ClinVar Miner

List of variants in gene TTN reported by Laboratory for Molecular Medicine,Partners HealthCare Personalized Medicine

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 2788
Download table as spreadsheet
HGVS dbSNP
NM_001256850.1(TTN):c.13984+9C>T rs544241749
NM_001256850.1(TTN):c.16232-9T>C rs141687561
NM_001256850.1(TTN):c.22427-10C>A rs72648975
NM_001256850.1(TTN):c.28091-2A>C rs6716782
NM_001256850.1(TTN):c.29560+3G>A rs563582627
NM_001256850.1(TTN):c.31604-6T>C rs375742678
NM_001256850.1(TTN):c.32222-4G>A rs727504440
NM_001256850.1(TTN):c.32876-8C>T rs371318311
NM_001256850.1(TTN):c.34690+6C>T rs187365142
NM_001256850.1(TTN):c.35188+6C>T rs72650067
NM_001256850.1(TTN):c.39359-6G>A rs372166634
NM_001256850.1(TTN):c.43537+5G>A rs374413644
NM_001256850.1(TTN):c.44725+2delT rs727504851
NM_001256850.1(TTN):c.48079+10G>A rs370352450
NM_001256850.1(TTN):c.48364+6G>A rs149890360
NM_001256850.1(TTN):c.52340-4C>T rs373552048
NM_001256850.1(TTN):c.60353-8T>C rs377484398
NM_001256850.1(TTN):c.60652+10T>C rs72646864
NM_001256850.1(TTN):c.64489+10G>C rs72646883
NM_001256850.1(TTN):c.81898+2T>A rs397517735
NM_001256850.1(TTN):c.91981+4T>C rs373514079
NM_001256850.1(TTN):c.92569+1G>C rs727505319
NM_001267550.1(TTN):c.45599C>G rs201057307
NM_001267550.1(TTN):c.46387G>A rs200042932
NM_001267550.1(TTN):c.83315A>T rs578191491
NM_001267550.2(TTN):c.100026_100030del (p.Ser33344fs) rs727503537
NM_001267550.2(TTN):c.100047A>C (p.Thr33349=) rs727504698
NM_001267550.2(TTN):c.100059T>A (p.Ile33353=) rs56026369
NM_001267550.2(TTN):c.100094G>A (p.Arg33365Gln) rs55742743
NM_001267550.2(TTN):c.100096G>A (p.Val33366Ile) rs55675869
NM_001267550.2(TTN):c.100172-17dup rs397517782
NM_001267550.2(TTN):c.10024G>A (p.Val3342Ile) rs727503679
NM_001267550.2(TTN):c.100257T>C (p.Asp33419=) rs727505046
NM_001267550.2(TTN):c.100281C>T (p.Tyr33427=) rs373085562
NM_001267550.2(TTN):c.1002C>T (p.Thr334=) rs148094198
NM_001267550.2(TTN):c.100389C>T (p.Tyr33463=) rs368984050
NM_001267550.2(TTN):c.100397G>A (p.Arg33466His) rs189626540
NM_001267550.2(TTN):c.1003G>A (p.Val335Met) rs72647846
NM_001267550.2(TTN):c.100400T>G (p.Val33467Gly) rs200166942
NM_001267550.2(TTN):c.100417G>A (p.Gly33473Ser) rs397517783
NM_001267550.2(TTN):c.100459C>T (p.Pro33487Ser) rs72629779
NM_001267550.2(TTN):c.10045A>G (p.Thr3349Ala) rs777960129
NM_001267550.2(TTN):c.10046C>T (p.Thr3349Ile) rs727503678
NM_001267550.2(TTN):c.100562G>A (p.Gly33521Asp) rs370516977
NM_001267550.2(TTN):c.100579G>A (p.Val33527Ile) rs2278196
NM_001267550.2(TTN):c.100653C>A (p.Gly33551=) rs727505326
NM_001267550.2(TTN):c.100766-9C>T rs77483833
NM_001267550.2(TTN):c.100829G>A (p.Gly33610Asp) rs373754986
NM_001267550.2(TTN):c.10088G>A (p.Arg3363His) rs148169214
NM_001267550.2(TTN):c.100980G>C (p.Glu33660Asp) rs727503536
NM_001267550.2(TTN):c.10100G>A (p.Arg3367Gln) rs34819099
NM_001267550.2(TTN):c.10104T>G (p.Val3368=) rs142460433
NM_001267550.2(TTN):c.101055T>C (p.Asp33685=) rs372788551
NM_001267550.2(TTN):c.101064T>C (p.Asp33688=) rs368168812
NM_001267550.2(TTN):c.10114+14C>T rs876657598
NM_001267550.2(TTN):c.101159A>G (p.Lys33720Arg) rs727503535
NM_001267550.2(TTN):c.101212C>T (p.Arg33738Cys) rs56273463
NM_001267550.2(TTN):c.101214T>C (p.Arg33738=) rs876657617
NM_001267550.2(TTN):c.101245G>A (p.Val33749Met) rs201554140
NM_001267550.2(TTN):c.101250C>G (p.Ile33750Met) rs397517784
NM_001267550.2(TTN):c.101281C>T (p.Arg33761Trp) rs201421156
NM_001267550.2(TTN):c.101369T>A (p.Met33790Lys) rs876658097
NM_001267550.2(TTN):c.101376T>C (p.Tyr33792=) rs367732133
NM_001267550.2(TTN):c.101378A>T (p.Asp33793Val) rs200675195
NM_001267550.2(TTN):c.101406C>G (p.Val33802=) rs55802460
NM_001267550.2(TTN):c.101506T>A (p.Cys33836Ser) rs766439271
NM_001267550.2(TTN):c.101557A>G (p.Lys33853Glu) rs727505163
NM_001267550.2(TTN):c.101665G>A (p.Val33889Ile) rs34924609
NM_001267550.2(TTN):c.101697C>T (p.Asp33899=) rs114267234
NM_001267550.2(TTN):c.101754T>G (p.Ser33918Arg) rs952080555
NM_001267550.2(TTN):c.101766G>C (p.Gln33922His) rs55886356
NM_001267550.2(TTN):c.101803A>G (p.Ile33935Val) rs56376197
NM_001267550.2(TTN):c.101822G>C (p.Arg33941Thr) rs762498249
NM_001267550.2(TTN):c.10188A>G (p.Glu3396=) rs183336802
NM_001267550.2(TTN):c.101891G>A (p.Arg33964His) rs55669553
NM_001267550.2(TTN):c.101908G>A (p.Asp33970Asn) rs749832500
NM_001267550.2(TTN):c.101925A>G (p.Leu33975=) rs201246720
NM_001267550.2(TTN):c.101936C>G (p.Pro33979Arg) rs200238877
NM_001267550.2(TTN):c.102011T>A (p.Leu34004Gln) rs727504897
NM_001267550.2(TTN):c.102024A>G (p.Leu34008=) rs727504677
NM_001267550.2(TTN):c.102028A>C (p.Ser34010Arg) rs727503534
NM_001267550.2(TTN):c.102103G>A (p.Asp34035Asn) rs144963736
NM_001267550.2(TTN):c.102156G>T (p.Arg34052=) rs376894729
NM_001267550.2(TTN):c.102183C>T (p.Arg34061=) rs727504536
NM_001267550.2(TTN):c.102190G>A (p.Ala34064Thr) rs200237973
NM_001267550.2(TTN):c.102271C>T (p.Arg34091Trp) rs140319117
NM_001267550.2(TTN):c.102394T>C (p.Ser34132Pro) rs876658098
NM_001267550.2(TTN):c.10241_10247del (p.Tyr3414fs) rs876657663
NM_001267550.2(TTN):c.102428T>C (p.Met34143Thr) rs397517786
NM_001267550.2(TTN):c.10242C>T (p.Tyr3414=) rs45447891
NM_001267550.2(TTN):c.102519C>T (p.Gly34173=) rs2857265
NM_001267550.2(TTN):c.102520G>A (p.Val34174Ile) rs200430493
NM_001267550.2(TTN):c.10256G>A (p.Ser3419Asn) rs2291310
NM_001267550.2(TTN):c.102595A>G (p.Ile34199Val) rs56347248
NM_001267550.2(TTN):c.102638A>G (p.Asn34213Ser) rs375332499
NM_001267550.2(TTN):c.102711C>T (p.Cys34237=) rs568801205
NM_001267550.2(TTN):c.102737G>A (p.Arg34246His) rs372716177
NM_001267550.2(TTN):c.102751A>G (p.Met34251Val) rs56173891
NM_001267550.2(TTN):c.102833G>T (p.Gly34278Val) rs3731752
NM_001267550.2(TTN):c.102846T>A (p.Thr34282=) rs876657618
NM_001267550.2(TTN):c.102877A>G (p.Lys34293Glu) rs72629783
NM_001267550.2(TTN):c.102949C>T (p.Gln34317Ter) rs397517787
NM_001267550.2(TTN):c.102984C>T (p.Asp34328=) rs541125667
NM_001267550.2(TTN):c.103104A>G (p.Leu34368=) rs371535721
NM_001267550.2(TTN):c.103147G>C (p.Glu34383Gln) rs148525155
NM_001267550.2(TTN):c.103292C>T (p.Thr34431Met) rs192001910
NM_001267550.2(TTN):c.103363C>T (p.Arg34455Cys) rs72629785
NM_001267550.2(TTN):c.103434C>A (p.Asp34478Glu) rs376371272
NM_001267550.2(TTN):c.103514A>T (p.Glu34505Val) rs761105256
NM_001267550.2(TTN):c.103524C>T (p.Val34508=) rs587780985
NM_001267550.2(TTN):c.103580T>C (p.Ile34527Thr) rs370618537
NM_001267550.2(TTN):c.103632G>A (p.Glu34544=) rs1285886003
NM_001267550.2(TTN):c.103658T>C (p.Ile34553Thr) rs727505196
NM_001267550.2(TTN):c.103688T>C (p.Val34563Ala) rs55945684
NM_001267550.2(TTN):c.103730A>G (p.Gln34577Arg) rs727505009
NM_001267550.2(TTN):c.103781G>A (p.Arg34594His) rs3829747
NM_001267550.2(TTN):c.10378C>G (p.Pro3460Ala) rs201735487
NM_001267550.2(TTN):c.103804C>G (p.Gln34602Glu) rs727505242
NM_001267550.2(TTN):c.103859G>A (p.Arg34620His) rs367927066
NM_001267550.2(TTN):c.103909C>T (p.Arg34637Trp) rs200716930
NM_001267550.2(TTN):c.103910G>A (p.Arg34637Gln) rs199642423
NM_001267550.2(TTN):c.103913G>A (p.Arg34638His) rs371528685
NM_001267550.2(TTN):c.103946G>A (p.Arg34649Gln) rs397517788
NM_001267550.2(TTN):c.103974C>T (p.Ile34658=) rs199714102
NM_001267550.2(TTN):c.104000T>C (p.Ile34667Thr) rs727504476
NM_001267550.2(TTN):c.104192A>G (p.Tyr34731Cys) rs397517789
NM_001267550.2(TTN):c.104222C>T (p.Thr34741Ile) rs727505306
NM_001267550.2(TTN):c.104251G>C (p.Ala34751Pro) rs185683410
NM_001267550.2(TTN):c.104261C>T (p.Ala34754Val) rs727505020
NM_001267550.2(TTN):c.104364C>T (p.Ser34788=) rs181679744
NM_001267550.2(TTN):c.104365G>A (p.Glu34789Lys) rs190565627
NM_001267550.2(TTN):c.104377A>C (p.Met34793Leu) rs72629787
NM_001267550.2(TTN):c.104385G>A (p.Lys34795=) rs397517790
NM_001267550.2(TTN):c.104414G>T (p.Arg34805Leu) rs115150240
NM_001267550.2(TTN):c.104560G>C (p.Val34854Leu) rs55866005
NM_001267550.2(TTN):c.104576G>A (p.Arg34859Gln) rs68080670
NM_001267550.2(TTN):c.104592G>A (p.Pro34864=) rs144094650
NM_001267550.2(TTN):c.104769A>C (p.Thr34923=) rs56375087
NM_001267550.2(TTN):c.104774A>C (p.Glu34925Ala) rs201218828
NM_001267550.2(TTN):c.104914G>A (p.Glu34972Lys) rs727504918
NM_001267550.2(TTN):c.104936G>C (p.Gly34979Ala) rs376634193
NM_001267550.2(TTN):c.104950del (p.Glu34984fs) rs727503533
NM_001267550.2(TTN):c.104985A>G (p.Gly34995=) rs397517793
NM_001267550.2(TTN):c.104988C>T (p.Val34996=) rs3829748
NM_001267550.2(TTN):c.104993C>A (p.Thr34998Asn) rs397517794
NM_001267550.2(TTN):c.104995C>T (p.Leu34999=) rs727503532
NM_001267550.2(TTN):c.1049A>G (p.Tyr350Cys) rs563369722
NM_001267550.2(TTN):c.105064G>A (p.Glu35022Lys) rs727504977
NM_001267550.2(TTN):c.1050C>T (p.Tyr350=) rs375448572
NM_001267550.2(TTN):c.105127C>T (p.Arg35043Cys) rs200378865
