c.49049-6A>T rs1012199109
NM_001267550.2(TTN):c.49152A>C (p.Thr16384=)
NM_001267550.2(TTN):c.49213G>A (p.Val16405Ile)
NM_001267550.2(TTN):c.49263C>T (p.Tyr16421=) rs376188859
NM_001267550.2(TTN):c.49278T>C (p.Ala16426=) rs372633280
NM_001267550.2(TTN):c.49287C>T (p.Asn16429=) rs763809932
NM_001267550.2(TTN):c.49345+23dup rs566373563
NM_001267550.2(TTN):c.49357C>A (p.Pro16453Thr) rs200121902
NM_001267550.2(TTN):c.49366C>T (p.Arg16456Cys) rs727504986
NM_001267550.2(TTN):c.49367G>A (p.Arg16456His) rs768914789
NM_001267550.2(TTN):c.49377T>A (p.Pro16459=) rs564712731
NM_001267550.2(TTN):c.49395C>T (p.Asp16465=) rs749308557
NM_001267550.2(TTN):c.49406T>A (p.Leu16469His) rs72677245
NM_001267550.2(TTN):c.49443A>C (p.Pro16481=) rs74321406
NM_001267550.2(TTN):c.49449A>G (p.Thr16483=) rs769061694
NM_001267550.2(TTN):c.49465A>C (p.Arg16489=) rs748959693
NM_001267550.2(TTN):c.49527A>G (p.Thr16509=) rs727505248
NM_001267550.2(TTN):c.49532+8C>T rs397517597
NM_001267550.2(TTN):c.49533-7A>G rs747701799
NM_001267550.2(TTN):c.49575G>A (p.Val16525=) rs886038826
NM_001267550.2(TTN):c.49648+13T>A rs368996176
NM_001267550.2(TTN):c.49648+7T>C rs1553700115
NM_001267550.2(TTN):c.49649-11T>C rs727504474
NM_001267550.2(TTN):c.49649-4G>T rs77477619
NM_001267550.2(TTN):c.49656A>G (p.Pro16552=) rs982034509
NM_001267550.2(TTN):c.49701A>G (p.Ser16567=) rs369646977
NM_001267550.2(TTN):c.49731T>C (p.His16577=) rs2115558
NM_001267550.2(TTN):c.49752G>A (p.Glu16584=) rs763652368
NM_001267550.2(TTN):c.49758T>C (p.Tyr16586=) rs72677247
NM_001267550.2(TTN):c.49795G>A (p.Val16599Ile) rs1553699620
NM_001267550.2(TTN):c.49806G>A (p.Ala16602=)
NM_001267550.2(TTN):c.49812G>A (p.Gly16604=) rs760032120
NM_001267550.2(TTN):c.49812G>T (p.Gly16604=) rs760032120
NM_001267550.2(TTN):c.4989A>T (p.Pro1663=) rs756408474
NM_001267550.2(TTN):c.49919G>C (p.Ser16640Thr) rs55663050
NM_001267550.2(TTN):c.49944G>A (p.Lys16648=) rs190021597
NM_001267550.2(TTN):c.49985A>C (p.Asn16662Thr) rs36043230
NM_001267550.2(TTN):c.49998T>C (p.Asn16666=) rs376917681
NM_001267550.2(TTN):c.50028G>A (p.Glu16676=) rs727503621
NM_001267550.2(TTN):c.50059A>G (p.Ile16687Val) rs727504194
NM_001267550.2(TTN):c.50076C>T (p.Asp16692=) rs397517598
NM_001267550.2(TTN):c.50083C>A (p.Arg16695=) rs751502842
NM_001267550.2(TTN):c.50121C>T (p.Asp16707=)
NM_001267550.2(TTN):c.50154C>A (p.Gly16718=) rs894625126
NM_001267550.2(TTN):c.50157T>C (p.Ser16719=) rs566449160
NM_001267550.2(TTN):c.50185A>G (p.Asn16729Asp) rs794729238
NM_001267550.2(TTN):c.50205C>T (p.Asp16735=) rs1185567072
NM_001267550.2(TTN):c.50212G>A (p.Glu16738Lys) rs148018042
NM_001267550.2(TTN):c.5022C>G (p.Ala1674=) rs753444772
NM_001267550.2(TTN):c.50244C>T (p.Thr16748=) rs778337707
NM_001267550.2(TTN):c.50248+6C>G rs1057524622
NM_001267550.2(TTN):c.50254C>G (p.Pro16752Ala) rs938347047
NM_001267550.2(TTN):c.50268C>T (p.Tyr16756=) rs748836778
NM_001267550.2(TTN):c.50308C>T (p.Leu16770=) rs370782852
NM_001267550.2(TTN):c.50337T>G (p.Gly16779=) rs983630096
NM_001267550.2(TTN):c.50351A>G (p.Gln16784Arg) rs765976576
NM_001267550.2(TTN):c.50354+10G>T rs772647911
NM_001267550.2(TTN):c.50355-15T>C rs757425897
NM_001267550.2(TTN):c.50363T>C (p.Ile16788Thr) rs397517599
NM_001267550.2(TTN):c.50385T>C (p.Gly16795=) rs374672630
NM_001267550.2(TTN):c.50390G>A (p.Arg16797His) rs200835354
NM_001267550.2(TTN):c.50400A>T (p.Lys16800Asn) rs794729239
NM_001267550.2(TTN):c.50430C>T (p.Asn16810=) rs878854313
NM_001267550.2(TTN):c.50452G>A (p.Glu16818Lys) rs397517600
NM_001267550.2(TTN):c.50480G>A (p.Arg16827Gln) rs138896856
NM_001267550.2(TTN):c.5052T>C (p.Tyr1684=) rs727503694
NM_001267550.2(TTN):c.50551+11C>G rs1169808515
NM_001267550.2(TTN):c.50551+9T>C rs370798229
NM_001267550.2(TTN):c.50551A>G (p.Ser16851Gly) rs1405972121
NM_001267550.2(TTN):c.50642G>C (p.Gly16881Ala) rs201302681
NM_001267550.2(TTN):c.50669A>C (p.Glu16890Ala) rs752204728
NM_001267550.2(TTN):c.50714G>A (p.Arg16905His) rs191539637
NM_001267550.2(TTN):c.50719A>G (p.Ile16907Val) rs750610895
NM_001267550.2(TTN):c.50758C>G (p.Pro16920Ala) rs377289817
NM_001267550.2(TTN):c.50857+10C>G rs1553695761
NM_001267550.2(TTN):c.50858-3C>T rs587782987
NM_001267550.2(TTN):c.50870T>C (p.Ile16957Thr)
NM_001267550.2(TTN):c.50891T>C (p.Ile16964Thr) rs794729453
NM_001267550.2(TTN):c.50954C>T (p.Thr16985Ile) rs116765281
NM_001267550.2(TTN):c.50979A>G (p.Lys16993=) rs913914694
NM_001267550.2(TTN):c.51015T>C (p.Asn17005=) rs752077995
NM_001267550.2(TTN):c.51018T>C (p.Asp17006=) rs1163818093
NM_001267550.2(TTN):c.51060A>G (p.Ala17020=) rs1553694864
NM_001267550.2(TTN):c.51066C>T (p.Ala17022=) rs762091746
NM_001267550.2(TTN):c.5109A>G (p.Pro1703=) rs781287476
NM_001267550.2(TTN):c.51118A>G (p.Ile17040Val) rs727505039
NM_001267550.2(TTN):c.51183G>A (p.Lys17061=) rs972424734
NM_001267550.2(TTN):c.51231C>A (p.Thr17077=) rs779518431
NM_001267550.2(TTN):c.51234A>C (p.Pro17078=) rs1553693459
NM_001267550.2(TTN):c.51249C>A (p.Val17083=) rs377342233
NM_001267550.2(TTN):c.51256C>T (p.Arg17086Cys)
