ClinVar Miner

List of variants in gene TTN reported as uncertain significance by Genetic Services Laboratory, University of Chicago

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 134
Download table as spreadsheet
HGVS dbSNP
NM_001267550.1(TTN):c.45599C>G rs201057307
NM_001267550.2(TTN):c.100315T>C (p.Trp33439Arg) rs545443009
NM_001267550.2(TTN):c.101613G>A (p.Arg33871=) rs797046068
NM_001267550.2(TTN):c.10182A>G (p.Gln3394=) rs797046059
NM_001267550.2(TTN):c.101891G>A (p.Arg33964His) rs55669553
NM_001267550.2(TTN):c.102520G>A (p.Val34174Ile) rs200430493
NM_001267550.2(TTN):c.102595A>G (p.Ile34199Val) rs56347248
NM_001267550.2(TTN):c.102877A>G (p.Lys34293Glu) rs72629783
NM_001267550.2(TTN):c.103131C>T (p.Gly34377=) rs797046069
NM_001267550.2(TTN):c.103147G>C (p.Glu34383Gln) rs148525155
NM_001267550.2(TTN):c.104560G>C (p.Val34854Leu) rs55866005
NM_001267550.2(TTN):c.105521G>A (p.Arg35174His) rs756575734
NM_001267550.2(TTN):c.105818C>A (p.Pro35273Gln) rs1553484561
NM_001267550.2(TTN):c.106580A>T (p.Glu35527Val) rs55725279
NM_001267550.2(TTN):c.107728G>A (p.Glu35910Lys) rs370649675
NM_001267550.2(TTN):c.14911T>G (p.Cys4971Gly) rs537312655
NM_001267550.2(TTN):c.15040A>T (p.Thr5014Ser) rs143093473
NM_001267550.2(TTN):c.15688G>A (p.Val5230Ile) rs369294144
NM_001267550.2(TTN):c.16313A>G (p.Lys5438Arg) rs190636272
NM_001267550.2(TTN):c.16549T>G (p.Ser5517Ala) rs200520316
NM_001267550.2(TTN):c.18824A>G (p.Asn6275Ser) rs184412722
NM_001267550.2(TTN):c.18943G>A (p.Val6315Met) rs770552574
NM_001267550.2(TTN):c.20175A>G (p.Ile6725Met) rs146627500
NM_001267550.2(TTN):c.20341G>A (p.Glu6781Lys) rs72648958
NM_001267550.2(TTN):c.20355G>A (p.Ser6785=) rs549470227
NM_001267550.2(TTN):c.20633A>C (p.Glu6878Ala) rs752107739
NM_001267550.2(TTN):c.20743G>T (p.Ala6915Ser) rs201728165
NM_001267550.2(TTN):c.21404-4A>G rs72648965
NM_001267550.2(TTN):c.22634G>A (p.Arg7545Gln) rs72648969
NM_001267550.2(TTN):c.23538C>G (p.Phe7846Leu) rs149523263
NM_001267550.2(TTN):c.24107C>T (p.Ser8036Leu) rs200598509
NM_001267550.2(TTN):c.24952G>A (p.Val8318Ile) rs200103997
NM_001267550.2(TTN):c.25087G>T (p.Ala8363Ser) rs200972189
NM_001267550.2(TTN):c.25490G>A (p.Arg8497His) rs149855485
NM_001267550.2(TTN):c.26494A>G (p.Ile8832Val) rs72648989
NM_001267550.2(TTN):c.2679A>C (p.Glu893Asp) rs770287129
NM_001267550.2(TTN):c.26863A>G (p.Ile8955Val) rs72648994
NM_001267550.2(TTN):c.2691G>C (p.Glu897Asp) rs778905342
NM_001267550.2(TTN):c.27914G>A (p.Arg9305Gln) rs397517527
NM_001267550.2(TTN):c.28754-9C>T rs797046061
NM_001267550.2(TTN):c.29397C>T (p.Gly9799=) rs770084292
NM_001267550.2(TTN):c.29525A>G (p.Tyr9842Cys) rs1553879661
NM_001267550.2(TTN):c.30274C>T (p.His10092Tyr) rs72650011