NM_001267550.2(TTN):c.105136G>A (p.Glu35046Lys) rs540500017
NM_001267550.2(TTN):c.105180G>C (p.Glu35060Asp) rs56308529
NM_001267550.2(TTN):c.105183G>A (p.Ala35061=) rs371075036
NM_001267550.2(TTN):c.105212C>G (p.Ser35071Cys) rs3813249
NM_001267550.2(TTN):c.105228G>A (p.Ser35076=) rs55938627
NM_001267550.2(TTN):c.10523C>T (p.Thr3508Ile) rs397517823
NM_001267550.2(TTN):c.105260C>T (p.Thr35087Met) rs397517795
NM_001267550.2(TTN):c.105384A>G (p.Ala35128=) rs3813250
NM_001267550.2(TTN):c.105391A>G (p.Ile35131Val) rs779464128
NM_001267550.2(TTN):c.105416C>T (p.Thr35139Ile) rs200782068
NM_001267550.2(TTN):c.105466C>G (p.Pro35156Ala) rs876658100
NM_001267550.2(TTN):c.105468G>A (p.Pro35156=) rs55806007
NM_001267550.2(TTN):c.105529G>A (p.Val35177Met) rs55865284
NM_001267550.2(TTN):c.105531G>A (p.Val35177=) rs727505323
NM_001267550.2(TTN):c.105562A>C (p.Ile35188Leu) rs727504491
NM_001267550.2(TTN):c.105582C>T (p.Ser35194=) rs3829749
NM_001267550.2(TTN):c.105590G>A (p.Gly35197Asp) rs397517796
NM_001267550.2(TTN):c.105601G>A (p.Val35201Met) rs397517797
NM_001267550.2(TTN):c.105625A>C (p.Lys35209Gln) rs56365812
NM_001267550.2(TTN):c.105630A>C (p.Gln35210His) rs397517798
NM_001267550.2(TTN):c.105719G>A (p.Arg35240Gln) rs530537991
NM_001267550.2(TTN):c.105769G>A (p.Glu35257Lys) rs56324595
NM_001267550.2(TTN):c.10577T>C (p.Ile3526Thr) rs727503677
NM_001267550.2(TTN):c.105782C>T (p.Pro35261Leu) rs16866380
NM_001267550.2(TTN):c.105787G>T (p.Ala35263Ser) rs67254537
NM_001267550.2(TTN):c.105788C>T (p.Ala35263Val) rs66961115
NM_001267550.2(TTN):c.105818C>A (p.Pro35273Gln) rs1553484561
NM_001267550.2(TTN):c.105843A>T (p.Pro35281=) rs876657619
NM_001267550.2(TTN):c.105876G>A (p.Leu35292=) rs372521529
NM_001267550.2(TTN):c.106100C>T (p.Thr35367Met) rs377056111
NM_001267550.2(TTN):c.106121T>A (p.Phe35374Tyr) rs727504609
NM_001267550.2(TTN):c.106275G>C (p.Gly35425=) rs56207956
NM_001267550.2(TTN):c.106445C>G (p.Thr35482Ser) rs397517799
NM_001267550.2(TTN):c.106468T>C (p.Tyr35490His) rs199663911
NM_001267550.2(TTN):c.106476T>C (p.Cys35492=) rs6725673
NM_001267550.2(TTN):c.106578T>A (p.Ser35526=) rs55838839
NM_001267550.2(TTN):c.106580A>T (p.Glu35527Val) rs55725279
NM_001267550.2(TTN):c.106619T>C (p.Ile35540Thr) rs55880440
NM_001267550.2(TTN):c.106638G>A (p.Arg35546=) rs56324602
NM_001267550.2(TTN):c.106675G>C (p.Glu35559Gln) rs199632397
NM_001267550.2(TTN):c.1066G>C (p.Glu356Gln) rs144531477
NM_001267550.2(TTN):c.106736C>T (p.Ser35579Leu) rs727504462
NM_001267550.2(TTN):c.106787C>T (p.Thr35596Ile) rs55842557
NM_001267550.2(TTN):c.106788A>T (p.Thr35596=) rs369896045
NM_001267550.2(TTN):c.10679-10G>C rs397517832
NM_001267550.2(TTN):c.106820C>T (p.Ala35607Val) rs377337528
NM_001267550.2(TTN):c.106827T>G (p.Ile35609Met) rs727504540
NM_001267550.2(TTN):c.10682A>G (p.Gln3561Arg) rs727503676
NM_001267550.2(TTN):c.106837T>G (p.Ser35613Ala) rs374405802
NM_001267550.2(TTN):c.106857C>T (p.Asn35619=) rs116604145
NM_001267550.2(TTN):c.106876T>G (p.Leu35626Val) rs373152640
NM_001267550.2(TTN):c.1068G>A (p.Glu356=) rs144716589
NM_001267550.2(TTN):c.106920G>A (p.Leu35640=) rs183923129
NM_001267550.2(TTN):c.106955G>A (p.Arg35652Gln) rs200497615
NM_001267550.2(TTN):c.107009G>C (p.Arg35670Thr) rs534961012
NM_001267550.2(TTN):c.10700G>A (p.Ser3567Asn) rs72955213
NM_001267550.2(TTN):c.107082G>A (p.Leu35694=) rs727505278
NM_001267550.2(TTN):c.107089G>C (p.Glu35697Gln) rs199531140
NM_001267550.2(TTN):c.107134A>C (p.Asn35712His) rs727504949
NM_001267550.2(TTN):c.107147del (p.Gly35716fs) rs876658101
NM_001267550.2(TTN):c.107198_107223+4del rs1553479603
NM_001267550.2(TTN):c.107223+1G>A rs876658102
NM_001267550.2(TTN):c.107267T>C (p.Val35756Ala) rs16866378
NM_001267550.2(TTN):c.10726A>G (p.Thr3576Ala) rs6433728
NM_001267550.2(TTN):c.107285G>A (p.Arg35762Gln) rs397517800
NM_001267550.2(TTN):c.107377+14C>T rs367908657
NM_001267550.2(TTN):c.107397C>T (p.Ser35799=) rs371480338
NM_001267550.2(TTN):c.107552T>C (p.Met35851Thr) rs1310904463
NM_001267550.2(TTN):c.107576T>C (p.Met35859Thr) rs72629793
NM_001267550.2(TTN):c.107605A>G (p.Ser35869Gly) rs201835888
NM_001267550.2(TTN):c.107657A>G (p.Lys35886Arg) rs727504465
NM_001267550.2(TTN):c.107671G>A (p.Gly35891Ser) rs201298767
NM_001267550.2(TTN):c.107700A>G (p.Glu35900=) rs55832587
NM_001267550.2(TTN):c.10770G>A (p.Glu3590=) rs377401997
NM_001267550.2(TTN):c.107753G>A (p.Cys35918Tyr) rs193212275
NM_001267550.2(TTN):c.107766T>C (p.Gly35922=) rs147293964
NM_001267550.2(TTN):c.107897G>A (p.Gly35966Asp) rs727505008
NM_001267550.2(TTN):c.107915G>T (p.Ser35972Ile) rs397517478
NM_001267550.2(TTN):c.107961T>C (p.His35987=) rs377439315
NM_001267550.2(TTN):c.1079G>C (p.Arg360Thr) rs56128843
NM_001267550.2(TTN):c.10850C>T (p.Ser3617Phe) rs57389274
NM_001267550.2(TTN):c.10854A>C (p.Gln3618His) rs79466278
NM_001267550.2(TTN):c.10922T>C (p.Ile3641Thr) rs141027782
NM_001267550.2(TTN):c.10931G>A (p.Ser3644Asn) rs78535378
NM_001267550.2(TTN):c.10977G>A (p.Ala3659=) rs369327691
NM_001267550.2(TTN):c.11019C>T (p.Cys3673=) rs72955212
NM_001267550.2(TTN):c.11063T>C (p.Phe3688Ser) rs377296133
NM_001267550.2(TTN):c.11109C>T (p.Ser3703=) rs879160199
NM_001267550.2(TTN):c.11140A>G (p.Ile3714Val) rs397517833
NM_001267550.2(TTN):c.11252G>A (p.Gly3751Asp) rs7585334
NM_001267550.2(TTN):c.11311+1079_11311+1080del rs58651353
NM_001267550.2(TTN):c.11311+1080del rs58651353
NM_001267550.2(TTN):c.11311+1134C>T rs727505183
NM_001267550.2(TTN):c.11311+1135G>A rs149878929
NM_001267550.2(TTN):c.11311+1177G>C rs727503675
NM_001267550.2(TTN):c.11311+1283C>T rs189445085
NM_001267550.2(TTN):c.11311+1341T>C rs200284932
NM_001267550.2(TTN):c.11311+1349G>A rs141926114
NM_001267550.2(TTN):c.11311+1357C>T rs373311410
NM_001267550.2(TTN):c.11311+1369C>T rs201047740
NM_001267550.2(TTN):c.11311+1370G>A rs148115514
NM_001267550.2(TTN):c.11311+1372C>T rs141407971
NM_001267550.2(TTN):c.11311+1408T>G rs727503673
NM_001267550.2(TTN):c.11311+1561G>A rs144967245
NM_001267550.2(TTN):c.11311+1604G>C rs727503674
NM_001267550.2(TTN):c.11311+1641C>T rs140804168
NM_001267550.2(TTN):c.11311+1644T>C rs142585268
NM_001267550.2(TTN):c.11311+1730A>G rs72647896
NM_001267550.2(TTN):c.11311+1788T>C rs727503672
NM_001267550.2(TTN):c.11311+1790del rs727503671
NM_001267550.2(TTN):c.11311+1799G>C rs147314430
NM_001267550.2(TTN):c.11311+1857A>G rs922986
NM_001267550.2(TTN):c.11311+1892C>T rs397517803
NM_001267550.2(TTN):c.11311+1920G>C rs922985
NM_001267550.2(TTN):c.11311+1949del rs727503670
NM_001267550.2(TTN):c.11311+1964A>G rs922984
NM_001267550.2(TTN):c.11311+1977A>G rs374616494
NM_001267550.2(TTN):c.11311+1978T>A rs144209883
NM_001267550.2(TTN):c.11311+2007G>C rs200816462
NM_001267550.2(TTN):c.11311+2236C>T rs756000739
NM_001267550.2(TTN):c.11311+2362A>G rs542259495
NM_001267550.2(TTN):c.11311+2465C>G rs116593093
NM_001267550.2(TTN):c.11311+2481C>G rs369074426
NM_001267550.2(TTN):c.11311+2533A>C rs562658562
NM_001267550.2(TTN):c.11311+2545C>T rs397517804
NM_001267550.2(TTN):c.11311+2573T>C rs72647897
NM_001267550.2(TTN):c.11311+2649G>A rs562072193
NM_001267550.2(TTN):c.11311+2680C>T rs200935937
NM_001267550.2(TTN):c.11311+2731C>T rs200550488
NM_001267550.2(TTN):c.11311+2833C>T rs761974222
NM_001267550.2(TTN):c.11311+2853A>G rs727503669
NM_001267550.2(TTN):c.11311+2877C>T rs200304872
NM_001267550.2(TTN):c.11311+2899T>C rs10803917
NM_001267550.2(TTN):c.11311+2950G>A rs144690298
NM_001267550.2(TTN):c.11311+3111G>A rs142887857
NM_001267550.2(TTN):c.11311+3133G>C rs727504522
NM_001267550.2(TTN):c.11311+3208C>T rs727504521
NM_001267550.2(TTN):c.11311+3226G>A rs1367949983
NM_001267550.2(TTN):c.11311+3260A>C rs568690706
NM_001267550.2(TTN):c.11311+3274G>T rs145460295
NM_001267550.2(TTN):c.11311+3377T>C rs397517805
NM_001267550.2(TTN):c.11311+3378T>G rs727503668
NM_001267550.2(TTN):c.11311+3440C>T rs72647901
NM_001267550.2(TTN):c.11311+3448A>G rs541264551
NM_001267550.2(TTN):c.11311+3611C>T rs727504927
NM_001267550.2(TTN):c.11311+3670G>A rs727503667
NM_001267550.2(TTN):c.11311+3703A>G rs144226338
NM_001267550.2(TTN):c.11311+3716dup rs397517806
NM_001267550.2(TTN):c.11311+3737A>G rs140583865
NM_001267550.2(TTN):c.11311+3769C>A rs140064945
NM_001267550.2(TTN):c.11311+3792A>G rs16866490
NM_001267550.2(TTN):c.11311+3799G>A rs876658103
NM_001267550.2(TTN):c.11311+3827A>G rs145803192
NM_001267550.2(TTN):c.11311+3847G>T rs72647902
NM_001267550.2(TTN):c.11311+3889G>A rs72648903
NM_001267550.2(TTN):c.11311+3928C>T rs370602665
NM_001267550.2(TTN):c.11311+3934A>G rs397517807
NM_001267550.2(TTN):c.11311+3945G>A rs529300203
NM_001267550.2(TTN):c.11311+3976T>A rs876658104
NM_001267550.2(TTN):c.11311+4019A>G rs397517808
NM_001267550.2(TTN):c.11311+4071A>G rs144539321
NM_001267550.2(TTN):c.11311+4088A>G rs142304137