NM_001267550.2(TTN):c.51270_51272GAG[1] (p.Arg17092del)
NM_001267550.2(TTN):c.51273G>A (p.Arg17091=) rs532589236
NM_001267550.2(TTN):c.51297T>C (p.Ser17099=) rs1237576280
NM_001267550.2(TTN):c.51310C>T (p.Leu17104=) rs1060503959
NM_001267550.2(TTN):c.51378G>A (p.Lys17126=) rs560889721
NM_001267550.2(TTN):c.51482C>T (p.Ala17161Val) rs16866412
NM_001267550.2(TTN):c.51483G>A (p.Ala17161=) rs397517604
NM_001267550.2(TTN):c.51527G>C (p.Gly17176Ala) rs768961892
NM_001267550.2(TTN):c.51570T>G (p.Gly17190=) rs876657607
NM_001267550.2(TTN):c.51606A>G (p.Val17202=) rs375685343
NM_001267550.2(TTN):c.51678C>T (p.Asn17226=) rs372635204
NM_001267550.2(TTN):c.51681C>T (p.Ala17227=) rs367779216
NM_001267550.2(TTN):c.51684G>A (p.Ala17228=) rs2288566
NM_001267550.2(TTN):c.516G>A (p.Gly172=) rs747789397
NM_001267550.2(TTN):c.51704G>A (p.Arg17235Gln) rs573695008
NM_001267550.2(TTN):c.51739+14C>A rs727505018
NM_001267550.2(TTN):c.51739+20G>A rs571361599
NM_001267550.2(TTN):c.51740-17G>T rs1271846679
NM_001267550.2(TTN):c.51782G>A (p.Arg17261Gln) rs201825412
NM_001267550.2(TTN):c.51809G>T (p.Ser17270Ile) rs200650668
NM_001267550.2(TTN):c.51870A>G (p.Pro17290=) rs1060503957
NM_001267550.2(TTN):c.51887G>A (p.Arg17296His) rs200456782
NM_001267550.2(TTN):c.5198C>T (p.Thr1733Met) rs367700246
NM_001267550.2(TTN):c.51991G>C (p.Glu17331Gln) rs547986881
NM_001267550.2(TTN):c.52004G>A (p.Arg17335His) rs367603302
NM_001267550.2(TTN):c.52006G>A (p.Val17336Ile) rs567781604
NM_001267550.2(TTN):c.52022G>A (p.Arg17341Gln) rs370390570
NM_001267550.2(TTN):c.52032T>C (p.His17344=) rs374254751
NM_001267550.2(TTN):c.52086T>C (p.Cys17362=) rs1057523625
NM_001267550.2(TTN):c.52098G>A (p.Val17366=) rs727503617
NM_001267550.2(TTN):c.52110G>A (p.Pro17370=) rs139789997
NM_001267550.2(TTN):c.52144A>G (p.Arg17382Gly) rs397517607
NM_001267550.2(TTN):c.52199A>C (p.Glu17400Ala) rs773027240
NM_001267550.2(TTN):c.52230C>T (p.Asp17410=) rs397517608
NM_001267550.2(TTN):c.52290T>C (p.Tyr17430=) rs990974705
NM_001267550.2(TTN):c.52305G>A (p.Leu17435=) rs759498383
NM_001267550.2(TTN):c.52317A>G (p.Lys17439=) rs370450339
NM_001267550.2(TTN):c.5231C>T (p.Pro1744Leu) rs75686037
NM_001267550.2(TTN):c.52323C>T (p.Tyr17441=) rs749855424
NM_001267550.2(TTN):c.52331G>A (p.Arg17444His) rs376080116
NM_001267550.2(TTN):c.52374T>C (p.Val17458=) rs752571545
NM_001267550.2(TTN):c.52386T>C (p.Leu17462=) rs369139618
NM_001267550.2(TTN):c.52405+19C>G rs1553689081
NM_001267550.2(TTN):c.52449C>T (p.Thr17483=)
NM_001267550.2(TTN):c.52542A>G (p.Thr17514=)
NM_001267550.2(TTN):c.52557C>T (p.Val17519=) rs397517610
NM_001267550.2(TTN):c.5255G>A (p.Arg1752His) rs150737838
NM_001267550.2(TTN):c.52590T>C (p.Asn17530=) rs777245474
NM_001267550.2(TTN):c.52596T>C (p.Asp17532=) rs761084280
NM_001267550.2(TTN):c.5265T>C (p.Asn1755=) rs1561293273
NM_001267550.2(TTN):c.5268A>G (p.Glu1756=) rs775999739
NM_001267550.2(TTN):c.52705+10T>C rs1553687969
NM_001267550.2(TTN):c.52821T>C (p.Asp17607=) rs2303831
NM_001267550.2(TTN):c.52852C>T (p.Arg17618Cys) rs201213901
NM_001267550.2(TTN):c.52860A>G (p.Thr17620=) rs397517611
NM_001267550.2(TTN):c.52863G>A (p.Glu17621=) rs368606067
NM_001267550.2(TTN):c.52878C>T (p.Val17626=) rs775005179
NM_001267550.2(TTN):c.52890C>T (p.Thr17630=) rs374228930
NM_001267550.2(TTN):c.52917T>C (p.Asp17639=) rs73036398
NM_001267550.2(TTN):c.52920C>T (p.Tyr17640=) rs1553687219
NM_001267550.2(TTN):c.52927C>T (p.Arg17643Trp) rs375944265
NM_001267550.2(TTN):c.52947C>T (p.Ala17649=) rs766991039
NM_001267550.2(TTN):c.52950A>G (p.Ala17650=) rs774191524
NM_001267550.2(TTN):c.5295C>T (p.Gly1765=) rs145999395
NM_001267550.2(TTN):c.52962G>A (p.Pro17654=) rs773148195
NM_001267550.2(TTN):c.5296G>A (p.Val1766Ile) rs149494502
NM_001267550.2(TTN):c.53002+10G>T rs370352450
NM_001267550.2(TTN):c.53002+9C>T rs374671774
NM_001267550.2(TTN):c.53012C>T (p.Ala17671Val) rs549478203
NM_001267550.2(TTN):c.53055G>A (p.Met17685Ile) rs200387466
NM_001267550.2(TTN):c.53096G>A (p.Arg17699His) rs72646808
NM_001267550.2(TTN):c.53122A>G (p.Lys17708Glu) rs185913848
NM_001267550.2(TTN):c.53122_53123delinsGT (p.Lys17708Val) rs886042743
NM_001267550.2(TTN):c.53123A>T (p.Lys17708Ile) rs2303832
NM_001267550.2(TTN):c.53142T>C (p.Asp17714=) rs373316165
NM_001267550.2(TTN):c.53150G>A (p.Arg17717His)
NM_001267550.2(TTN):c.53154T>C (p.Val17718=) rs990097785
NM_001267550.2(TTN):c.53166C>T (p.Asn17722=) rs371730757
NM_001267550.2(TTN):c.53185C>T (p.Leu17729=) rs767559716
NM_001267550.2(TTN):c.53192T>C (p.Ile17731Thr) rs72646809
NM_001267550.2(TTN):c.53206C>A (p.Arg17736=) rs571702144
NM_001267550.2(TTN):c.53226T>C (p.Tyr17742=) rs202200861
NM_001267550.2(TTN):c.53229G>A (p.Val17743=) rs376469717
NM_001267550.2(TTN):c.53260T>C (p.Phe17754Leu) rs397517612
NM_001267550.2(TTN):c.53261T>C (p.Phe17754Ser) rs749312983
NM_001267550.2(TTN):c.53292C>T (p.Val17764=) rs1060503942
NM_001267550.2(TTN):c.53295T>C (p.Pro17765=) rs771792080
NM_001267550.2(TTN):c.53300C>T (p.Pro17767Leu)
NM_001267550.2(TTN):c.53443A>G (p.Ile17815Val) rs368065637