NM_001267550.2(TTN):c.30718G>T (p.Val10240Phe) rs111671438
NM_001267550.2(TTN):c.30857T>C (p.Ile10286Thr) rs369094355
NM_001267550.2(TTN):c.31762+4C>T rs368538884
NM_001267550.2(TTN):c.33404C>A (p.Ala11135Glu) rs577901623
NM_001267550.2(TTN):c.33501_33503AGA[6] (p.Glu11172dup) rs368327166
NM_001267550.2(TTN):c.33754C>A (p.Pro11252Thr) rs886055283
NM_001267550.2(TTN):c.34129_34149GTTCTACCTGAAGAAGAGGAA[1] (p.11363_11369VLPEEEE[3]) rs587780487
NM_001267550.2(TTN):c.34566A>C (p.Glu11522Asp) rs140640738
NM_001267550.2(TTN):c.3475C>A (p.Arg1159Ser) rs797046063
NM_001267550.2(TTN):c.34812A>C (p.Lys11604Asn) rs797046062
NM_001267550.2(TTN):c.39284C>A (p.Pro13095His) rs770419196
NM_001267550.2(TTN):c.40558G>C (p.Val13520Leu) rs587780488
NM_001267550.2(TTN):c.40576_40578GAA[3] (p.Glu13529del) rs727504199
NM_001267550.2(TTN):c.45408G>T (p.Lys15136Asn) rs72677225
NM_001267550.2(TTN):c.47278G>A (p.Gly15760Ser) rs372404266
NM_001267550.2(TTN):c.47545C>A (p.Pro15849Thr) rs146181477
NM_001267550.2(TTN):c.48334C>G (p.Leu16112Val) rs747917712
NM_001267550.2(TTN):c.49919G>C (p.Ser16640Thr) rs55663050
NM_001267550.2(TTN):c.50390G>A (p.Arg16797His) rs200835354
NM_001267550.2(TTN):c.51887G>A (p.Arg17296His) rs200456782
NM_001267550.2(TTN):c.52139A>T (p.Asp17380Val) rs373305248
NM_001267550.2(TTN):c.52852C>T (p.Arg17618Cys) rs201213901
NM_001267550.2(TTN):c.53213A>T (p.Asp17738Val) rs773447539
NM_001267550.2(TTN):c.5397T>G (p.Ser1799Arg) rs797046065
NM_001267550.2(TTN):c.54813T>G (p.Phe18271Leu) rs370583314
NM_001267550.2(TTN):c.55804C>T (p.Pro18602Ser) rs781300931
NM_001267550.2(TTN):c.56255C>T (p.Pro18752Leu) rs200132226
NM_001267550.2(TTN):c.56296G>C (p.Ala18766Pro) rs727505268
NM_001267550.2(TTN):c.56535G>A (p.Thr18845=) rs529480368
NM_001267550.2(TTN):c.56963-3C>T rs375979145
NM_001267550.2(TTN):c.57073G>A (p.Val19025Ile) rs181957743
NM_001267550.2(TTN):c.57586C>G (p.Leu19196Val) rs397517630
NM_001267550.2(TTN):c.58072C>T (p.Arg19358Cys) rs371973579
NM_001267550.2(TTN):c.58363G>A (p.Gly19455Ser) rs191927501
NM_001267550.2(TTN):c.58775C>A (p.Thr19592Asn) rs745441183
NM_001267550.2(TTN):c.58944T>G (p.Cys19648Trp) rs764728016
NM_001267550.2(TTN):c.59248G>A (p.Gly19750Ser) rs200732032
NM_001267550.2(TTN):c.59282A>G (p.Asn19761Ser) rs563969986
NM_001267550.2(TTN):c.61322A>G (p.Asn20441Ser) rs147580753
NM_001267550.2(TTN):c.61409T>C (p.Ile20470Thr) rs202012910
NM_001267550.2(TTN):c.63185T>C (p.Ile21062Thr) rs575313522
NM_001267550.2(TTN):c.63187+5G>C rs1292388582
NM_001267550.2(TTN):c.64174C>T (p.Arg21392Cys) rs72646859
NM_001267550.2(TTN):c.64481C>T (p.Pro21494Leu) rs587780492
NM_001267550.2(TTN):c.64789G>A (p.Val21597Met) rs150661999
NM_001267550.2(TTN):c.65187G>A (p.Glu21729=) rs397517660