NM_001267550.2(TTN):c.11311+4098T>C rs397517809
NM_001267550.2(TTN):c.11311+4168A>G rs149169686
NM_001267550.2(TTN):c.11311+4179T>C rs146470872
NM_001267550.2(TTN):c.11311+4200C>T rs72648904
NM_001267550.2(TTN):c.11311+4202A>C rs78457662
NM_001267550.2(TTN):c.11311+4313T>G rs200066725
NM_001267550.2(TTN):c.11311+4332C>T rs72648905
NM_001267550.2(TTN):c.11311+4338A>C rs139344272
NM_001267550.2(TTN):c.11311+4357G>A rs147884688
NM_001267550.2(TTN):c.11311+4470A>G rs201945197
NM_001267550.2(TTN):c.11311+4516C>T rs145996491
NM_001267550.2(TTN):c.11311+4523A>C rs200760091
NM_001267550.2(TTN):c.11311+4538T>C rs397517810
NM_001267550.2(TTN):c.11311+4583A>C rs139172299
NM_001267550.2(TTN):c.11311+4587G>A rs77419653
NM_001267550.2(TTN):c.11311+4593T>G rs72648906
NM_001267550.2(TTN):c.11311+4612C>G rs139103966
NM_001267550.2(TTN):c.11311+4660A>G rs140909116
NM_001267550.2(TTN):c.11311+4672C>T rs149748934
NM_001267550.2(TTN):c.11311+4675A>G rs190193836
NM_001267550.2(TTN):c.11311+4704C>G rs75785339
NM_001267550.2(TTN):c.11311+4708A>G rs374783099
NM_001267550.2(TTN):c.11311+4750A>G rs397517811
NM_001267550.2(TTN):c.11311+4802T>C rs139486133
NM_001267550.2(TTN):c.11311+4838G>A rs144127396
NM_001267550.2(TTN):c.11311+4938C>T rs147513899
NM_001267550.2(TTN):c.11311+4964A>T rs149586047
NM_001267550.2(TTN):c.11311+4968T>C rs139669372
NM_001267550.2(TTN):c.11311+4982G>T rs397517812
NM_001267550.2(TTN):c.11311+5019T>G rs140366460
NM_001267550.2(TTN):c.11311+5051T>C rs142132973
NM_001267550.2(TTN):c.11311+5055G>C rs397517813
NM_001267550.2(TTN):c.11311+5123G>A rs565140436
NM_001267550.2(TTN):c.11311+5213A>G rs144905085
NM_001267550.2(TTN):c.11311+5217C>T rs876657620
NM_001267550.2(TTN):c.11311+5250T>A rs776361113
NM_001267550.2(TTN):c.11311+5276T>C rs143310631
NM_001267550.2(TTN):c.11311+5339C>G rs876658105
NM_001267550.2(TTN):c.11311+5340C>T rs148105798
NM_001267550.2(TTN):c.11311+5412T>C rs727503666
NM_001267550.2(TTN):c.11311+5468G>A rs72648907
NM_001267550.2(TTN):c.11311+5478T>G rs72648908
NM_001267550.2(TTN):c.11311+5491A>G rs773571719
NM_001267550.2(TTN):c.11311+5514C>G rs370038956
NM_001267550.2(TTN):c.11311+5530A>T rs72648909
NM_001267550.2(TTN):c.11311+5536A>G rs145581345
NM_001267550.2(TTN):c.11312-3829T>C rs16866488
NM_001267550.2(TTN):c.11312-3866G>A rs145932311
NM_001267550.2(TTN):c.11312-3877G>A rs141624211
NM_001267550.2(TTN):c.11312-3895T>C rs876657622
NM_001267550.2(TTN):c.11312-3963G>T rs148430495
NM_001267550.2(TTN):c.11312-3971G>C rs16866489
NM_001267550.2(TTN):c.11312-4008A>C rs191751905
NM_001267550.2(TTN):c.11312-4047G>A rs72648915
NM_001267550.2(TTN):c.11312-4085G>A rs148147002
NM_001267550.2(TTN):c.11312-4092_11312-4089del rs397517822
NM_001267550.2(TTN):c.11312-4095G>A rs876658106
NM_001267550.2(TTN):c.11312-4126C>G rs397517821
NM_001267550.2(TTN):c.11312-4151T>C rs145183384
NM_001267550.2(TTN):c.11312-4215C>G rs397517820
NM_001267550.2(TTN):c.11312-4258G>A rs397517819
NM_001267550.2(TTN):c.11312-4305C>A rs397517818
NM_001267550.2(TTN):c.11312-4319G>A rs72648913
NM_001267550.2(TTN):c.11312-4404A>G rs372044281
NM_001267550.2(TTN):c.11312-4459T>C rs200378944
NM_001267550.2(TTN):c.11312-4463A>G rs372997814
NM_001267550.2(TTN):c.11312-4478C>T rs151253841
NM_001267550.2(TTN):c.11312-4498G>A rs186841908
NM_001267550.2(TTN):c.11312-4518G>A rs397517817
NM_001267550.2(TTN):c.11312-4553A>G rs150017914
NM_001267550.2(TTN):c.11312-4697T>C rs375197115
NM_001267550.2(TTN):c.11312-4701A>G rs369214339
NM_001267550.2(TTN):c.11312-4711T>A rs138826545
NM_001267550.2(TTN):c.11312-4724A>G rs727503663
NM_001267550.2(TTN):c.11312-4819A>G rs876657621
NM_001267550.2(TTN):c.11312-4826G>A rs727505032
NM_001267550.2(TTN):c.11312-4871T>C rs200376564
NM_001267550.2(TTN):c.11312-4873C>T rs138122578
NM_001267550.2(TTN):c.11312-4894T>C rs149543721
NM_001267550.2(TTN):c.11312-4904G>A rs62179016
NM_001267550.2(TTN):c.11312-4959A>G rs727504853
NM_001267550.2(TTN):c.11312-4992C>T rs727504760
NM_001267550.2(TTN):c.11312-5032C>T rs72648911
NM_001267550.2(TTN):c.11312-5063G>T rs66677602
NM_001267550.2(TTN):c.11312-5141C>T rs397517816
NM_001267550.2(TTN):c.11312-5177A>G rs142973956
NM_001267550.2(TTN):c.11312-5194_11312-5162dup rs397517815
NM_001267550.2(TTN):c.11312-5196T>C rs557767596
NM_001267550.2(TTN):c.11312-5199_11312-5167del rs397517814
NM_001267550.2(TTN):c.11312-5203G>A rs72648910
NM_001267550.2(TTN):c.11312-5227T>C rs61233923
NM_001267550.2(TTN):c.11312-5286C>T rs200953966
NM_001267550.2(TTN):c.11312-5297G>A rs727503664
NM_001267550.2(TTN):c.11312-5310G>T rs727503665
NM_001267550.2(TTN):c.11312-5357C>G rs148791107
NM_001267550.2(TTN):c.11312-5477A>T rs727504519
NM_001267550.2(TTN):c.11312-5568A>G rs727504687
NM_001267550.2(TTN):c.11312-5577G>A rs371444691
NM_001267550.2(TTN):c.11312-5598C>T rs565101305
NM_001267550.2(TTN):c.11334T>C (p.Ser3778=) rs397517824
NM_001267550.2(TTN):c.11338G>A (p.Glu3780Lys) rs727504586
NM_001267550.2(TTN):c.11370A>G (p.Gln3790=) rs72648918
NM_001267550.2(TTN):c.1137A>G (p.Arg379=) rs55972547
NM_001267550.2(TTN):c.11422C>T (p.Pro3808Ser) rs2627037
NM_001267550.2(TTN):c.11440G>A (p.Glu3814Lys) rs375103237
NM_001267550.2(TTN):c.11450G>A (p.Gly3817Asp) rs371056587
NM_001267550.2(TTN):c.11502G>A (p.Gly3834=) rs777420658
NM_001267550.2(TTN):c.11506G>A (p.Val3836Met) rs397517825
NM_001267550.2(TTN):c.11546C>T (p.Pro3849Leu) rs727503662
NM_001267550.2(TTN):c.11583C>T (p.Thr3861=) rs11899887
NM_001267550.2(TTN):c.11602T>C (p.Phe3868Leu) rs727504700
NM_001267550.2(TTN):c.11657del (p.Asp3886fs) rs397517826
NM_001267550.2(TTN):c.11672C>T (p.Thr3891Ile) rs148164929
NM_001267550.2(TTN):c.11719C>G (p.Leu3907Val) rs55853696
NM_001267550.2(TTN):c.11756C>A (p.Thr3919Asn) rs727503661
NM_001267550.2(TTN):c.11756C>T (p.Thr3919Ile) rs727503661
NM_001267550.2(TTN):c.11788G>A (p.Glu3930Lys) rs186624523
NM_001267550.2(TTN):c.11842C>T (p.Arg3948Cys) rs397517827
NM_001267550.2(TTN):c.1186G>A (p.Ala396Thr) rs200052202
NM_001267550.2(TTN):c.11910A>T (p.Thr3970=) rs727503660
NM_001267550.2(TTN):c.11969C>T (p.Pro3990Leu) rs33971253
NM_001267550.2(TTN):c.11991T>C (p.Ile3997=) rs565546452
NM_001267550.2(TTN):c.12037G>A (p.Ala4013Thr) rs397517828
NM_001267550.2(TTN):c.1208G>C (p.Ser403Thr) rs727505091
NM_001267550.2(TTN):c.12103A>G (p.Met4035Val) rs727503659
NM_001267550.2(TTN):c.12117C>T (p.Pro4039=) rs55895721
NM_001267550.2(TTN):c.1213G>A (p.Ala405Thr) rs112266780
NM_001267550.2(TTN):c.12145C>T (p.Pro4049Ser) rs201888760
NM_001267550.2(TTN):c.12175G>T (p.Gly4059Cys) rs377114166
NM_001267550.2(TTN):c.12181G>A (p.Ala4061Thr) rs397517829
NM_001267550.2(TTN):c.12195T>C (p.Leu4065=) rs201129413
NM_001267550.2(TTN):c.12208G>T (p.Glu4070Ter) rs397517830
NM_001267550.2(TTN):c.12233C>T (p.Thr4078Ile) rs80136515
NM_001267550.2(TTN):c.12234C>G (p.Thr4078=) rs192857526
NM_001267550.2(TTN):c.12235A>G (p.Ile4079Val) rs34070843
NM_001267550.2(TTN):c.12255T>C (p.Ile4085=) rs2742357
NM_001267550.2(TTN):c.12361G>C (p.Asp4121His) rs370209978
NM_001267550.2(TTN):c.12401T>A (p.Ile4134Asn) rs112009206
NM_001267550.2(TTN):c.12405del (p.Asn4135fs) rs727503658
NM_001267550.2(TTN):c.1246-5T>C rs727503707
NM_001267550.2(TTN):c.12547A>G (p.Lys4183Glu) rs201565932
NM_001267550.2(TTN):c.12558A>G (p.Pro4186=) rs72648921
NM_001267550.2(TTN):c.12580A>T (p.Ile4194Phe) rs34618570
NM_001267550.2(TTN):c.12587C>A (p.Ser4196Ter) rs370912401
NM_001267550.2(TTN):c.12653T>C (p.Ile4218Thr) rs374631591
NM_001267550.2(TTN):c.12733A>C (p.Asn4245His) rs199652066
NM_001267550.2(TTN):c.12734A>G (p.Asn4245Ser) rs879167134
NM_001267550.2(TTN):c.12748G>A (p.Val4250Met) rs201437752
NM_001267550.2(TTN):c.12780G>A (p.Ala4260=) rs746578
NM_001267550.2(TTN):c.12780G>T (p.Ala4260=) rs746578
NM_001267550.2(TTN):c.12821G>A (p.Ser4274Asn) rs200348414
NM_001267550.2(TTN):c.12851A>C (p.Gln4284Pro) rs876658107
NM_001267550.2(TTN):c.12887C>T (p.Ser4296Leu) rs727503657
NM_001267550.2(TTN):c.12889T>G (p.Cys4297Gly) rs377063950
NM_001267550.2(TTN):c.12986G>A (p.Arg4329Lys) rs199560188
NM_001267550.2(TTN):c.13058del (p.Pro4353fs) rs1408345511
NM_001267550.2(TTN):c.13078A>C (p.Lys4360Gln) rs727504903
NM_001267550.2(TTN):c.13090G>A (p.Val4364Met) rs201506104
NM_001267550.2(TTN):c.1312G>A (p.Val438Met) rs727504795
NM_001267550.2(TTN):c.13194A>G (p.Gln4398=) rs375347596
NM_001267550.2(TTN):c.13202G>A (p.Arg4401Gln) rs200431386
NM_001267550.2(TTN):c.13218C>T (p.Ala4406=) rs1883084
NM_001267550.2(TTN):c.13265T>G (p.Ile4422Ser) rs727503656
NM_001267550.2(TTN):c.13282G>A (p.Glu4428Lys) rs528766978
NM_001267550.2(TTN):c.13287T>C (p.Ala4429=) rs370604524
NM_001267550.2(TTN):c.1333G>A (p.Ala445Thr) rs142414432
NM_001267550.2(TTN):c.13376T>C (p.Ile4459Thr) rs763065439
NM_001267550.2(TTN):c.13499A>G (p.Lys4500Arg) rs727503655