NM_001267550.2(TTN):c.53507G>A (p.Arg17836His) rs373526624
NM_001267550.2(TTN):c.53592A>G (p.Thr17864=) rs397517613
NM_001267550.2(TTN):c.53625A>G (p.Thr17875=) rs373277508
NM_001267550.2(TTN):c.53678C>G (p.Pro17893Arg)
NM_001267550.2(TTN):c.53717A>G (p.Lys17906Arg) rs727503606
NM_001267550.2(TTN):c.53730A>G (p.Glu17910=) rs1057523995
NM_001267550.2(TTN):c.53732G>T (p.Arg17911Ile)
NM_001267550.2(TTN):c.5373C>A (p.Thr1791=) rs727503693
NM_001267550.2(TTN):c.53780T>C (p.Leu17927Pro) rs369678018
NM_001267550.2(TTN):c.53881+15T>A
NM_001267550.2(TTN):c.53976C>G (p.Gly17992=) rs1553682339
NM_001267550.2(TTN):c.54068G>A (p.Arg18023Gln) rs727503603
NM_001267550.2(TTN):c.54105G>A (p.Ala18035=) rs371155050
NM_001267550.2(TTN):c.54109C>T (p.Arg18037Trp) rs201623791
NM_001267550.2(TTN):c.54140C>T (p.Ala18047Val) rs373815064
NM_001267550.2(TTN):c.54148C>T (p.Arg18050Cys) rs55734111
NM_001267550.2(TTN):c.54160G>C (p.Val18054Leu) rs200968679
NM_001267550.2(TTN):c.54190+17C>G rs759925759
NM_001267550.2(TTN):c.54194G>A (p.Arg18065His) rs375895183
NM_001267550.2(TTN):c.54201C>T (p.Ser18067=) rs397517618
NM_001267550.2(TTN):c.54207A>G (p.Pro18069=) rs372686070
NM_001267550.2(TTN):c.54207A>T (p.Pro18069=) rs372686070
NM_001267550.2(TTN):c.54208A>C (p.Arg18070=) rs138240658
NM_001267550.2(TTN):c.542G>A (p.Ser181Asn) rs72647843
NM_001267550.2(TTN):c.54321A>G (p.Ala18107=) rs368021072
NM_001267550.2(TTN):c.54324T>C (p.Ser18108=) rs397517619
NM_001267550.2(TTN):c.54360T>C (p.Thr18120=) rs749248039
NM_001267550.2(TTN):c.54378T>C (p.Tyr18126=)
NM_001267550.2(TTN):c.54383T>G (p.Ile18128Ser)
NM_001267550.2(TTN):c.5439A>G (p.Leu1813=) rs886039124
NM_001267550.2(TTN):c.543C>T (p.Ser181=) rs758598014
NM_001267550.2(TTN):c.54477C>G (p.Val18159=) rs374335905
NM_001267550.2(TTN):c.54489T>G (p.Pro18163=) rs1010205941
NM_001267550.2(TTN):c.54517C>T (p.Pro18173Ser) rs766074604
NM_001267550.2(TTN):c.54597T>C (p.Thr18199=) rs879170876
NM_001267550.2(TTN):c.54636T>C (p.Tyr18212=) rs397517620
NM_001267550.2(TTN):c.5464A>C (p.Met1822Leu) rs201581947
NM_001267550.2(TTN):c.54710T>C (p.Leu18237Pro) rs201412693
NM_001267550.2(TTN):c.54740T>C (p.Met18247Thr) rs200585270
NM_001267550.2(TTN):c.54771C>T (p.Pro18257=) rs190716158
NM_001267550.2(TTN):c.54793G>A (p.Val18265Ile) rs397517621
NM_001267550.2(TTN):c.5479G>T (p.Ala1827Ser) rs141213991
NM_001267550.2(TTN):c.54811+10C>T rs796651993
NM_001267550.2(TTN):c.54811+15G>A rs201450276
NM_001267550.2(TTN):c.54811+298T>G
NM_001267550.2(TTN):c.54811+8T>C rs747409403
NM_001267550.2(TTN):c.54812-13C>T rs754778370
NM_001267550.2(TTN):c.54812-5A>G rs375343798
NM_001267550.2(TTN):c.54818C>T (p.Pro18273Leu) rs201035511
NM_001267550.2(TTN):c.54855G>A (p.Thr18285=) rs200410212
NM_001267550.2(TTN):c.54874G>C (p.Gly18292Arg) rs377512675
NM_001267550.2(TTN):c.54903C>G (p.Gly18301=) rs190830121
NM_001267550.2(TTN):c.54947C>G (p.Thr18316Ser) rs758527900
NM_001267550.2(TTN):c.55005G>A (p.Val18335=) rs1057522129
NM_001267550.2(TTN):c.55029G>A (p.Arg18343=) rs62178963
NM_001267550.2(TTN):c.5503C>A (p.Gln1835Lys) rs537070177
NM_001267550.2(TTN):c.55059T>C (p.Asn18353=) rs553295928
NM_001267550.2(TTN):c.55079C>T (p.Pro18360Leu) rs192788942
NM_001267550.2(TTN):c.55107C>T (p.Ala18369=) rs1316618431
NM_001267550.2(TTN):c.55136T>G (p.Phe18379Cys) rs1553675060
NM_001267550.2(TTN):c.55143C>T (p.Asp18381=) rs1057522461
NM_001267550.2(TTN):c.55145T>G (p.Ile18382Ser) rs1553675010
NM_001267550.2(TTN):c.55206C>A (p.Ile18402=) rs368272978
NM_001267550.2(TTN):c.55270-38G>A
NM_001267550.2(TTN):c.55270-8T>C rs770659997
NM_001267550.2(TTN):c.55278T>C (p.Val18426=) rs368013796
NM_001267550.2(TTN):c.55290C>T (p.Pro18430=) rs777904054
NM_001267550.2(TTN):c.55314T>C (p.Ala18438=) rs997011257
NM_001267550.2(TTN):c.55354T>C (p.Ser18452Pro) rs372541479
NM_001267550.2(TTN):c.55374C>G (p.Ser18458Arg) rs200550947
NM_001267550.2(TTN):c.55379C>T (p.Thr18460Ile) rs372778818
NM_001267550.2(TTN):c.55380A>G (p.Thr18460=) rs1553673472
NM_001267550.2(TTN):c.55383C>A (p.Ala18461=) rs369861620
NM_001267550.2(TTN):c.55417A>G (p.Arg18473Gly) rs72646822
NM_001267550.2(TTN):c.55420G>A (p.Val18474Ile) rs779583004
NM_001267550.2(TTN):c.55432+19G>A rs1213547538
NM_001267550.2(TTN):c.55433A>C (p.Asp18478Ala) rs794729240
NM_001267550.2(TTN):c.55435G>A (p.Val18479Ile) rs559712998
NM_001267550.2(TTN):c.55449C>T (p.Pro18483=) rs187366691
NM_001267550.2(TTN):c.55503G>A (p.Lys18501=) rs879239475
NM_001267550.2(TTN):c.55512C>T (p.Asp18504=) rs377164046
NM_001267550.2(TTN):c.55547T>C (p.Ile18516Thr) rs146608896
NM_001267550.2(TTN):c.55553A>G (p.Lys18518Arg) rs72646823
NM_001267550.2(TTN):c.55555A>C (p.Arg18519=) rs879182051
NM_001267550.2(TTN):c.55659G>A (p.Val18553=) rs368450420
NM_001267550.2(TTN):c.55673G>A (p.Arg18558His) rs115867512
NM_001267550.2(TTN):c.55692T>A (p.Pro18564=) rs200864020
NM_001267550.2(TTN):c.55709G>A (p.Arg18570Lys)
NM_001267550.2(TTN):c.55728G>A (p.Pro18576=) rs727504598
NM_001267550.2(TTN):c.55738C>T (p.Pro18580Ser)
NM_001267550.2(TTN):c.55750A>G (p.Ile18584Val) rs760979964