NM_001267550.2(TTN):c.65459C>T (p.Thr21820Ile) rs56130023
NM_001267550.2(TTN):c.66392C>T (p.Thr22131Ile) rs1553626919
NM_001267550.2(TTN):c.68803_68805ATT[1] (p.Ile22936del) rs587780493
NM_001267550.2(TTN):c.71705T>C (p.Ile23902Thr) rs55837610
NM_001267550.2(TTN):c.71841G>C (p.Lys23947Asn) rs56019808
NM_001267550.2(TTN):c.73110_73111delinsCA (p.Trp24370_Gln24371delinsCysLys) rs1553608093
NM_001267550.2(TTN):c.73994C>T (p.Thr24665Met) rs144398602
NM_001267550.2(TTN):c.74691A>G (p.Ser24897=) rs797046066
NM_001267550.2(TTN):c.75329G>A (p.Arg25110Gln) rs757674072
NM_001267550.2(TTN):c.75458C>T (p.Ser25153Leu) rs368058280
NM_001267550.2(TTN):c.7570A>T (p.Thr2524Ser) rs797046067
NM_001267550.2(TTN):c.76124A>T (p.Tyr25375Phe) rs374494927
NM_001267550.2(TTN):c.77716G>A (p.Glu25906Lys) rs56341835
NM_001267550.2(TTN):c.7783A>G (p.Met2595Val) rs760786665
NM_001267550.2(TTN):c.78896T>A (p.Val26299Asp) rs73036377
NM_001267550.2(TTN):c.79410G>A (p.Gly26470=) rs140942979
NM_001267550.2(TTN):c.80701A>G (p.Ile26901Val) rs201562505
NM_001267550.2(TTN):c.82022G>A (p.Arg27341Gln) rs555414240
NM_001267550.2(TTN):c.82560C>A (p.Asn27520Lys) rs56264840
NM_001267550.2(TTN):c.86140G>A (p.Gly28714Arg) rs532818379
NM_001267550.2(TTN):c.87616_87618GAA[1] (p.Glu29207del) rs753636173
NM_001267550.2(TTN):c.87808G>A (p.Val29270Ile) rs141624266
NM_001267550.2(TTN):c.88028G>A (p.Arg29343His) rs73036368
NM_001267550.2(TTN):c.89314G>A (p.Glu29772Lys) rs200503016
NM_001267550.2(TTN):c.90536G>A (p.Arg30179His) rs149567378
NM_001267550.2(TTN):c.90638T>C (p.Ile30213Thr) rs114026724
NM_001267550.2(TTN):c.90826T>G (p.Cys30276Gly) rs150430592
NM_001267550.2(TTN):c.91765G>A (p.Ala30589Thr) rs148617456
NM_001267550.2(TTN):c.92187C>A (p.Ser30729Arg) rs778827102
NM_001267550.2(TTN):c.93005G>T (p.Ser31002Ile) rs180975448
NM_001267550.2(TTN):c.95242C>T (p.Arg31748Cys) rs142525903
NM_001267550.2(TTN):c.95297C>T (p.Ser31766Phe) rs191484894
NM_001267550.2(TTN):c.95450T>C (p.Val31817Ala) rs758207460
NM_001267550.2(TTN):c.9713C>T (p.Pro3238Leu) rs397517792
NM_001267550.2(TTN):c.97285G>A (p.Gly32429Ser) rs397517768
NM_001267550.2(TTN):c.97673G>A (p.Arg32558Gln) rs369237346
NM_001267550.2(TTN):c.98242C>T (p.Arg32748Cys) rs72648272
NM_133379.5(TTN):c.1297G>A (p.Val433Ile) rs146000949
NM_133379.5(TTN):c.204C>T (p.Pro68=) rs201089861
NM_133379.5(TTN):c.3100G>A (p.Val1034Met) rs142951505
NM_133379.5(TTN):c.3241G>A (p.Ala1081Thr) rs55914517
NM_133379.5(TTN):c.5582G>A (p.Arg1861His) rs140914855
NM_133379.5(TTN):c.8069C>T (p.Thr2690Ile) rs374620001
NM_133379.5(TTN):c.9338G>A (p.Arg3113His) rs141258018
NM_133379.5(TTN):c.9359G>A (p.Arg3120Gln) rs72647894

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.