NM_001267550.2(TTN):c.1349C>T (p.Ala450Val) rs727503706
NM_001267550.2(TTN):c.13501A>G (p.Thr4501Ala) rs750320283
NM_001267550.2(TTN):c.13520T>C (p.Met4507Thr) rs191968963
NM_001267550.2(TTN):c.13594A>C (p.Thr4532Pro) rs2562829
NM_001267550.2(TTN):c.13599A>G (p.Glu4533=) rs727503654
NM_001267550.2(TTN):c.13614dup (p.Asn4539Ter) rs876657673
NM_001267550.2(TTN):c.13618G>A (p.Val4540Met) rs201046911
NM_001267550.2(TTN):c.13654G>A (p.Val4552Ile) rs374214280
NM_001267550.2(TTN):c.1365G>A (p.Thr455=) rs145211131
NM_001267550.2(TTN):c.13706G>A (p.Ser4569Asn) rs115532048
NM_001267550.2(TTN):c.13782G>A (p.Gln4594=) rs188071134
NM_001267550.2(TTN):c.13793del (p.Gly4598fs) rs727503653
NM_001267550.2(TTN):c.13800A>C (p.Leu4600Phe) rs1883085
NM_001267550.2(TTN):c.13859G>A (p.Gly4620Asp) rs55857742
NM_001267550.2(TTN):c.13864A>G (p.Ile4622Val) rs397517831
NM_001267550.2(TTN):c.13884C>T (p.Ser4628=) rs183328495
NM_001267550.2(TTN):c.13969A>C (p.Asn4657His) rs200204761
NM_001267550.2(TTN):c.13976A>G (p.Tyr4659Cys) rs34706803
NM_001267550.2(TTN):c.1398+4C>T rs368548209
NM_001267550.2(TTN):c.14004C>T (p.Thr4668=) rs201200682
NM_001267550.2(TTN):c.14169C>T (p.Ile4723=) rs397517479
NM_001267550.2(TTN):c.14189G>A (p.Arg4730Gln) rs202017278
NM_001267550.2(TTN):c.14232C>A (p.Asp4744Glu) rs55906845
NM_001267550.2(TTN):c.1429A>T (p.Thr477Ser) rs727503705
NM_001267550.2(TTN):c.14302G>A (p.Gly4768Ser) rs727503652
NM_001267550.2(TTN):c.14309A>G (p.Tyr4770Cys) rs371552518
NM_001267550.2(TTN):c.14326A>G (p.Asn4776Asp) rs727505309
NM_001267550.2(TTN):c.1449C>T (p.Ala483=) rs141617218
NM_001267550.2(TTN):c.14525G>A (p.Arg4842Lys) rs2742347
NM_001267550.2(TTN):c.14533G>A (p.Asp4845Asn) rs373378672
NM_001267550.2(TTN):c.14535C>T (p.Asp4845=) rs184307461
NM_001267550.2(TTN):c.14610C>T (p.Ser4870=) rs2742348
NM_001267550.2(TTN):c.14697C>T (p.Ser4899=) rs372740215
NM_001267550.2(TTN):c.14698G>A (p.Ala4900Thr) rs72648923
NM_001267550.2(TTN):c.14765G>A (p.Ser4922Asn) rs184740744
NM_001267550.2(TTN):c.14784C>A (p.Leu4928=) rs373875040
NM_001267550.2(TTN):c.14813T>C (p.Phe4938Ser) rs560537668
NM_001267550.2(TTN):c.14828C>A (p.Ala4943Glu) rs540497678
NM_001267550.2(TTN):c.14850C>G (p.Ala4950=) rs376339761
NM_001267550.2(TTN):c.14870C>G (p.Thr4957Ser) rs72648925
NM_001267550.2(TTN):c.1492G>A (p.Val498Ile) rs72647851
NM_001267550.2(TTN):c.14984C>G (p.Pro4995Arg) rs72648927
NM_001267550.2(TTN):c.14998C>T (p.Arg5000Cys) rs369933152
NM_001267550.2(TTN):c.1499C>T (p.Thr500Ile) rs727503704
NM_001267550.2(TTN):c.15040A>G (p.Thr5014Ala) rs143093473
NM_001267550.2(TTN):c.15063A>C (p.Glu5021Asp) rs727503651
NM_001267550.2(TTN):c.15130G>A (p.Val5044Ile) rs727503650
NM_001267550.2(TTN):c.15178G>A (p.Val5060Ile) rs72648929
NM_001267550.2(TTN):c.15178G>C (p.Val5060Leu) rs72648929
NM_001267550.2(TTN):c.151C>T (p.Leu51=) rs397517489
NM_001267550.2(TTN):c.15369_15371del (p.Leu5123del) rs397517480
NM_001267550.2(TTN):c.15415A>G (p.Ser5139Gly) rs876658040
NM_001267550.2(TTN):c.15496+1G>A rs397517481
NM_001267550.2(TTN):c.15497-8T>C rs727505010
NM_001267550.2(TTN):c.15542G>C (p.Gly5181Ala) rs201185434
NM_001267550.2(TTN):c.15552C>T (p.Thr5184=) rs146353237
NM_001267550.2(TTN):c.15563A>C (p.Gln5188Pro) rs72648930
NM_001267550.2(TTN):c.15584A>G (p.Glu5195Gly) rs72648931
NM_001267550.2(TTN):c.156C>T (p.Pro52=) rs72647842
NM_001267550.2(TTN):c.15717G>A (p.Thr5239=) rs72648932
NM_001267550.2(TTN):c.15775+14C>T rs151057960
NM_001267550.2(TTN):c.15778C>A (p.Pro5260Thr) rs727505108
NM_001267550.2(TTN):c.15792T>C (p.Ile5264=) rs12993099
NM_001267550.2(TTN):c.15850G>A (p.Val5284Met) rs66839174
NM_001267550.2(TTN):c.1585G>A (p.Ala529Thr) rs143030869
NM_001267550.2(TTN):c.15860C>T (p.Thr5287Met) rs148551876
NM_001267550.2(TTN):c.15901T>C (p.Leu5301=) rs727505349
NM_001267550.2(TTN):c.15906C>T (p.Val5302=) rs375179152
NM_001267550.2(TTN):c.15978C>T (p.His5326=) rs397517482
NM_001267550.2(TTN):c.16055-9A>C rs368897883
NM_001267550.2(TTN):c.16091G>A (p.Arg5364His) rs200941841
NM_001267550.2(TTN):c.16095C>T (p.Asn5365=) rs72648935
NM_001267550.2(TTN):c.16113T>C (p.Asn5371=) rs143845692
NM_001267550.2(TTN):c.16157T>C (p.Met5386Thr) rs375417155
NM_001267550.2(TTN):c.16234G>A (p.Ala5412Thr) rs727504442
NM_001267550.2(TTN):c.16303G>A (p.Val5435Met) rs72648937
NM_001267550.2(TTN):c.16313A>G (p.Lys5438Arg) rs190636272
NM_001267550.2(TTN):c.16351A>G (p.Ser5451Gly) rs760722200
NM_001267550.2(TTN):c.16367C>A (p.Pro5456His) rs876658041
NM_001267550.2(TTN):c.16422A>G (p.Gln5474=) rs371026448
NM_001267550.2(TTN):c.16480G>A (p.Gly5494Arg) rs727504697
NM_001267550.2(TTN):c.16492A>G (p.Ile5498Val) rs876658042
NM_001267550.2(TTN):c.16529A>G (p.Tyr5510Cys) rs72648939
NM_001267550.2(TTN):c.16546G>T (p.Asp5516Tyr) rs72648940
NM_001267550.2(TTN):c.16551G>A (p.Ser5517=) rs376037792
NM_001267550.2(TTN):c.16574G>C (p.Ser5525Thr) rs727503649
NM_001267550.2(TTN):c.16577A>G (p.Asn5526Ser) rs767376352
NM_001267550.2(TTN):c.16621+7A>T rs10200398
NM_001267550.2(TTN):c.16751T>A (p.Ile5584Asn) rs779652311
NM_001267550.2(TTN):c.16839A>C (p.Glu5613Asp) rs397517483
NM_001267550.2(TTN):c.16863G>A (p.Glu5621=) rs727504441
NM_001267550.2(TTN):c.16895T>C (p.Ile5632Thr) rs727504971
NM_001267550.2(TTN):c.1691C>T (p.Ala564Val) rs727505068
NM_001267550.2(TTN):c.17048A>G (p.Tyr5683Cys) rs72648942
NM_001267550.2(TTN):c.17075T>C (p.Val5692Ala) rs570039271
NM_001267550.2(TTN):c.1709C>T (p.Ala570Val) rs146690035
NM_001267550.2(TTN):c.17115C>T (p.Gly5705=) rs370036981
NM_001267550.2(TTN):c.17116G>A (p.Glu5706Lys) rs376593556
NM_001267550.2(TTN):c.17208C>G (p.Ile5736Met) rs397517484
NM_001267550.2(TTN):c.17224C>T (p.Leu5742Phe) rs72648943
NM_001267550.2(TTN):c.1728A>G (p.Lys576=) rs727503703
NM_001267550.2(TTN):c.17300G>A (p.Ser5767Asn) rs200692495
NM_001267550.2(TTN):c.17312C>G (p.Thr5771Ser) rs16866477
NM_001267550.2(TTN):c.17386C>G (p.His5796Asp) rs397517485
NM_001267550.2(TTN):c.1742C>T (p.Pro581Leu) rs199778910
NM_001267550.2(TTN):c.17500G>A (p.Val5834Ile) rs727505221
NM_001267550.2(TTN):c.17543G>A (p.Gly5848Glu) rs185962498
NM_001267550.2(TTN):c.17669G>C (p.Ser5890Thr) rs775293848
NM_001267550.2(TTN):c.17752C>A (p.Pro5918Thr) rs727504480
NM_001267550.2(TTN):c.1776T>C (p.Asp592=) rs147081804
NM_001267550.2(TTN):c.177C>A (p.Ser59Arg) rs191057824
NM_001267550.2(TTN):c.17806A>G (p.Ile5936Val) rs72648945
NM_001267550.2(TTN):c.17818T>C (p.Cys5940Arg) rs374882815
NM_001267550.2(TTN):c.17821A>G (p.Ile5941Val) rs397517487
NM_001267550.2(TTN):c.17888A>G (p.Glu5963Gly) rs146983095
NM_001267550.2(TTN):c.178G>T (p.Asp60Tyr) rs35683768
NM_001267550.2(TTN):c.17928G>A (p.Leu5976=) rs373963067
NM_001267550.2(TTN):c.17989G>A (p.Ala5997Thr) rs72648946
NM_001267550.2(TTN):c.17C>T (p.Pro6Leu) rs201490999
NM_001267550.2(TTN):c.18075C>T (p.Pro6025=) rs557350005
NM_001267550.2(TTN):c.180T>C (p.Asp60=) rs144750850
NM_001267550.2(TTN):c.1816A>G (p.Arg606Gly) rs397517498
NM_001267550.2(TTN):c.18172C>T (p.Arg6058Cys) rs189127014
NM_001267550.2(TTN):c.18173G>A (p.Arg6058His) rs376012117
NM_001267550.2(TTN):c.18231C>T (p.Thr6077=) rs377639910
NM_001267550.2(TTN):c.1828G>C (p.Val610Leu) rs397517499
NM_001267550.2(TTN):c.18292A>G (p.Thr6098Ala) rs727505140
NM_001267550.2(TTN):c.18307+12A>G rs376899412
NM_001267550.2(TTN):c.18325A>G (p.Lys6109Glu) rs73973139
NM_001267550.2(TTN):c.1834A>G (p.Lys612Glu) rs727505256
NM_001267550.2(TTN):c.18363G>A (p.Gln6121=) rs375032616
NM_001267550.2(TTN):c.18379T>G (p.Cys6127Gly) rs370812788
NM_001267550.2(TTN):c.18390A>T (p.Thr6130=) rs66523653
NM_001267550.2(TTN):c.18413C>A (p.Ser6138Tyr) rs727504477
NM_001267550.2(TTN):c.18456T>C (p.His6152=) rs756540833
NM_001267550.2(TTN):c.1851A>C (p.Thr617=) rs727504530
NM_001267550.2(TTN):c.18531G>C (p.Val6177=) rs370684491
NM_001267550.2(TTN):c.18561G>A (p.Ala6187=) rs377556808
NM_001267550.2(TTN):c.18609A>G (p.Arg6203=) rs777227340
NM_001267550.2(TTN):c.18653T>G (p.Leu6218Arg) rs727505193
NM_001267550.2(TTN):c.18659G>C (p.Cys6220Ser) rs191692293
NM_001267550.2(TTN):c.18663A>C (p.Glu6221Asp) rs369544339
NM_001267550.2(TTN):c.18680C>T (p.Pro6227Leu) rs376846228
NM_001267550.2(TTN):c.18745G>A (p.Asp6249Asn) rs201263441
NM_001267550.2(TTN):c.18776C>G (p.Thr6259Ser) rs72648949
NM_001267550.2(TTN):c.18778A>C (p.Lys6260Gln) rs375652574
NM_001267550.2(TTN):c.18810G>A (p.Gln6270=) rs727505012
NM_001267550.2(TTN):c.18816T>C (p.Ile6272=) rs146219199
NM_001267550.2(TTN):c.18824A>G (p.Asn6275Ser) rs184412722
NM_001267550.2(TTN):c.18832G>A (p.Gly6278Ser) rs397517488
NM_001267550.2(TTN):c.18856G>A (p.Val6286Ile) rs149131555
NM_001267550.2(TTN):c.18903C>T (p.Thr6301=) rs72648950
NM_001267550.2(TTN):c.18961A>G (p.Ile6321Val) rs145204073
NM_001267550.2(TTN):c.19004A>G (p.Asp6335Gly) rs72648951