NM_001267550.2(TTN):c.55758C>G (p.Leu18586=) rs1553671369
NM_001267550.2(TTN):c.55806C>A (p.Pro18602=) rs751325503
NM_001267550.2(TTN):c.55809G>A (p.Pro18603=) rs750472100
NM_001267550.2(TTN):c.55925T>A (p.Leu18642Gln) rs140714512
NM_001267550.2(TTN):c.55929A>G (p.Gln18643=) rs151335428
NM_001267550.2(TTN):c.55932T>C (p.Phe18644=) rs755839294
NM_001267550.2(TTN):c.55992T>C (p.Ala18664=) rs377441727
NM_001267550.2(TTN):c.56019T>C (p.Thr18673=) rs183047238
NM_001267550.2(TTN):c.56050+20C>T rs372268675
NM_001267550.2(TTN):c.56100C>T (p.Thr18700=) rs774106489
NM_001267550.2(TTN):c.56101A>G (p.Asn18701Asp) rs1001238
NM_001267550.2(TTN):c.56106T>G (p.Val18702=) rs371043153
NM_001267550.2(TTN):c.56142G>A (p.Pro18714=) rs758771859
NM_001267550.2(TTN):c.56178T>A (p.Pro18726=) rs767060880
NM_001267550.2(TTN):c.561G>A (p.Ser187=) rs141444282
NM_001267550.2(TTN):c.56256G>A (p.Pro18752=) rs111262307
NM_001267550.2(TTN):c.56264G>A (p.Arg18755His) rs772767570
NM_001267550.2(TTN):c.56314A>G (p.Thr18772Ala) rs964263107
NM_001267550.2(TTN):c.56319A>T (p.Ala18773=) rs377569886
NM_001267550.2(TTN):c.56351G>A (p.Arg18784His) rs771284532
NM_001267550.2(TTN):c.56376A>G (p.Ile18792Met) rs794729241
NM_001267550.2(TTN):c.56403A>G (p.Gln18801=) rs553313488
NM_001267550.2(TTN):c.56454A>C (p.Thr18818=) rs374058011
NM_001267550.2(TTN):c.56456A>G (p.Asn18819Ser)
NM_001267550.2(TTN):c.56461G>A (p.Val18821Ile)
NM_001267550.2(TTN):c.56497G>A (p.Val18833Ile) rs1553665072
NM_001267550.2(TTN):c.56529G>A (p.Thr18843=) rs72646827
NM_001267550.2(TTN):c.56532C>T (p.Tyr18844=) rs1345899259
NM_001267550.2(TTN):c.56535G>A (p.Thr18845=) rs529480368
NM_001267550.2(TTN):c.56631A>G (p.Thr18877=) rs955370014
NM_001267550.2(TTN):c.56679T>C (p.Val18893=) rs397517625
NM_001267550.2(TTN):c.56685C>T (p.Ser18895=) rs375403059
NM_001267550.2(TTN):c.56686G>A (p.Val18896Met) rs370629962
NM_001267550.2(TTN):c.5668C>T (p.Arg1890Cys) rs146496197
NM_001267550.2(TTN):c.56754G>T (p.Gly18918=) rs1057523877
NM_001267550.2(TTN):c.56800G>C (p.Val18934Leu)
NM_001267550.2(TTN):c.56807G>A (p.Arg18936Gln) rs745914315
NM_001267550.2(TTN):c.56850G>A (p.Val18950=) rs368068200
NM_001267550.2(TTN):c.56910C>T (p.Gly18970=) rs148299739
NM_001267550.2(TTN):c.56942C>T (p.Ala18981Val) rs397517627
NM_001267550.2(TTN):c.56947G>A (p.Ala18983Thr) rs377000174
NM_001267550.2(TTN):c.56963-18T>C rs187501574
NM_001267550.2(TTN):c.56963-19G>T rs369216122
NM_001267550.2(TTN):c.56963-3C>T rs375979145
NM_001267550.2(TTN):c.56970T>C (p.Pro18990=) rs372019333
NM_001267550.2(TTN):c.5697C>T (p.Ile1899=) rs148434577
NM_001267550.2(TTN):c.56997T>C (p.Asp18999=) rs375918771
NM_001267550.2(TTN):c.57015A>G (p.Ala19005=) rs372661513
NM_001267550.2(TTN):c.57072C>T (p.Ile19024=) rs751290837
NM_001267550.2(TTN):c.57073G>A (p.Val19025Ile) rs181957743
NM_001267550.2(TTN):c.57112-11T>C rs553667328
NM_001267550.2(TTN):c.57112-14T>C rs777473081
NM_001267550.2(TTN):c.57112-4C>T rs117072049
NM_001267550.2(TTN):c.57189T>G (p.Val19063=) rs1314872554
NM_001267550.2(TTN):c.57207T>C (p.Ala19069=) rs1312323452
NM_001267550.2(TTN):c.57262+15T>G rs370875441
NM_001267550.2(TTN):c.57300T>C (p.Asp19100=) rs876658069
NM_001267550.2(TTN):c.57315T>C (p.His19105=) rs35833641
NM_001267550.2(TTN):c.57336C>A (p.Ile19112=) rs1353810362
NM_001267550.2(TTN):c.57369C>T (p.Thr19123=) rs199742163
NM_001267550.2(TTN):c.57370G>A (p.Val19124Ile) rs142841000
NM_001267550.2(TTN):c.57387T>C (p.Asn19129=) rs375305621
NM_001267550.2(TTN):c.5740G>A (p.Ala1914Thr) rs118161093
NM_001267550.2(TTN):c.5741C>T (p.Ala1914Val) rs374203813
NM_001267550.2(TTN):c.5742G>A (p.Ala1914=) rs368719553
NM_001267550.2(TTN):c.57449T>C (p.Ile19150Thr) rs1553659483
NM_001267550.2(TTN):c.57462G>A (p.Gln19154=) rs72646832
NM_001267550.2(TTN):c.57462_57464delinsAAA (p.Arg19155Lys) rs886038820
NM_001267550.2(TTN):c.57464G>A (p.Arg19155Lys) rs72646833
NM_001267550.2(TTN):c.57478G>A (p.Val19160Ile) rs200778464
NM_001267550.2(TTN):c.57478G>C (p.Val19160Leu) rs200778464
NM_001267550.2(TTN):c.57501T>C (p.Asn19167=) rs780536141
NM_001267550.2(TTN):c.57544+7dup rs750881309
NM_001267550.2(TTN):c.57545-11_57545-9del rs767743244
NM_001267550.2(TTN):c.57585C>T (p.Asn19195=) rs1057523577
NM_001267550.2(TTN):c.57586C>G (p.Leu19196Val) rs397517630
NM_001267550.2(TTN):c.57594T>A (p.Asn19198Lys) rs367606284
NM_001267550.2(TTN):c.57618T>C (p.Phe19206=) rs879238032
NM_001267550.2(TTN):c.57646A>G (p.Ile19216Val) rs374058726
NM_001267550.2(TTN):c.57660C>G (p.Val19220=) rs1553655572
NM_001267550.2(TTN):c.5766G>A (p.Glu1922=) rs1554006506
NM_001267550.2(TTN):c.57682C>T (p.Arg19228Cys)
NM_001267550.2(TTN):c.57683G>A (p.Arg19228His) rs114711705
NM_001267550.2(TTN):c.57786T>C (p.Asn19262=) rs876657608
NM_001267550.2(TTN):c.57808G>C (p.Val19270Leu) rs369440319
NM_001267550.2(TTN):c.57816A>G (p.Thr19272=) rs928567222
NM_001267550.2(TTN):c.57848-9T>C rs1404639698
NM_001267550.2(TTN):c.57849T>C (p.Thr19283=) rs989489157
NM_001267550.2(TTN):c.57860G>A (p.Arg19287His) rs371422299