NM_001267550.2(TTN):c.19015T>C (p.Tyr6339His) rs397517490
NM_001267550.2(TTN):c.19016A>G (p.Tyr6339Cys) rs192553687
NM_001267550.2(TTN):c.19054A>G (p.Arg6352Gly) rs569003242
NM_001267550.2(TTN):c.19063G>T (p.Asp6355Tyr) rs188878341
NM_001267550.2(TTN):c.1914A>G (p.Glu638=) rs727504691
NM_001267550.2(TTN):c.19150C>A (p.Pro6384Thr) rs72648953
NM_001267550.2(TTN):c.19191G>A (p.Thr6397=) rs140495148
NM_001267550.2(TTN):c.19204A>G (p.Met6402Val) rs72648954
NM_001267550.2(TTN):c.19263C>T (p.Asp6421=) rs552531581
NM_001267550.2(TTN):c.19282A>T (p.Ser6428Cys) rs727505137
NM_001267550.2(TTN):c.19301G>A (p.Ser6434Asn) rs11888217
NM_001267550.2(TTN):c.19315G>A (p.Val6439Met) rs727505289
NM_001267550.2(TTN):c.19356C>T (p.Ser6452=) rs369275615
NM_001267550.2(TTN):c.19383T>C (p.Asn6461=) rs76771282
NM_001267550.2(TTN):c.19426+2T>A rs727505178
NM_001267550.2(TTN):c.19483G>A (p.Gly6495Ser) rs397517491
NM_001267550.2(TTN):c.1953C>T (p.Ala651=) rs778742098
NM_001267550.2(TTN):c.19715-4A>G rs375009631
NM_001267550.2(TTN):c.19728C>T (p.Phe6576=) rs751902051
NM_001267550.2(TTN):c.19738C>T (p.Pro6580Ser) rs116572520
NM_001267550.2(TTN):c.19818A>G (p.Lys6606=) rs397517492
NM_001267550.2(TTN):c.19914T>C (p.Ala6638=) rs1317197263
NM_001267550.2(TTN):c.19922C>A (p.Thr6641Asn) rs747240394
NM_001267550.2(TTN):c.19963G>A (p.Asp6655Asn) rs397517493
NM_001267550.2(TTN):c.19976C>T (p.Thr6659Met) rs16866475
NM_001267550.2(TTN):c.20025C>A (p.Ala6675=) rs373842558
NM_001267550.2(TTN):c.20142C>T (p.Tyr6714=) rs535793314
NM_001267550.2(TTN):c.20147T>A (p.Met6716Lys) rs28626194
NM_001267550.2(TTN):c.20169C>T (p.Ala6723=) rs727504776
NM_001267550.2(TTN):c.20175A>G (p.Ile6725Met) rs146627500
NM_001267550.2(TTN):c.20236G>A (p.Ala6746Thr) rs202108224
NM_001267550.2(TTN):c.20260A>G (p.Lys6754Glu) rs397517494
NM_001267550.2(TTN):c.20263G>C (p.Val6755Leu) rs876657599
NM_001267550.2(TTN):c.202C>T (p.Pro68Ser) rs876658046
NM_001267550.2(TTN):c.20335A>T (p.Ser6779Cys) rs149470241
NM_001267550.2(TTN):c.20341G>A (p.Glu6781Lys) rs72648958
NM_001267550.2(TTN):c.20367G>A (p.Pro6789=) rs368422028
NM_001267550.2(TTN):c.20468T>G (p.Val6823Gly) rs529417675
NM_001267550.2(TTN):c.204C>T (p.Pro68=) rs201089861
NM_001267550.2(TTN):c.20602G>A (p.Gly6868Arg) rs17355460
NM_001267550.2(TTN):c.20630T>C (p.Ile6877Thr) rs142794598
NM_001267550.2(TTN):c.20736A>G (p.Leu6912=) rs876657600
NM_001267550.2(TTN):c.20742T>A (p.Phe6914Leu) rs397517495
NM_001267550.2(TTN):c.20743G>T (p.Ala6915Ser) rs201728165
NM_001267550.2(TTN):c.20772G>A (p.Lys6924=) rs369993514
NM_001267550.2(TTN):c.20798G>C (p.Gly6933Ala) rs200118743
NM_001267550.2(TTN):c.2082C>T (p.Asp694=) rs534874686
NM_001267550.2(TTN):c.2084T>C (p.Val695Ala) rs727503702
NM_001267550.2(TTN):c.20861C>T (p.Ala6954Val) rs17355446
NM_001267550.2(TTN):c.20892G>A (p.Thr6964=) rs727504623
NM_001267550.2(TTN):c.20971A>G (p.Ser6991Gly) rs397517496
NM_001267550.2(TTN):c.21003A>G (p.Lys7001=) rs727504579
NM_001267550.2(TTN):c.21019A>T (p.Ile7007Phe) rs114626713
NM_001267550.2(TTN):c.21044C>T (p.Ala7015Val) rs72648960
NM_001267550.2(TTN):c.21106G>A (p.Asp7036Asn) rs72648962
NM_001267550.2(TTN):c.21148C>T (p.Leu7050=) rs202089818
NM_001267550.2(TTN):c.21157A>C (p.Thr7053Pro) rs727504741
NM_001267550.2(TTN):c.21173G>A (p.Gly7058Asp) rs72648964
NM_001267550.2(TTN):c.21197A>G (p.Lys7066Arg) rs553548392
NM_001267550.2(TTN):c.21227C>T (p.Ala7076Val) rs374625641
NM_001267550.2(TTN):c.21279A>G (p.Thr7093=) rs727504765
NM_001267550.2(TTN):c.21332T>C (p.Met7111Thr) rs374408615
NM_001267550.2(TTN):c.21364G>A (p.Ala7122Thr) rs201394117
NM_001267550.2(TTN):c.2137C>T (p.Arg713Ter) rs727505277
NM_001267550.2(TTN):c.21382C>G (p.Arg7128Gly) rs727505031
NM_001267550.2(TTN):c.2143A>G (p.Arg715Gly) rs727505258
NM_001267550.2(TTN):c.21489C>G (p.Thr7163=) rs376882041
NM_001267550.2(TTN):c.2151C>T (p.Pro717=) rs374570732
NM_001267550.2(TTN):c.21544C>T (p.Arg7182Trp) rs727504736
NM_001267550.2(TTN):c.21545G>A (p.Arg7182Gln) rs200447686
NM_001267550.2(TTN):c.21548G>A (p.Cys7183Tyr) rs189951108
NM_001267550.2(TTN):c.21555C>A (p.Ile7185=) rs201155967
NM_001267550.2(TTN):c.21605C>G (p.Ser7202Cys) rs747376234
NM_001267550.2(TTN):c.21656C>T (p.Ser7219Phe) rs201029552
NM_001267550.2(TTN):c.21668G>A (p.Arg7223His) rs138853909
NM_001267550.2(TTN):c.21721G>A (p.Val7241Ile) rs367854582
NM_001267550.2(TTN):c.21755C>T (p.Thr7252Ile) rs375714080
NM_001267550.2(TTN):c.21777T>A (p.Ile7259=) rs727505220
NM_001267550.2(TTN):c.21779C>A (p.Ser7260Tyr) rs187925021
NM_001267550.2(TTN):c.21800G>A (p.Gly7267Asp) rs375627540
NM_001267550.2(TTN):c.21956C>T (p.Thr7319Ile) rs876658043
NM_001267550.2(TTN):c.21980C>T (p.Thr7327Met) rs727504975
NM_001267550.2(TTN):c.21993T>C (p.Pro7331=) rs373223049
NM_001267550.2(TTN):c.2206G>A (p.Gly736Arg) rs876658047
NM_001267550.2(TTN):c.22074A>G (p.Lys7358=) rs34562585
NM_001267550.2(TTN):c.22077A>T (p.Gly7359=) rs202102237
NM_001267550.2(TTN):c.22080T>C (p.Asp7360=) rs16866473
NM_001267550.2(TTN):c.22090C>T (p.Arg7364Trp) rs397517500
NM_001267550.2(TTN):c.22240+7A>C rs368101794
NM_001267550.2(TTN):c.22241-14A>G rs371352901
NM_001267550.2(TTN):c.22241-5T>C rs397517501
NM_001267550.2(TTN):c.2227G>A (p.Ala743Thr) rs370728359
NM_001267550.2(TTN):c.22361G>A (p.Arg7454Lys) rs727504464
NM_001267550.2(TTN):c.22384G>C (p.Asp7462His) rs12693166
NM_001267550.2(TTN):c.22386T>A (p.Asp7462Glu) rs183482849
NM_001267550.2(TTN):c.22386T>G (p.Asp7462Glu) rs183482849
NM_001267550.2(TTN):c.2244G>A (p.Glu748=) rs6715406
NM_001267550.2(TTN):c.22513A>G (p.Arg7505Gly) rs372826489
NM_001267550.2(TTN):c.22531C>T (p.Pro7511Ser) rs727505333
NM_001267550.2(TTN):c.22569T>C (p.Ser7523=) rs761651834
NM_001267550.2(TTN):c.22575T>A (p.Asp7525Glu) rs200061856
NM_001267550.2(TTN):c.22611T>C (p.His7537=) rs16866469
NM_001267550.2(TTN):c.22634G>A (p.Arg7545Gln) rs72648969
NM_001267550.2(TTN):c.2264C>T (p.Ser755Leu) rs533384820
NM_001267550.2(TTN):c.22653T>C (p.Asp7551=) rs371736246
NM_001267550.2(TTN):c.22692A>T (p.Thr7564=) rs187182557
NM_001267550.2(TTN):c.2270C>T (p.Pro757Leu) rs116307796
NM_001267550.2(TTN):c.22786G>C (p.Asp7596His) rs72648970
NM_001267550.2(TTN):c.22798G>T (p.Ala7600Ser) rs757523256
NM_001267550.2(TTN):c.2280C>T (p.Val760=) rs727505021
NM_001267550.2(TTN):c.22817-15T>G rs727504821
NM_001267550.2(TTN):c.2283_2288del (p.Lys762_Ala763del) rs727503701
NM_001267550.2(TTN):c.22842A>G (p.Leu7614=) rs727504963
NM_001267550.2(TTN):c.22942G>A (p.Glu7648Lys) rs397517502
NM_001267550.2(TTN):c.22968C>T (p.Asn7656=) rs201904848
NM_001267550.2(TTN):c.23001G>A (p.Thr7667=) rs16866467
NM_001267550.2(TTN):c.23023G>T (p.Asp7675Tyr) rs552951988
NM_001267550.2(TTN):c.23029G>A (p.Gly7677Arg) rs367826445
NM_001267550.2(TTN):c.23065G>A (p.Asp7689Asn) rs727505052
NM_001267550.2(TTN):c.23067C>T (p.Asp7689=) rs191854953
NM_001267550.2(TTN):c.23098+15G>T rs397517503
NM_001267550.2(TTN):c.23099-3T>C rs2562830
NM_001267550.2(TTN):c.230G>A (p.Arg77Gln) rs727503709
NM_001267550.2(TTN):c.23121G>A (p.Lys7707=) rs72648971
NM_001267550.2(TTN):c.23177C>T (p.Ser7726Leu) rs17452588
NM_001267550.2(TTN):c.23178G>A (p.Ser7726=) rs753546095
NM_001267550.2(TTN):c.23214T>C (p.Asp7738=) rs727503648
NM_001267550.2(TTN):c.23223G>A (p.Gln7741=) rs2562831
NM_001267550.2(TTN):c.23232C>G (p.Asn7744Lys) rs72648972
NM_001267550.2(TTN):c.23301C>T (p.Ser7767=) rs73038337
NM_001267550.2(TTN):c.23302G>A (p.Asp7768Asn) rs72648973
NM_001267550.2(TTN):c.23371T>C (p.Phe7791Leu) rs727505045
NM_001267550.2(TTN):c.23392G>A (p.Val7798Met) rs144032104
NM_001267550.2(TTN):c.23455G>C (p.Glu7819Gln) rs201420077
NM_001267550.2(TTN):c.23537T>A (p.Phe7846Tyr) rs397517504
NM_001267550.2(TTN):c.23538C>G (p.Phe7846Leu) rs149523263
NM_001267550.2(TTN):c.23538C>T (p.Phe7846=) rs149523263
NM_001267550.2(TTN):c.2359A>G (p.Ile787Val) rs397517522
NM_001267550.2(TTN):c.2376G>A (p.Lys792=) rs727504854
NM_001267550.2(TTN):c.23853C>A (p.Ala7951=) rs201766927
NM_001267550.2(TTN):c.23919T>C (p.Thr7973=) rs727504974
NM_001267550.2(TTN):c.23925C>T (p.Ser7975=) rs374879942
NM_001267550.2(TTN):c.23939-13C>A rs876658045
NM_001267550.2(TTN):c.23965C>T (p.Arg7989Cys) rs201653851
NM_001267550.2(TTN):c.2396C>T (p.Thr799Met) rs149061352
NM_001267550.2(TTN):c.2397G>A (p.Thr799=) rs369313128
NM_001267550.2(TTN):c.24075T>G (p.Ile8025Met) rs371496970
NM_001267550.2(TTN):c.24107C>T (p.Ser8036Leu) rs200598509
NM_001267550.2(TTN):c.24114C>T (p.Asn8038=) rs199576800
NM_001267550.2(TTN):c.24150C>T (p.Ser8050=) rs185062935
NM_001267550.2(TTN):c.24156A>G (p.Thr8052=) rs749823104
NM_001267550.2(TTN):c.24160A>T (p.Ile8054Leu) rs72648976
NM_001267550.2(TTN):c.24195C>T (p.Ser8065=) rs182425565
NM_001267550.2(TTN):c.24227-15C>T rs397517505
NM_001267550.2(TTN):c.2422C>T (p.Arg808Cys) rs149155733
NM_001267550.2(TTN):c.2432C>T (p.Thr811Ile) rs35813871
NM_001267550.2(TTN):c.24344G>A (p.Ser8115Asn) rs397517506
NM_001267550.2(TTN):c.24345C>T (p.Ser8115=) rs72648977
NM_001267550.2(TTN):c.24385G>T (p.Glu8129Ter) rs727504843
NM_001267550.2(TTN):c.24431A>C (p.Glu8144Ala) rs16866465
NM_001267550.2(TTN):c.24454G>A (p.Val8152Ile) rs397517507
NM_001267550.2(TTN):c.24471C>T (p.Gly8157=) rs113391261
NM_001267550.2(TTN):c.24505+13C>T rs534803807
NM_001267550.2(TTN):c.24516C>T (p.Thr8172=) rs72648978
NM_001267550.2(TTN):c.24520G>A (p.Val8174Met) rs727504961
NM_001267550.2(TTN):c.24546T>A (p.Val8182=) rs397517508
NM_001267550.2(TTN):c.24579A>G (p.Thr8193=) rs72648979
NM_001267550.2(TTN):c.24609C>T (p.Ser8203=) rs397517509
NM_001267550.2(TTN):c.24622G>A (p.Glu8208Lys) rs190192954
NM_001267550.2(TTN):c.24639A>C (p.Gln8213His) rs397517510
NM_001267550.2(TTN):c.24652A>G (p.Ser8218Gly) rs72648980
NM_001267550.2(TTN):c.24706G>A (p.Glu8236Lys) rs377762626
NM_001267550.2(TTN):c.24820G>A (p.Glu8274Lys) rs72648981
NM_001267550.2(TTN):c.24823G>A (p.Ala8275Thr) rs771947778
NM_001267550.2(TTN):c.24880A>G (p.Arg8294Gly) rs72648982
NM_001267550.2(TTN):c.24905C>A (p.Thr8302Lys) rs549604128
NM_001267550.2(TTN):c.24909G>A (p.Lys8303=) rs72648983
NM_001267550.2(TTN):c.24922C>T (p.Pro8308Ser) rs373770383
NM_001267550.2(TTN):c.24928T>A (p.Tyr8310Asn) rs397517511
NM_001267550.2(TTN):c.24952G>A (p.Val8318Ile) rs200103997
NM_001267550.2(TTN):c.24964G>T (p.Val8322Leu) rs201571580
NM_001267550.2(TTN):c.24973A>G (p.Lys8325Glu) rs72648984
NM_001267550.2(TTN):c.25002T>C (p.Tyr8334=) rs371334680
NM_001267550.2(TTN):c.25008C>T (p.Cys8336=) rs116378128
NM_001267550.2(TTN):c.25041T>C (p.Ser8347=) rs397517512
NM_001267550.2(TTN):c.25046C>G (p.Ala8349Gly) rs397517513
NM_001267550.2(TTN):c.25064C>A (p.Ala8355Glu) rs2627043
NM_001267550.2(TTN):c.25065G>A (p.Ala8355=) rs397517514
NM_001267550.2(TTN):c.25066C>T (p.Arg8356Cys) rs201810836
NM_001267550.2(TTN):c.25087G>T (p.Ala8363Ser) rs200972189
NM_001267550.2(TTN):c.25126C>T (p.Pro8376Ser) rs375209098
NM_001267550.2(TTN):c.25134A>G (p.Ala8378=) rs371819104
NM_001267550.2(TTN):c.25162C>T (p.Pro8388Ser) rs727503647
NM_001267550.2(TTN):c.25223C>T (p.Thr8408Ile) rs201432372
NM_001267550.2(TTN):c.25274G>A (p.Ser8425Asn) rs13390491
NM_001267550.2(TTN):c.25351+13C>G rs138362885
NM_001267550.2(TTN):c.25398T>A (p.Asp8466Glu) rs72648986
NM_001267550.2(TTN):c.25481G>A (p.Arg8494Gln) rs201418615
NM_001267550.2(TTN):c.25490G>A (p.Arg8497His) rs149855485
NM_001267550.2(TTN):c.25510A>C (p.Met8504Leu) rs761929830
NM_001267550.2(TTN):c.25545T>C (p.Val8515=) rs397517515
NM_001267550.2(TTN):c.25563C>T (p.Gly8521=) rs556205722
NM_001267550.2(TTN):c.25564G>A (p.Asp8522Asn) rs199619070
NM_001267550.2(TTN):c.25569C>T (p.Ala8523=) rs375022009
NM_001267550.2(TTN):c.25619C>T (p.Ser8540Phe) rs201523784
NM_001267550.2(TTN):c.25626G>T (p.Gln8542His) rs2562832
NM_001267550.2(TTN):c.25704G>A (p.Arg8568=) rs150544093
NM_001267550.2(TTN):c.25706A>G (p.Tyr8569Cys) rs397517516
NM_001267550.2(TTN):c.25707T>C (p.Tyr8569=) rs2742329
NM_001267550.2(TTN):c.25723G>A (p.Gly8575Arg) rs397517517
NM_001267550.2(TTN):c.25758C>T (p.Asp8586=) rs372802604
NM_001267550.2(TTN):c.25921+10C>T rs10183237
NM_001267550.2(TTN):c.25936C>T (p.Arg8646Cys) rs72648987
NM_001267550.2(TTN):c.25942A>G (p.Lys8648Glu) rs188234466
NM_001267550.2(TTN):c.25978G>A (p.Val8660Ile) rs141856116
NM_001267550.2(TTN):c.26020G>A (p.Val8674Ile) rs375710902
NM_001267550.2(TTN):c.26055C>T (p.Ser8685=) rs727505250
NM_001267550.2(TTN):c.2605A>T (p.Thr869Ser) rs370962244
NM_001267550.2(TTN):c.26067C>T (p.Tyr8689=) rs377125716
NM_001267550.2(TTN):c.2607T>C (p.Thr869=) rs143969192
NM_001267550.2(TTN):c.26091A>T (p.Leu8697=) rs2562836
NM_001267550.2(TTN):c.26144G>A (p.Cys8715Tyr) rs183499397
NM_001267550.2(TTN):c.26200G>A (p.Ala8734Thr) rs727503646
NM_001267550.2(TTN):c.26201-11dup rs727503644
NM_001267550.2(TTN):c.26201-13C>T rs727505138
NM_001267550.2(TTN):c.26245G>A (p.Val8749Ile) rs16866457
NM_001267550.2(TTN):c.26289A>G (p.Glu8763=) rs2562838
NM_001267550.2(TTN):c.26345A>G (p.Asn8782Ser) rs727504895
NM_001267550.2(TTN):c.26408A>G (p.Asn8803Ser) rs12693164
NM_001267550.2(TTN):c.26439C>T (p.Asn8813=) rs200088963
NM_001267550.2(TTN):c.26463C>T (p.Phe8821=) rs551600321
NM_001267550.2(TTN):c.26466C>G (p.Ala8822=) rs140003804
NM_001267550.2(TTN):c.26468C>T (p.Thr8823Met) rs368151971
NM_001267550.2(TTN):c.26494A>G (p.Ile8832Val) rs72648989
NM_001267550.2(TTN):c.2649C>T (p.Phe883=) rs775588479
NM_001267550.2(TTN):c.26528C>T (p.Thr8843Met) rs72648990
NM_001267550.2(TTN):c.26639T>G (p.Phe8880Cys) rs397517518
NM_001267550.2(TTN):c.26655C>T (p.Ser8885=) rs2562839
NM_001267550.2(TTN):c.26672A>G (p.Asn8891Ser) rs146057575
NM_001267550.2(TTN):c.26681C>T (p.Pro8894Leu) rs13398235
NM_001267550.2(TTN):c.26682G>A (p.Pro8894=) rs142812510
NM_001267550.2(TTN):c.26694G>T (p.Gly8898=) rs199525540
NM_001267550.2(TTN):c.26744C>G (p.Ala8915Gly) rs536974988
NM_001267550.2(TTN):c.26762-39TTTGT[10] rs71393436
NM_001267550.2(TTN):c.26762-39TTTGT[11] rs71393436
NM_001267550.2(TTN):c.26762-39TTTGT[5] rs71393436
NM_001267550.2(TTN):c.26762-39TTTGT[7] rs71393436
NM_001267550.2(TTN):c.26762-39TTTGT[8] rs71393436
NM_001267550.2(TTN):c.26762-9A>G rs200821070
NM_001267550.2(TTN):c.26765G>A (p.Arg8922Gln) rs397517520
NM_001267550.2(TTN):c.26818G>A (p.Gly8940Ser) rs201005813
NM_001267550.2(TTN):c.2682T>C (p.Ala894=) rs727505299
NM_001267550.2(TTN):c.26849A>G (p.Tyr8950Cys) rs199557654
NM_001267550.2(TTN):c.26863A>G (p.Ile8955Val) rs72648994
NM_001267550.2(TTN):c.2686G>A (p.Val896Ile) rs376768790
NM_001267550.2(TTN):c.26893G>A (p.Glu8965Lys) rs200325324
NM_001267550.2(TTN):c.26916C>T (p.Tyr8972=) rs762329439
NM_001267550.2(TTN):c.26928G>A (p.Leu8976=) rs370973715
NM_001267550.2(TTN):c.26935A>C (p.Asn8979His) rs376982715
NM_001267550.2(TTN):c.26991A>G (p.Thr8997=) rs61232800
NM_001267550.2(TTN):c.27015T>C (p.Gly9005=) rs727503643
NM_001267550.2(TTN):c.27217G>C (p.Val9073Leu) rs756400799
NM_001267550.2(TTN):c.2731G>A (p.Val911Ile) rs141961878
NM_001267550.2(TTN):c.27328+4T>G rs876658048
NM_001267550.2(TTN):c.27328+5G>A rs397517521
NM_001267550.2(TTN):c.27498G>A (p.Ser9166=) rs372528823
NM_001267550.2(TTN):c.27593A>G (p.Gln9198Arg) rs368297438
NM_001267550.2(TTN):c.27618T>C (p.Tyr9206=) rs1457644440
NM_001267550.2(TTN):c.2761G>A (p.Gly921Arg) rs774924294
NM_001267550.2(TTN):c.2764C>T (p.Arg922Cys) rs72647862
NM_001267550.2(TTN):c.2765G>A (p.Arg922His) rs56046320
NM_001267550.2(TTN):c.27676T>C (p.Cys9226Arg) rs372820178
NM_001267550.2(TTN):c.27702T>C (p.Ile9234=) rs143368674
NM_001267550.2(TTN):c.27711C>T (p.Ser9237=) rs727504749
NM_001267550.2(TTN):c.27743C>A (p.Thr9248Asn) rs397517523
NM_001267550.2(TTN):c.2776-14T>C rs201611946
NM_001267550.2(TTN):c.2776G>A (p.Val926Ile) rs876658052
NM_001267550.2(TTN):c.27793A>C (p.Asn9265His) rs397517524
NM_001267550.2(TTN):c.2781A>C (p.Thr927=) rs55892860
NM_001267550.2(TTN):c.27846C>T (p.Ser9282=) rs182355009
NM_001267550.2(TTN):c.27847G>A (p.Val9283Met) rs727504515
NM_001267550.2(TTN):c.27849G>A (p.Val9283=) rs397517525
NM_001267550.2(TTN):c.27886+10A>G rs397517526
NM_001267550.2(TTN):c.27886+5T>C rs876658050
NM_001267550.2(TTN):c.27914G>A (p.Arg9305Gln) rs397517527
NM_001267550.2(TTN):c.27915A>G (p.Arg9305=) rs367900368
NM_001267550.2(TTN):c.27941T>A (p.Val9314Asp) rs727505348
NM_001267550.2(TTN):c.28070C>T (p.Thr9357Ile) rs144930507
NM_001267550.2(TTN):c.2807T>C (p.Val936Ala) rs139567470
NM_001267550.2(TTN):c.28093C>T (p.Arg9365Trp) rs190600127
NM_001267550.2(TTN):c.28094G>A (p.Arg9365Gln) rs570608843
NM_001267550.2(TTN):c.28131C>T (p.Asn9377=) rs72648997
NM_001267550.2(TTN):c.28139G>T (p.Gly9380Val) rs397517528
NM_001267550.2(TTN):c.28187C>T (p.Pro9396Leu) rs373065549
NM_001267550.2(TTN):c.28313G>A (p.Arg9438Gln) rs72648998
NM_001267550.2(TTN):c.28321G>A (p.Gly9441Arg) rs397517529
NM_001267550.2(TTN):c.28425G>T (p.Val9475=) rs727503642
NM_001267550.2(TTN):c.28463-14G>A rs200917885
NM_001267550.2(TTN):c.28466G>A (p.Arg9489Gln) rs189431308
NM_001267550.2(TTN):c.28507G>A (p.Val9503Ile) rs202160275
NM_001267550.2(TTN):c.28509A>G (p.Val9503=) rs756229382
NM_001267550.2(TTN):c.28547G>A (p.Arg9516His) rs374156904
NM_001267550.2(TTN):c.28587A>C (p.Lys9529Asn) rs876658049
NM_001267550.2(TTN):c.28606C>A (p.Pro9536Thr) rs201121983
NM_001267550.2(TTN):c.28641C>T (p.Asn9547=) rs727505185
NM_001267550.2(TTN):c.28653G>C (p.Leu9551=) rs876657601
NM_001267550.2(TTN):c.28662G>A (p.Arg9554=) rs2742332
NM_001267550.2(TTN):c.28678G>A (p.Asp9560Asn) rs771843862
NM_001267550.2(TTN):c.28709A>G (p.Asn9570Ser) rs727503641
NM_001267550.2(TTN):c.28710T>C (p.Asn9570=) rs727504991
NM_001267550.2(TTN):c.28741A>G (p.Ile9581Val) rs371826762