NM_001267550.2(TTN):c.57864T>G (p.Pro19288=) rs878854320
NM_001267550.2(TTN):c.57933T>C (p.Asp19311=) rs554555894
NM_001267550.2(TTN):c.57956A>G (p.Tyr19319Cys)
NM_001267550.2(TTN):c.57971G>A (p.Arg19324Gln) rs186809500
NM_001267550.2(TTN):c.57990G>A (p.Lys19330=) rs773467310
NM_001267550.2(TTN):c.58072C>T (p.Arg19358Cys) rs371973579
NM_001267550.2(TTN):c.58074T>C (p.Arg19358=) rs397517632
NM_001267550.2(TTN):c.58122C>G (p.Thr19374=) rs189818369
NM_001267550.2(TTN):c.58137C>T (p.Cys19379=) rs376310289
NM_001267550.2(TTN):c.58150+10T>C rs397517635
NM_001267550.2(TTN):c.58150+17A>G rs779666540
NM_001267550.2(TTN):c.58155C>A (p.Pro19385=) rs373587801
NM_001267550.2(TTN):c.58170C>T (p.Leu19390=) rs754108889
NM_001267550.2(TTN):c.58182T>C (p.Asp19394=)
NM_001267550.2(TTN):c.58190C>T (p.Thr19397Met) rs373527448
NM_001267550.2(TTN):c.58191G>A (p.Thr19397=) rs370091658
NM_001267550.2(TTN):c.58205A>G (p.Glu19402Gly) rs886042539
NM_001267550.2(TTN):c.58226G>A (p.Arg19409His) rs201505306
NM_001267550.2(TTN):c.5823A>G (p.Arg1941=) rs149668487
NM_001267550.2(TTN):c.58299T>G (p.Thr19433=) rs778334134
NM_001267550.2(TTN):c.58329T>C (p.Ala19443=) rs766693145
NM_001267550.2(TTN):c.58362C>T (p.Ser19454=) rs374998127
NM_001267550.2(TTN):c.58392T>C (p.Ser19464=) rs876657609
NM_001267550.2(TTN):c.58395A>G (p.Thr19465=) rs375134177
NM_001267550.2(TTN):c.584-4A>G rs868433615
NM_001267550.2(TTN):c.58419A>G (p.Gln19473=) rs186563991
NM_001267550.2(TTN):c.58426G>A (p.Val19476Ile) rs397517636
NM_001267550.2(TTN):c.58436G>A (p.Arg19479His) rs2288569
NM_001267550.2(TTN):c.5847T>C (p.Phe1949=) rs879049862
NM_001267550.2(TTN):c.5850C>T (p.His1950=) rs1057523471
NM_001267550.2(TTN):c.58576G>A (p.Val19526Ile) rs377682563
NM_001267550.2(TTN):c.58612A>G (p.Thr19538Ala) rs200017524
NM_001267550.2(TTN):c.58616G>T (p.Cys19539Phe) rs539868284
NM_001267550.2(TTN):c.58653T>C (p.Ile19551=) rs727504980
NM_001267550.2(TTN):c.58728T>C (p.Arg19576=) rs727504475
NM_001267550.2(TTN):c.58767A>G (p.Thr19589=) rs1349484500
NM_001267550.2(TTN):c.587_589AAG[2] (p.Glu198del) rs771898264
NM_001267550.2(TTN):c.58841T>C (p.Ile19614Thr) rs199933004
NM_001267550.2(TTN):c.58857A>C (p.Glu19619Asp) rs368026488
NM_001267550.2(TTN):c.58867A>G (p.Lys19623Glu) rs794729242
NM_001267550.2(TTN):c.58869A>G (p.Lys19623=) rs191066933
NM_001267550.2(TTN):c.58902T>C (p.His19634=) rs397517639
NM_001267550.2(TTN):c.5892G>A (p.Val1964=) rs752730793
NM_001267550.2(TTN):c.58933C>T (p.Leu19645=) rs2303836
NM_001267550.2(TTN):c.58947G>A (p.Gln19649=) rs886038922
NM_001267550.2(TTN):c.5895T>C (p.Asp1965=) rs186005100
NM_001267550.2(TTN):c.5896A>G (p.Arg1966Gly) rs1554006161
NM_001267550.2(TTN):c.58971A>C (p.Glu19657Asp) rs200728232
NM_001267550.2(TTN):c.59073T>C (p.Asp19691=) rs775577598
NM_001267550.2(TTN):c.59074A>G (p.Thr19692Ala) rs771977738
NM_001267550.2(TTN):c.59091C>T (p.Val19697=) rs756192412
NM_001267550.2(TTN):c.59092G>C (p.Asp19698His) rs397517642
NM_001267550.2(TTN):c.59113C>T (p.Arg19705Cys) rs72646839
NM_001267550.2(TTN):c.59172T>C (p.Asp19724=) rs1373178934
NM_001267550.2(TTN):c.59248G>A (p.Gly19750Ser) rs200732032
NM_001267550.2(TTN):c.59282A>G (p.Asn19761Ser) rs563969986
NM_001267550.2(TTN):c.59315C>T (p.Pro19772Leu) rs72646840
NM_001267550.2(TTN):c.59316G>A (p.Pro19772=) rs377180286
NM_001267550.2(TTN):c.59318A>G (p.Glu19773Gly) rs371719028
NM_001267550.2(TTN):c.59319G>A (p.Glu19773=) rs367622770
NM_001267550.2(TTN):c.59322A>G (p.Pro19774=) rs188063446
NM_001267550.2(TTN):c.59442A>G (p.Pro19814=)
NM_001267550.2(TTN):c.59534G>A (p.Arg19845His) rs201457934
NM_001267550.2(TTN):c.59585C>T (p.Pro19862Leu) rs16866406
NM_001267550.2(TTN):c.595G>A (p.Val199Ile) rs794729254
NM_001267550.2(TTN):c.59626+10T>G
NM_001267550.2(TTN):c.59626+7del rs766734794
NM_001267550.2(TTN):c.59685C>T (p.Tyr19895=) rs397517644
NM_001267550.2(TTN):c.59729C>T (p.Thr19910Ile) rs369476725
NM_001267550.2(TTN):c.59736T>C (p.Tyr19912=)
NM_001267550.2(TTN):c.5973T>A (p.Pro1991=) rs1554005997
NM_001267550.2(TTN):c.597A>G (p.Val199=) rs144214844
NM_001267550.2(TTN):c.59812G>A (p.Ala19938Thr)
NM_001267550.2(TTN):c.5982G>A (p.Ser1994=) rs573823772
NM_001267550.2(TTN):c.59859G>A (p.Ala19953=) rs759120495
NM_001267550.2(TTN):c.59927-16CTT[2] rs1338225091
NM_001267550.2(TTN):c.59927-19T>A rs772730956
NM_001267550.2(TTN):c.59927-20A>G rs762347403
NM_001267550.2(TTN):c.59937G>A (p.Gly19979=) rs727505101
NM_001267550.2(TTN):c.5993G>A (p.Arg1998His) rs144135510
NM_001267550.2(TTN):c.59943C>A (p.Pro19981=) rs202017608
NM_001267550.2(TTN):c.59965G>A (p.Val19989Ile)
NM_001267550.2(TTN):c.60003G>A (p.Pro20001=) rs753118050
NM_001267550.2(TTN):c.60008G>A (p.Arg20003His) rs756091180
NM_001267550.2(TTN):c.60025A>G (p.Ile20009Val) rs371988490
NM_001267550.2(TTN):c.60120A>G (p.Leu20040=) rs878854323
NM_001267550.2(TTN):c.60138T>C (p.Tyr20046=) rs1215527173
NM_001267550.2(TTN):c.60180C>T (p.Leu20060=) rs876657610
NM_001267550.2(TTN):c.60192T>C (p.Thr20064=) rs1215674180
NM_001267550.2(TTN):c.60198G>A (p.Pro20066=) rs767152563
NM_001267550.2(TTN):c.60231C>T (p.Ser20077=) rs751255726
NM_001267550.2(TTN):c.60232G>A (p.Val20078Met) rs77351975
NM_001267550.2(TTN):c.6030T>C (p.Tyr2010=) rs1000321939
NM_001267550.2(TTN):c.60381T>A (p.Val20127=) rs570215155
NM_001267550.2(TTN):c.60471C>T (p.Ala20157=) rs397517645
NM_001267550.2(TTN):c.60490G>C (p.Val20164Leu) rs72646843
NM_001267550.2(TTN):c.60501T>C (p.Thr20167=) rs1459026538
NM_001267550.2(TTN):c.60654G>A (p.Thr20218=) rs776141268
NM_001267550.2(TTN):c.60721G>C (p.Glu20241Gln) rs200212521
NM_001267550.2(TTN):c.60756A>G (p.Ile20252Met) rs876657611
NM_001267550.2(TTN):c.6075A>C (p.Glu2025Asp) rs778940741
NM_001267550.2(TTN):c.60782C>T (p.Thr20261Ile)
NM_001267550.2(TTN):c.60816G>A (p.Pro20272=) rs727504529
NM_001267550.2(TTN):c.60820C>T (p.Pro20274Ser) rs786205338
NM_001267550.2(TTN):c.60879C>T (p.Thr20293=) rs1279772354
NM_001267550.2(TTN):c.60963C>T (p.Asn20321=) rs776977331
NM_001267550.2(TTN):c.60975C>T (p.Ile20325=) rs727505195
NM_001267550.2(TTN):c.60976G>A (p.Ala20326Thr) rs370995867
NM_001267550.2(TTN):c.61029T>C (p.Phe20343=) rs6706088
NM_001267550.2(TTN):c.61041T>C (p.Ala20347=) rs764447938
NM_001267550.2(TTN):c.61073C>T (p.Pro20358Leu) rs751194376
NM_001267550.2(TTN):c.61098C>T (p.Cys20366=) rs755233818
NM_001267550.2(TTN):c.61100G>A (p.Arg20367Gln) rs141973925
NM_001267550.2(TTN):c.61121C>T (p.Pro20374Leu)
NM_001267550.2(TTN):c.61138C>A (p.Leu20380Met) rs201167216
NM_001267550.2(TTN):c.61138C>T (p.Leu20380=) rs201167216
NM_001267550.2(TTN):c.61206C>T (p.Pro20402=) rs1559582385
NM_001267550.2(TTN):c.61224G>A (p.Val20408=) rs566188777
NM_001267550.2(TTN):c.61245A>G (p.Thr20415=) rs2163009
NM_001267550.2(TTN):c.61287A>G (p.Gln20429=) rs774375991
NM_001267550.2(TTN):c.61322A>G (p.Asn20441Ser) rs147580753
NM_001267550.2(TTN):c.61332A>G (p.Arg20444=) rs758056865
NM_001267550.2(TTN):c.61355T>A (p.Ile20452Asn) rs375946418
NM_001267550.2(TTN):c.61483C>G (p.Arg20495Gly)
NM_001267550.2(TTN):c.61500C>A (p.Val20500=) rs1057522407
NM_001267550.2(TTN):c.61556G>A (p.Arg20519Gln) rs727504191
NM_001267550.2(TTN):c.61588C>A (p.Pro20530Thr) rs755700079
NM_001267550.2(TTN):c.6162C>T (p.Ala2054=) rs143265948
NM_001267550.2(TTN):c.6163G>A (p.Glu2055Lys) rs763733251
NM_001267550.2(TTN):c.61674C>T (p.Ala20558=) rs892095487
NM_001267550.2(TTN):c.61690G>A (p.Val20564Ile)
NM_001267550.2(TTN):c.61692T>A (p.Val20564=) rs1553641761
NM_001267550.2(TTN):c.61761A>C (p.Thr20587=) rs727505259
NM_001267550.2(TTN):c.61825C>T (p.Arg20609Cys) rs786205389
NM_001267550.2(TTN):c.61922G>A (p.Arg20641Gln) rs199895260
NM_001267550.2(TTN):c.61943T>G (p.Val20648Gly)
NM_001267550.2(TTN):c.61963G>A (p.Glu20655Lys)
NM_001267550.2(TTN):c.61991A>T (p.Asn20664Ile) rs1214786970
NM_001267550.2(TTN):c.62058T>C (p.Tyr20686=) rs1560221
NM_001267550.2(TTN):c.62098A>G (p.Asn20700Asp) rs151193056
NM_001267550.2(TTN):c.62137G>A (p.Asp20713Asn) rs1177521349
NM_001267550.2(TTN):c.62147A>T (p.Glu20716Val) rs794729243
NM_001267550.2(TTN):c.62149A>G (p.Arg20717Gly) rs75458912
NM_001267550.2(TTN):c.62178T>C (p.Thr20726=) rs72646847
NM_001267550.2(TTN):c.62280T>C (p.Val20760=) rs372065796
NM_001267550.2(TTN):c.62298A>G (p.Leu20766=) rs368503103
NM_001267550.2(TTN):c.62317C>A (p.Leu20773Met) rs375173874
NM_001267550.2(TTN):c.62385C>A (p.Gly20795=) rs72646848
NM_001267550.2(TTN):c.62424C>T (p.Asp20808=) rs374472044
NM_001267550.2(TTN):c.62432A>G (p.Asp20811Gly) rs72646849
NM_001267550.2(TTN):c.62468G>A (p.Arg20823His) rs758019778
NM_001267550.2(TTN):c.62507G>A (p.Arg20836Gln) rs201693851
NM_001267550.2(TTN):c.62510G>C (p.Ser20837Thr)
NM_001267550.2(TTN):c.62511T>C (p.Ser20837=) rs369467841
NM_001267550.2(TTN):c.62547G>A (p.Thr20849=) rs368969893
NM_001267550.2(TTN):c.62572A>G (p.Thr20858Ala) rs200689750
NM_001267550.2(TTN):c.62673T>C (p.Asp20891=) rs374354363
NM_001267550.2(TTN):c.62679C>T (p.Gly20893=) rs188059075
NM_001267550.2(TTN):c.6267G>C (p.Val2089=)
NM_001267550.2(TTN):c.62697T>C (p.Tyr20899=) rs1553640072
NM_001267550.2(TTN):c.62703A>G (p.Leu20901=) rs749180542
NM_001267550.2(TTN):c.627G>A (p.Ser209=) rs201942184
NM_001267550.2(TTN):c.62891C>A (p.Pro20964His) rs548460016
NM_001267550.2(TTN):c.62918C>T (p.Thr20973Ile) rs1553639678
NM_001267550.2(TTN):c.62939T>A (p.Met20980Lys) rs757789191
NM_001267550.2(TTN):c.62943T>C (p.Thr20981=) rs184863287
NM_001267550.2(TTN):c.62970T>C (p.Asp20990=)
NM_001267550.2(TTN):c.62994C>T (p.Tyr20998=) rs375006117
NM_001267550.2(TTN):c.63023C>T (p.Thr21008Ile) rs72646850
NM_001267550.2(TTN):c.63026G>A (p.Arg21009Gln) rs72646851
NM_001267550.2(TTN):c.63060G>A (p.Glu21020=) rs1391810054
NM_001267550.2(TTN):c.63065G>A (p.Arg21022His) rs727503585
NM_001267550.2(TTN):c.63109C>T (p.Arg21037Cys) rs191549948
NM_001267550.2(TTN):c.63114C>A (p.Val21038=) rs201642579
NM_001267550.2(TTN):c.63162A>G (p.Arg21054=) rs1553639081
NM_001267550.2(TTN):c.63165G>A (p.Pro21055=) rs72646852
NM_001267550.2(TTN):c.63180C>T (p.Asp21060=) rs778030754
NM_001267550.2(TTN):c.63187+20T>C rs1057523652