NM_001267550.2(TTN):c.28754A>C (p.Glu9585Ala) rs200856239
NM_001267550.2(TTN):c.28818C>T (p.Tyr9606=) rs374117152
NM_001267550.2(TTN):c.2883C>T (p.Thr961=) rs397517541
NM_001267550.2(TTN):c.28849G>A (p.Glu9617Lys) rs144025230
NM_001267550.2(TTN):c.28877C>A (p.Ala9626Asp) rs397517530
NM_001267550.2(TTN):c.28903A>G (p.Arg9635Gly) rs397517531
NM_001267550.2(TTN):c.28970C>T (p.Ser9657Leu) rs200049911
NM_001267550.2(TTN):c.28971G>A (p.Ser9657=) rs370903846
NM_001267550.2(TTN):c.289G>A (p.Val97Met) rs185921345
NM_001267550.2(TTN):c.29079G>A (p.Ala9693=) rs372997298
NM_001267550.2(TTN):c.29128G>A (p.Val9710Ile) rs72649002
NM_001267550.2(TTN):c.29153T>C (p.Ile9718Thr) rs4893852
NM_001267550.2(TTN):c.29178C>A (p.Ile9726=) rs72650003
NM_001267550.2(TTN):c.29230C>T (p.Arg9744Cys) rs375266859
NM_001267550.2(TTN):c.29238C>T (p.Phe9746=) rs727503640
NM_001267550.2(TTN):c.2926T>C (p.Trp976Arg) rs267607155
NM_001267550.2(TTN):c.29278G>A (p.Asp9760Asn) rs372537023
NM_001267550.2(TTN):c.29448_29450AGA[2] (p.Glu9820del) rs377232641
NM_001267550.2(TTN):c.2949C>T (p.Ile983=) rs56310516
NM_001267550.2(TTN):c.29541C>T (p.Phe9847=) rs56812642
NM_001267550.2(TTN):c.296-14T>C rs199951296
NM_001267550.2(TTN):c.29604+7T>C rs727503639
NM_001267550.2(TTN):c.29605-12T>C rs143352892
NM_001267550.2(TTN):c.29763T>C (p.Ile9921=) rs2742343
NM_001267550.2(TTN):c.29799G>A (p.Ser9933=) rs2742344
NM_001267550.2(TTN):c.29812A>T (p.Thr9938Ser) rs72650006
NM_001267550.2(TTN):c.29815G>C (p.Glu9939Gln) rs727503638
NM_001267550.2(TTN):c.29938G>A (p.Ala9980Thr) rs189286381
NM_001267550.2(TTN):c.29963-13A>G rs72650008
NM_001267550.2(TTN):c.30022A>G (p.Met10008Val) rs1553877757
NM_001267550.2(TTN):c.3002T>G (p.Met1001Arg) rs148269839
NM_001267550.2(TTN):c.30055T>G (p.Ser10019Ala) rs754368714
NM_001267550.2(TTN):c.30088C>T (p.Pro10030Ser) rs368531555
NM_001267550.2(TTN):c.30129T>C (p.His10043=) rs764724866
NM_001267550.2(TTN):c.30181A>C (p.Lys10061Gln) rs184153985
NM_001267550.2(TTN):c.30231A>G (p.Pro10077=) rs74324101
NM_001267550.2(TTN):c.30274C>T (p.His10092Tyr) rs72650011
NM_001267550.2(TTN):c.30296G>A (p.Cys10099Tyr) rs1253569310
NM_001267550.2(TTN):c.3031G>A (p.Gly1011Arg) rs397517546
NM_001267550.2(TTN):c.3034C>T (p.Arg1012Ter) rs397517547
NM_001267550.2(TTN):c.30384T>C (p.Asp10128=) rs188584219
NM_001267550.2(TTN):c.30426C>T (p.Asp10142=) rs147524531
NM_001267550.2(TTN):c.30433+11T>G rs199848546
NM_001267550.2(TTN):c.30434-15G>A rs373562293
NM_001267550.2(TTN):c.30444G>A (p.Ser10148=) rs367901929
NM_001267550.2(TTN):c.30484_30493del (p.Thr10162fs) rs727504452
NM_001267550.2(TTN):c.30485C>T (p.Thr10162Met) rs200593368
NM_001267550.2(TTN):c.30512-19dup rs397517532
NM_001267550.2(TTN):c.30588G>A (p.Val10196=) rs727504524
NM_001267550.2(TTN):c.30598+15C>T rs79685525
NM_001267550.2(TTN):c.30598G>C (p.Glu10200Gln) rs779015756
NM_001267550.2(TTN):c.30642A>G (p.Pro10214=) rs397517533
NM_001267550.2(TTN):c.30682+10C>T rs727505022
NM_001267550.2(TTN):c.3069C>T (p.Thr1023=) rs371447978
NM_001267550.2(TTN):c.30707A>C (p.Asp10236Ala) rs539986891
NM_001267550.2(TTN):c.3070G>A (p.Val1024Ile) rs368770038
NM_001267550.2(TTN):c.30718G>T (p.Val10240Phe) rs111671438
NM_001267550.2(TTN):c.30725C>T (p.Ala10242Val) rs397517534
NM_001267550.2(TTN):c.30803-15C>T rs397517535
NM_001267550.2(TTN):c.30857T>C (p.Ile10286Thr) rs369094355
NM_001267550.2(TTN):c.3087T>C (p.Tyr1029=) rs55863869
NM_001267550.2(TTN):c.30893C>T (p.Ala10298Val) rs727504902
NM_001267550.2(TTN):c.3089T>C (p.Leu1030Pro) rs727504809
NM_001267550.2(TTN):c.30952G>A (p.Glu10318Lys) rs73038324
NM_001267550.2(TTN):c.3100G>A (p.Val1034Met) rs142951505
NM_001267550.2(TTN):c.31014T>G (p.Tyr10338Ter) rs397517536
NM_001267550.2(TTN):c.31071C>T (p.His10357=) rs368973334
NM_001267550.2(TTN):c.31149G>A (p.Glu10383=) rs727504724
NM_001267550.2(TTN):c.31207+5G>A rs876658051
NM_001267550.2(TTN):c.31255C>T (p.Pro10419Ser) rs397517537
NM_001267550.2(TTN):c.3133G>A (p.Val1045Met) rs72647868
NM_001267550.2(TTN):c.31391G>A (p.Arg10464Gln) rs727504757
NM_001267550.2(TTN):c.31399G>A (p.Val10467Ile) rs72650019
NM_001267550.2(TTN):c.31426+11T>C rs901251232
NM_001267550.2(TTN):c.31426+1G>C rs6749719
NM_001267550.2(TTN):c.31472T>C (p.Met10491Thr) rs769226745
NM_001267550.2(TTN):c.31533A>G (p.Glu10511=) rs757499228
NM_001267550.2(TTN):c.31542T>C (p.Thr10514=) rs876657602
NM_001267550.2(TTN):c.31564A>G (p.Ile10522Val) rs2042995
NM_001267550.2(TTN):c.31735A>C (p.Lys10579Gln) rs376287951
NM_001267550.2(TTN):c.31757C>A (p.Pro10586Gln) rs200459347
NM_001267550.2(TTN):c.31762+5_31762+7del rs397517538
NM_001267550.2(TTN):c.31763-1G>A rs202234172
NM_001267550.2(TTN):c.31791T>G (p.Pro10597=) rs397517539
NM_001267550.2(TTN):c.31806C>T (p.Pro10602=) rs370080995
NM_001267550.2(TTN):c.31807G>A (p.Val10603Ile) rs139790668
NM_001267550.2(TTN):c.31832C>G (p.Ala10611Gly) rs727503637
NM_001267550.2(TTN):c.31837C>G (p.Pro10613Ala) rs200213832
NM_001267550.2(TTN):c.31864G>A (p.Gly10622Arg) rs2244492
NM_001267550.2(TTN):c.3201T>C (p.Thr1067=) rs876657603
NM_001267550.2(TTN):c.32020C>G (p.Leu10674Val) rs766003250
NM_001267550.2(TTN):c.32026A>G (p.Lys10676Glu) rs200952728
NM_001267550.2(TTN):c.32035G>A (p.Val10679Ile) rs369932282
NM_001267550.2(TTN):c.32071G>A (p.Ala10691Thr) rs371452173
NM_001267550.2(TTN):c.32093G>A (p.Arg10698Gln) rs200161147
NM_001267550.2(TTN):c.32095+1G>A rs727503636
NM_001267550.2(TTN):c.32186C>T (p.Thr10729Met) rs115119858
NM_001267550.2(TTN):c.32197+11G>A rs369265969
NM_001267550.2(TTN):c.32198-10T>C rs371121439
NM_001267550.2(TTN):c.32254G>A (p.Val10752Ile) rs72650028
NM_001267550.2(TTN):c.3228T>C (p.Pro1076=) rs876657604
NM_001267550.2(TTN):c.32311G>A (p.Val10771Met) rs549877654
NM_001267550.2(TTN):c.32350C>G (p.Leu10784Val) rs72650029
NM_001267550.2(TTN):c.32367G>A (p.Lys10789=) rs79232842
NM_001267550.2(TTN):c.32393-12A>G rs16866434
NM_001267550.2(TTN):c.3241G>A (p.Ala1081Thr) rs55914517
NM_001267550.2(TTN):c.32449G>A (p.Glu10817Lys) rs876658053
NM_001267550.2(TTN):c.32462C>T (p.Pro10821Leu) rs146400809
NM_001267550.2(TTN):c.32480C>T (p.Ala10827Val) rs72650030
NM_001267550.2(TTN):c.32515G>T (p.Ala10839Ser) rs727503635
NM_001267550.2(TTN):c.32555-12G>T rs397517540
NM_001267550.2(TTN):c.32557C>T (p.Pro10853Ser) rs201738153
NM_001267550.2(TTN):c.32593G>C (p.Val10865Leu) rs150733188
NM_001267550.2(TTN):c.32624C>T (p.Pro10875Leu) rs72650031
NM_001267550.2(TTN):c.32648G>A (p.Arg10883Lys) rs116676813
NM_001267550.2(TTN):c.32703G>A (p.Glu10901=) rs397517542
NM_001267550.2(TTN):c.32706G>A (p.Ala10902=) rs372124201
NM_001267550.2(TTN):c.32722+8C>T rs765936606
NM_001267550.2(TTN):c.32743G>C (p.Ala10915Pro) rs72650032
NM_001267550.2(TTN):c.32750C>T (p.Pro10917Leu) rs73973137
NM_001267550.2(TTN):c.32767A>C (p.Lys10923Gln) rs367720439
NM_001267550.2(TTN):c.32803A>G (p.Lys10935Glu) rs397517543
NM_001267550.2(TTN):c.32807-10T>A rs138192315
NM_001267550.2(TTN):c.32866del (p.Arg10956fs) rs876658054
NM_001267550.2(TTN):c.32888-3C>A rs397517544
NM_001267550.2(TTN):c.32953C>T (p.Arg10985Trp) rs201991864
NM_001267550.2(TTN):c.32954G>A (p.Arg10985Gln) rs181395238
NM_001267550.2(TTN):c.3295G>A (p.Val1099Met) rs368282893
NM_001267550.2(TTN):c.32971G>A (p.Glu10991Lys) rs201081803
NM_001267550.2(TTN):c.33053G>A (p.Arg11018Gln) rs72650034
NM_001267550.2(TTN):c.33059A>G (p.Tyr11020Cys) rs72650035
NM_001267550.2(TTN):c.33063A>G (p.Glu11021=) rs115744476
NM_001267550.2(TTN):c.33172+15del rs559323758
NM_001267550.2(TTN):c.33172+4G>A rs756475184
NM_001267550.2(TTN):c.3318C>T (p.Gly1106=) rs141768043
NM_001267550.2(TTN):c.33248-8C>G rs766957102
NM_001267550.2(TTN):c.33287G>A (p.Arg11096His) rs36051007
NM_001267550.2(TTN):c.33305G>A (p.Arg11102His) rs368777046
NM_001267550.2(TTN):c.33404C>A (p.Ala11135Glu) rs577901623
NM_001267550.2(TTN):c.33416G>C (p.Arg11139Thr) rs72650040
NM_001267550.2(TTN):c.33418+12C>A rs199772748
NM_001267550.2(TTN):c.33445C>T (p.Pro11149Ser) rs377760800
NM_001267550.2(TTN):c.33479C>T (p.Thr11160Ile) rs876658055
NM_001267550.2(TTN):c.33501_33503AGA[6] (p.Glu11172dup) rs368327166
NM_001267550.2(TTN):c.33580+6T>C rs368442571
NM_001267550.2(TTN):c.33732G>A (p.Pro11244=) rs190604150
NM_001267550.2(TTN):c.33742+11A>G rs72650042
NM_001267550.2(TTN):c.33762A>G (p.Lys11254=) rs749466171
NM_001267550.2(TTN):c.33796C>T (p.Pro11266Ser) rs201120871
NM_001267550.2(TTN):c.33834G>A (p.Glu11278=) rs35112591
NM_001267550.2(TTN):c.33838C>T (p.Pro11280Ser) rs374449452
NM_001267550.2(TTN):c.33856G>A (p.Glu11286Lys) rs376874956
NM_001267550.2(TTN):c.33911-6_33911-5insG rs765503214
NM_001267550.2(TTN):c.33911-7T>C rs397517545
NM_001267550.2(TTN):c.33971A>G (p.Lys11324Arg) rs727504880
NM_001267550.2(TTN):c.33G>A (p.Pro11=) rs138331646
NM_001267550.2(TTN):c.34038T>G (p.Pro11346=) rs375714279