NM_001267550.2(TTN):c.63187+8G>A rs727503584
NM_001267550.2(TTN):c.63210T>C (p.Asn21070=) rs200578829
NM_001267550.2(TTN):c.6321C>T (p.Pro2107=) rs766245195
NM_001267550.2(TTN):c.63273T>C (p.Asp21091=) rs374168580
NM_001267550.2(TTN):c.63287T>A (p.Ile21096Asn) rs558727238
NM_001267550.2(TTN):c.63291T>C (p.Ile21097=) rs397517653
NM_001267550.2(TTN):c.63329C>T (p.Ala21110Val) rs370687831
NM_001267550.2(TTN):c.63330G>A (p.Ala21110=) rs727504885
NM_001267550.2(TTN):c.63352C>T (p.Arg21118Trp) rs200726948
NM_001267550.2(TTN):c.63432G>A (p.Arg21144=) rs776520284
NM_001267550.2(TTN):c.63439G>A (p.Ala21147Thr) rs72646853
NM_001267550.2(TTN):c.63463C>T (p.Arg21155Cys) rs374727686
NM_001267550.2(TTN):c.63483A>G (p.Glu21161=) rs747885095
NM_001267550.2(TTN):c.63558G>A (p.Val21186=) rs200261892
NM_001267550.2(TTN):c.63589A>G (p.Ile21197Val) rs72646855
NM_001267550.2(TTN):c.6359G>T (p.Arg2120Leu) rs141142920
NM_001267550.2(TTN):c.63711C>A (p.Thr21237=) rs763404962
NM_001267550.2(TTN):c.63743T>C (p.Leu21248Pro) rs745323281
NM_001267550.2(TTN):c.63775G>A (p.Val21259Ile) rs371286595
NM_001267550.2(TTN):c.63793+9del rs771033923
NM_001267550.2(TTN):c.63819A>G (p.Leu21273=) rs944964747
NM_001267550.2(TTN):c.63834C>T (p.Val21278=) rs911870330
NM_001267550.2(TTN):c.63876C>T (p.Asn21292=) rs199598302
NM_001267550.2(TTN):c.63879C>T (p.Asp21293=) rs200463088
NM_001267550.2(TTN):c.6387C>T (p.Pro2129=) rs140253822
NM_001267550.2(TTN):c.63906C>T (p.Ile21302=) rs566830548
NM_001267550.2(TTN):c.63917G>A (p.Arg21306His) rs202240487
NM_001267550.2(TTN):c.63921G>A (p.Glu21307=) rs1466883677
NM_001267550.2(TTN):c.63942G>A (p.Ser21314=) rs201285872
NM_001267550.2(TTN):c.63960T>A (p.Val21320=) rs397517655
NM_001267550.2(TTN):c.63981A>G (p.Val21327=) rs397517656
NM_001267550.2(TTN):c.64005G>A (p.Glu21335=) rs749889687
NM_001267550.2(TTN):c.64023T>C (p.Thr21341=) rs747104609
NM_001267550.2(TTN):c.64032C>T (p.Asn21344=) rs72646857
NM_001267550.2(TTN):c.64059T>C (p.Asp21353=) rs377184630
NM_001267550.2(TTN):c.64072G>A (p.Val21358Met) rs371725212
NM_001267550.2(TTN):c.64101G>A (p.Pro21367=) rs397517657
NM_001267550.2(TTN):c.64158C>G (p.Ala21386=) rs1060503926
NM_001267550.2(TTN):c.64171C>T (p.Leu21391=) rs371009616
NM_001267550.2(TTN):c.64174C>T (p.Arg21392Cys) rs72646859
NM_001267550.2(TTN):c.64206C>T (p.Ile21402=) rs752270069
NM_001267550.2(TTN):c.64208C>T (p.Thr21403Ile) rs2042996
NM_001267550.2(TTN):c.64221A>G (p.Glu21407=) rs1553635514
NM_001267550.2(TTN):c.64283T>C (p.Val21428Ala)
NM_001267550.2(TTN):c.64326G>A (p.Ala21442=) rs377109969
NM_001267550.2(TTN):c.64338T>C (p.Ala21446=) rs371514555
NM_001267550.2(TTN):c.6438T>G (p.Ser2146=) rs375425113
NM_001267550.2(TTN):c.64443G>A (p.Gly21481=) rs747850027
NM_001267550.2(TTN):c.64455A>G (p.Arg21485=) rs1553633947
NM_001267550.2(TTN):c.64587G>A (p.Val21529=) rs1060503969
NM_001267550.2(TTN):c.64642G>T (p.Asp21548Tyr) rs749070255
NM_001267550.2(TTN):c.64654A>G (p.Ile21552Val) rs201247592
NM_001267550.2(TTN):c.64672+11T>A rs752070307
NM_001267550.2(TTN):c.64673-9T>C rs1370943867
NM_001267550.2(TTN):c.64683C>G (p.Gly21561=) rs542156552
NM_001267550.2(TTN):c.64698A>G (p.Pro21566=) rs1060503935
NM_001267550.2(TTN):c.64719C>T (p.Asp21573=) rs727504967
NM_001267550.2(TTN):c.64720G>A (p.Ala21574Thr) rs578085621
NM_001267550.2(TTN):c.64761C>T (p.Asp21587=) rs748386416
NM_001267550.2(TTN):c.64762G>A (p.Gly21588Arg) rs181717727
NM_001267550.2(TTN):c.64767C>G (p.Gly21589=) rs1060503955
NM_001267550.2(TTN):c.64789G>A (p.Val21597Met) rs150661999
NM_001267550.2(TTN):c.64811G>A (p.Arg21604Gln) rs188996850
NM_001267550.2(TTN):c.64827G>A (p.Thr21609=) rs377420188
NM_001267550.2(TTN):c.64851T>C (p.Thr21617=) rs1553632924
NM_001267550.2(TTN):c.64860G>A (p.Arg21620=) rs373713828
NM_001267550.2(TTN):c.6489C>T (p.His2163=)
NM_001267550.2(TTN):c.64903C>T (p.Arg21635Cys) rs201614524
NM_001267550.2(TTN):c.6490G>A (p.Ala2164Thr) rs56285559
NM_001267550.2(TTN):c.64959G>A (p.Ala21653=) rs776272431
NM_001267550.2(TTN):c.64968A>G (p.Pro21656=) rs376921740
NM_001267550.2(TTN):c.64973-20T>G
NM_001267550.2(TTN):c.64989A>C (p.Pro21663=) rs910020189
NM_001267550.2(TTN):c.64998A>G (p.Ala21666=) rs876657612
NM_001267550.2(TTN):c.65001A>C (p.Arg21667=) rs749850905
NM_001267550.2(TTN):c.6508+14C>A rs771328770
NM_001267550.2(TTN):c.6508+15T>C rs747722195
NM_001267550.2(TTN):c.6509-15A>G rs1554004514
NM_001267550.2(TTN):c.65092C>T (p.Arg21698Cys) rs72646861
NM_001267550.2(TTN):c.65142C>G (p.Val21714=)
NM_001267550.2(TTN):c.65147C>T (p.Ser21716Leu) rs13021201
NM_001267550.2(TTN):c.65173G>A (p.Val21725Ile) rs368716894
NM_001267550.2(TTN):c.65187G>A (p.Glu21729=) rs397517660
NM_001267550.2(TTN):c.65275+13G>T rs727504999
NM_001267550.2(TTN):c.65275+14T>G rs1291102348
NM_001267550.2(TTN):c.65275+20del rs747219831
NM_001267550.2(TTN):c.65276-16C>T rs370634364
NM_001267550.2(TTN):c.65319T>C (p.Thr21773=) rs746956869
NM_001267550.2(TTN):c.65379C>T (p.Phe21793=) rs377017745
NM_001267550.2(TTN):c.65380G>A (p.Val21794Ile)
NM_001267550.2(TTN):c.65388T>G (p.Ala21796=) rs369091096
NM_001267550.2(TTN):c.65459C>T (p.Thr21820Ile) rs56130023
NM_001267550.2(TTN):c.65466T>C (p.Thr21822=) rs761550395
NM_001267550.2(TTN):c.65514C>T (p.Thr21838=) rs372543748
NM_001267550.2(TTN):c.65516C>T (p.Ala21839Val) rs55948748
NM_001267550.2(TTN):c.65517G>A (p.Ala21839=) rs1390911668
NM_001267550.2(TTN):c.65523C>T (p.Asn21841=) rs749119647
NM_001267550.2(TTN):c.65534C>T (p.Pro21845Leu) rs201662134
NM_001267550.2(TTN):c.65574T>C (p.Asn21858=) rs374858668
NM_001267550.2(TTN):c.65575+18A>G rs1296782954
NM_001267550.2(TTN):c.65576-15_65576-11del rs1064795987
NM_001267550.2(TTN):c.65604T>C (p.Ala21868=) rs200825430
NM_001267550.2(TTN):c.65633G>C (p.Gly21878Ala) rs767001973
NM_001267550.2(TTN):c.6567C>T (p.Asp2189=) rs879111475
NM_001267550.2(TTN):c.65682A>C (p.Thr21894=) rs4894029
NM_001267550.2(TTN):c.65682A>G (p.Thr21894=) rs4894029
NM_001267550.2(TTN):c.65697A>G (p.Lys21899=) rs879177323
NM_001267550.2(TTN):c.65700T>C (p.Asp21900=) rs772440358
NM_001267550.2(TTN):c.65729T>C (p.Ile21910Thr) rs146941600
NM_001267550.2(TTN):c.65743C>A (p.Gln21915Lys) rs62618736
NM_001267550.2(TTN):c.65747G>A (p.Arg21916Gln) rs148849567
NM_001267550.2(TTN):c.65760C>T (p.Thr21920=) rs753720118
NM_001267550.2(TTN):c.65776G>A (p.Val21926Met) rs145527033
NM_001267550.2(TTN):c.6578C>A (p.Thr2193Asn)
NM_001267550.2(TTN):c.65799C>T (p.Asp21933=) rs370123011
NM_001267550.2(TTN):c.65864-13C>A rs368507077
NM_001267550.2(TTN):c.65871G>A (p.Pro21957=) rs771651842
NM_001267550.2(TTN):c.6587G>A (p.Cys2196Tyr) rs878854326
NM_001267550.2(TTN):c.65964C>T (p.Ile21988=) rs371954292
NM_001267550.2(TTN):c.66027T>G (p.Thr22009=) rs1553628094
NM_001267550.2(TTN):c.66048C>T (p.Ser22016=) rs997612485
NM_001267550.2(TTN):c.66051G>A (p.Val22017=) rs587780981
NM_001267550.2(TTN):c.66054G>A (p.Glu22018=) rs727503579
NM_001267550.2(TTN):c.66057A>G (p.Lys22019=) rs372989710
NM_001267550.2(TTN):c.66123A>G (p.Pro22041=) rs727504190
NM_001267550.2(TTN):c.66160+15C>T rs377288086
NM_001267550.2(TTN):c.66161-12_66161-9del rs758125069
NM_001267550.2(TTN):c.66172C>T (p.Arg22058Cys) rs199643269
NM_001267550.2(TTN):c.66240A>C (p.Ala22080=) rs375181938
NM_001267550.2(TTN):c.66283C>T (p.Arg22095Trp) rs571093313
NM_001267550.2(TTN):c.66288A>G (p.Glu22096=) rs368297582
NM_001267550.2(TTN):c.66349G>A (p.Ala22117Thr) rs727505036
NM_001267550.2(TTN):c.66372C>A (p.Thr22124=) rs756981729
NM_001267550.2(TTN):c.66385C>T (p.Arg22129Cys) rs763729258
NM_001267550.2(TTN):c.66429C>T (p.Asp22143=) rs1367041984
NM_001267550.2(TTN):c.66430G>A (p.Ala22144Thr) rs183276016
NM_001267550.2(TTN):c.66441C>T (p.Ala22147=) rs727503578
NM_001267550.2(TTN):c.66450T>G (p.Ala22150=) rs727504643
NM_001267550.2(TTN):c.66463+13G>T rs749690571
NM_001267550.2(TTN):c.66463+17G>A rs202244470
NM_001267550.2(TTN):c.66480G>A (p.Pro22160=) rs372814670
NM_001267550.2(TTN):c.66481G>A (p.Ala22161Thr) rs886038883
NM_001267550.2(TTN):c.66528T>G (p.Ser22176=) rs1553626322
NM_001267550.2(TTN):c.66549C>T (p.Asp22183=) rs374667295
NM_001267550.2(TTN):c.66561T>C (p.Pro22187=) rs1553626182
NM_001267550.2(TTN):c.66564C>T (p.Ile22188=) rs1060503940
NM_001267550.2(TTN):c.66576C>A (p.Leu22192=) rs187378247
NM_001267550.2(TTN):c.66576C>T (p.Leu22192=) rs187378247
NM_001267550.2(TTN):c.66590G>A (p.Arg22197Gln) rs374656017
NM_001267550.2(TTN):c.66600C>T (p.Ser22200=)
NM_001267550.2(TTN):c.66614G>A (p.Arg22205Lys) rs72646869
NM_001267550.2(TTN):c.66622T>C (p.Leu22208=) rs745856872
NM_001267550.2(TTN):c.66673G>A (p.Asp22225Asn) rs72646870
NM_001267550.2(TTN):c.66681A>G (p.Gln22227=) rs397517665
NM_001267550.2(TTN):c.66687A>G (p.Gln22229=) rs879004400
NM_001267550.2(TTN):c.66692G>A (p.Arg22231His) rs200971254
NM_001267550.2(TTN):c.66702C>T (p.Ala22234=) rs371802557
NM_001267550.2(TTN):c.66703G>A (p.Val22235Ile) rs751354601
NM_001267550.2(TTN):c.66762C>T (p.Asp22254=) rs1178308561
NM_001267550.2(TTN):c.66766T>C (p.Leu22256=)
NM_001267550.2(TTN):c.66770-6A>C rs200373454
NM_001267550.2(TTN):c.66778G>C (p.Glu22260Gln) rs553988103
NM_001267550.2(TTN):c.66795G>A (p.Ala22265=)
NM_001267550.2(TTN):c.66804G>A (p.Arg22268=) rs370501197
NM_001267550.2(TTN):c.66844T>C (p.Tyr22282His) rs745992545
NM_001267550.2(TTN):c.66870T>C (p.Pro22290=) rs1024438218
NM_001267550.2(TTN):c.66876G>T (p.Lys22292Asn)
NM_001267550.2(TTN):c.66898G>A (p.Val22300Ile) rs200343420
NM_001267550.2(TTN):c.66917T>C (p.Ile22306Thr) rs397517667
NM_001267550.2(TTN):c.66954C>A (p.Phe22318Leu) rs1282369228
NM_001267550.2(TTN):c.66957G>A (p.Leu22319=) rs1060503928
NM_001267550.2(TTN):c.66976A>G (p.Lys22326Glu) rs786205383
NM_001267550.2(TTN):c.66977A>G (p.Lys22326Arg) rs202125813
NM_001267550.2(TTN):c.66984T>C (p.Asp22328=) rs778439748
NM_001267550.2(TTN):c.66996T>C (p.Tyr22332=) rs397517668
NM_001267550.2(TTN):c.66C>T (p.Thr22=) rs143623862
NM_001267550.2(TTN):c.67053G>A (p.Val22351=) rs886038717
NM_001267550.2(TTN):c.67057+9A>G rs539161527
NM_001267550.2(TTN):c.67058-29C>G
NM_001267550.2(TTN):c.67062T>C (p.Thr22354=) rs1553623646