NM_001267550.2(TTN):c.34058T>C (p.Phe11353Ser) rs752527275
NM_001267550.2(TTN):c.34098_34118GGAAGAGGAAGTTCTACCTGA[3] (p.11363_11369VLPEEEE[5]) rs397517548
NM_001267550.2(TTN):c.3409G>C (p.Gly1137Arg) rs72647870
NM_001267550.2(TTN):c.34192G>T (p.Val11398Phe) rs551911856
NM_001267550.2(TTN):c.34241_34243AAG[2] (p.Glu11416del) rs397517549
NM_001267550.2(TTN):c.34379-14T>C rs727505341
NM_001267550.2(TTN):c.34453+12C>A rs74930148
NM_001267550.2(TTN):c.34453+14G>A rs397517550
NM_001267550.2(TTN):c.3445G>A (p.Asp1149Asn) rs368967197
NM_001267550.2(TTN):c.34566A>C (p.Glu11522Asp) rs140640738
NM_001267550.2(TTN):c.34571G>A (p.Arg11524Gln) rs201622536
NM_001267550.2(TTN):c.3469G>A (p.Val1157Ile) rs397517566
NM_001267550.2(TTN):c.34708+9G>T rs397517551
NM_001267550.2(TTN):c.34709-1G>A rs727503634
NM_001267550.2(TTN):c.34734A>G (p.Val11578=) rs866407525
NM_001267550.2(TTN):c.34769A>G (p.Glu11590Gly) rs201167067
NM_001267550.2(TTN):c.3476G>A (p.Arg1159His) rs149883066
NM_001267550.2(TTN):c.34843C>T (p.Pro11615Ser) rs727504775
NM_001267550.2(TTN):c.34845C>T (p.Pro11615=) rs368781863
NM_001267550.2(TTN):c.34855+7C>T rs397517552
NM_001267550.2(TTN):c.34864G>A (p.Val11622Ile) rs202014478
NM_001267550.2(TTN):c.34894C>A (p.Leu11632Ile) rs727503633
NM_001267550.2(TTN):c.34947A>G (p.Glu11649=) rs727504514
NM_001267550.2(TTN):c.34970G>A (p.Arg11657His) rs59887778
NM_001267550.2(TTN):c.35037G>A (p.Pro11679=) rs369095270
NM_001267550.2(TTN):c.3514C>A (p.Leu1172Ile) rs375735354
NM_001267550.2(TTN):c.3523+11C>G rs397517569
NM_001267550.2(TTN):c.3523+9A>C rs727503700
NM_001267550.2(TTN):c.3523G>A (p.Ala1175Thr) rs397517570
NM_001267550.2(TTN):c.35264A>C (p.Lys11755Thr) rs189966800
NM_001267550.2(TTN):c.35314G>A (p.Glu11772Lys) rs727505263
NM_001267550.2(TTN):c.35374C>T (p.Pro11792Ser) rs727505111
NM_001267550.2(TTN):c.3577G>A (p.Val1193Met) rs727503699
NM_001267550.2(TTN):c.3601A>G (p.Lys1201Glu) rs10497520
NM_001267550.2(TTN):c.3605T>C (p.Val1202Ala) rs150667217
NM_001267550.2(TTN):c.3625T>C (p.Phe1209Leu) rs727503698
NM_001267550.2(TTN):c.36655T>G (p.Leu12219Val) rs12994774
NM_001267550.2(TTN):c.3668C>T (p.Ala1223Val) rs78269740
NM_001267550.2(TTN):c.3680A>G (p.Lys1227Arg) rs541811273
NM_001267550.2(TTN):c.37397C>T (p.Pro12466Leu) rs727503632
NM_001267550.2(TTN):c.37421T>C (p.Ile12474Thr) rs72650057
NM_001267550.2(TTN):c.37432C>T (p.Pro12478Ser) rs200992277
NM_001267550.2(TTN):c.385G>A (p.Gly129Arg) rs727503708
NM_001267550.2(TTN):c.39044-9T>A rs184888200
NM_001267550.2(TTN):c.39045G>C (p.Val13015=) rs192464868
NM_001267550.2(TTN):c.39057G>A (p.Pro13019=) rs371945519
NM_001267550.2(TTN):c.39082G>A (p.Val13028Met) rs73038314
NM_001267550.2(TTN):c.39085C>A (p.Pro13029Thr) rs397517553
NM_001267550.2(TTN):c.39128-14T>C rs200916144
NM_001267550.2(TTN):c.39163A>G (p.Lys13055Glu) rs397517555
NM_001267550.2(TTN):c.39183T>A (p.Pro13061=) rs12474306
NM_001267550.2(TTN):c.39212-9C>A rs373056460
NM_001267550.2(TTN):c.39276G>A (p.Pro13092=) rs369002632
NM_001267550.2(TTN):c.39282_39284TCC[1] (p.Pro13097del) rs727503631
NM_001267550.2(TTN):c.39296-13C>T rs372380420
NM_001267550.2(TTN):c.39296-4A>G rs368641171
NM_001267550.2(TTN):c.39300C>T (p.Phe13100=) rs569579388
NM_001267550.2(TTN):c.39301G>A (p.Glu13101Lys) rs201035457
NM_001267550.2(TTN):c.39325G>C (p.Glu13109Gln) rs727504920
NM_001267550.2(TTN):c.39366G>A (p.Ala13122=) rs769494020
NM_001267550.2(TTN):c.39385G>A (p.Val13129Ile) rs774557269
NM_001267550.2(TTN):c.39419C>T (p.Ala13140Val) rs397517556
NM_001267550.2(TTN):c.39430G>A (p.Val13144Ile) rs374394719
NM_001267550.2(TTN):c.39457G>A (p.Val13153Met) rs377259883
NM_001267550.2(TTN):c.39466C>A (p.Pro13156Thr) rs72650064
NM_001267550.2(TTN):c.39472G>A (p.Val13158Met) rs876658056
NM_001267550.2(TTN):c.39477C>T (p.Pro13159=) rs397517557
NM_001267550.2(TTN):c.39504G>T (p.Val13168=) rs397517558
NM_001267550.2(TTN):c.39548-8A>G rs369594816
NM_001267550.2(TTN):c.39578A>G (p.Glu13193Gly) rs190461403
NM_001267550.2(TTN):c.39616C>T (p.Pro13206Ser) rs186404793
NM_001267550.2(TTN):c.39652T>C (p.Leu13218=) rs727505145
NM_001267550.2(TTN):c.39689C>T (p.Ala13230Val) rs148140756
NM_001267550.2(TTN):c.39690G>A (p.Ala13230=) rs528832388
NM_001267550.2(TTN):c.39704C>G (p.Pro13235Arg) rs72650066
NM_001267550.2(TTN):c.39731_39748TTGCTCCTGAAGAGGAAA[1] (p.13244_13249IAPEEE[1]) rs139512154
NM_001267550.2(TTN):c.39786A>G (p.Glu13262=) rs398124450
NM_001267550.2(TTN):c.39819_39820delinsTT (p.Pro13274Ser) rs727503630
NM_001267550.2(TTN):c.39895G>A (p.Glu13299Lys) rs758166967
NM_001267550.2(TTN):c.40315G>T (p.Val13439Phe) rs397517559
NM_001267550.2(TTN):c.40335C>T (p.Leu13445=) rs727504696
NM_001267550.2(TTN):c.40408+7_40408+10dup rs397517560
NM_001267550.2(TTN):c.40408+8del rs727504922
NM_001267550.2(TTN):c.40498G>T (p.Val13500Phe) rs201944202
NM_001267550.2(TTN):c.40502G>A (p.Arg13501His) rs571348685
NM_001267550.2(TTN):c.40515G>A (p.Pro13505=) rs367958537
NM_001267550.2(TTN):c.40543G>A (p.Val13515Ile) rs727504200
NM_001267550.2(TTN):c.40587A>G (p.Glu13529=) rs370597107
NM_001267550.2(TTN):c.40634-15_40634-11del rs375561641
NM_001267550.2(TTN):c.40723+1del rs876658058
NM_001267550.2(TTN):c.40877-14T>C rs397517561
NM_001267550.2(TTN):c.40877-7A>G rs727505201
NM_001267550.2(TTN):c.40903G>A (p.Ala13635Thr) rs191699632
NM_001267550.2(TTN):c.40956A>G (p.Ile13652Met) rs397517562
NM_001267550.2(TTN):c.40973A>G (p.Lys13658Arg) rs184713215
NM_001267550.2(TTN):c.41010T>C (p.Asp13670=) rs193191368
NM_001267550.2(TTN):c.41103C>T (p.Gly13701=) rs72650077
NM_001267550.2(TTN):c.41140A>G (p.Thr13714Ala) rs876658057
NM_001267550.2(TTN):c.41166C>T (p.Asp13722=) rs143049740
NM_001267550.2(TTN):c.41179C>G (p.Arg13727Gly) rs397517563
NM_001267550.2(TTN):c.41253C>T (p.Ser13751=) rs772643931
NM_001267550.2(TTN):c.41329+9T>C rs779075177
NM_001267550.2(TTN):c.41342G>A (p.Arg13781His) rs370878642
NM_001267550.2(TTN):c.41407G>A (p.Glu13803Lys) rs727504780
NM_001267550.2(TTN):c.41474G>A (p.Arg13825Gln) rs727504774
NM_001267550.2(TTN):c.41483del (p.Pro13828fs) rs876657664
NM_001267550.2(TTN):c.41490C>T (p.Val13830=) rs397517564
NM_001267550.2(TTN):c.41504G>A (p.Arg13835Gln) rs727504539
NM_001267550.2(TTN):c.41508T>C (p.Ala13836=) rs55847232
NM_001267550.2(TTN):c.41521G>A (p.Asp13841Asn) rs201257644
NM_001267550.2(TTN):c.41610del (p.Val13871fs) rs397517565
NM_001267550.2(TTN):c.41810C>T (p.Ala13937Val) rs545806408
NM_001267550.2(TTN):c.41931T>C (p.Tyr13977=) rs369128249
NM_001267550.2(TTN):c.41958A>G (p.Ala13986=) rs186699871
NM_001267550.2(TTN):c.41982T>C (p.Pro13994=) rs777609108
NM_001267550.2(TTN):c.41G>T (p.Ser14Ile) rs771027745
NM_001267550.2(TTN):c.42024+6T>C rs140002940
NM_001267550.2(TTN):c.42046G>A (p.Gly14016Ser) rs367751077
NM_001267550.2(TTN):c.42056G>A (p.Arg14019His) rs374683153
NM_001267550.2(TTN):c.42071A>G (p.His14024Arg) rs2288563
NM_001267550.2(TTN):c.42156C>T (p.Ile14052=) rs76815324
NM_001267550.2(TTN):c.42219C>T (p.Phe14073=) rs150612172
NM_001267550.2(TTN):c.42278A>G (p.Lys14093Arg) rs1553743733
NM_001267550.2(TTN):c.42304G>A (p.Ala14102Thr) rs72650080
NM_001267550.2(TTN):c.42329T>C (p.Val14110Ala) rs34706299
NM_001267550.2(TTN):c.42421A>G (p.Arg14141Gly) rs397517567
NM_001267550.2(TTN):c.42509T>C (p.Met14170Thr) rs369623392
NM_001267550.2(TTN):c.42598_42599insG (p.Met14200fs) rs1553742630
NM_001267550.2(TTN):c.42649G>A (p.Glu14217Lys) rs727503629
NM_001267550.2(TTN):c.426C>T (p.Ala142=) rs56137037
NM_001267550.2(TTN):c.42783A>G (p.Lys14261=) rs16866425
NM_001267550.2(TTN):c.42829A>T (p.Ile14277Phe) rs397517568
NM_001267550.2(TTN):c.42891C>T (p.Gly14297=) rs550471556
NM_001267550.2(TTN):c.42947-2A>G rs1553741357
NM_001267550.2(TTN):c.42950G>A (p.Arg14317Gln) rs727505144
NM_001267550.2(TTN):c.42958A>G (p.Lys14320Glu) rs6723526
NM_001267550.2(TTN):c.42968dup (p.Pro14324fs) rs1553741321
NM_001267550.2(TTN):c.42978C>T (p.Tyr14326=) rs369959066
NM_001267550.2(TTN):c.429A>G (p.Glu143=) rs878966869
NM_001267550.2(TTN):c.43019T>C (p.Ile14340Thr) rs397517571
NM_001267550.2(TTN):c.43100T>C (p.Ile14367Thr) rs397517572
NM_001267550.2(TTN):c.43138T>C (p.Cys14380Arg) rs557125278
NM_001267550.2(TTN):c.43167C>T (p.Ser14389=) rs375780439
NM_001267550.2(TTN):c.43244G>A (p.Ser14415Asn) rs370342831
NM_001267550.2(TTN):c.43417G>C (p.Asp14473His) rs397517573
NM_001267550.2(TTN):c.43481-16dup rs730880350
NM_001267550.2(TTN):c.43488G>A (p.Arg14496=) rs56034831
NM_001267550.2(TTN):c.43544dup (p.Phe14516fs) rs752856716
NM_001267550.2(TTN):c.43577G>A (p.Arg14526Gln) rs373491468
NM_001267550.2(TTN):c.43596T>C (p.Asn14532=) rs16866423
NM_001267550.2(TTN):c.43600C>T (p.Gln14534Ter) rs727504499
NM_001267550.2(TTN):c.43603C>T (p.Arg14535Cys) rs12471771
NM_001267550.2(TTN):c.43690T>A (p.Ser14564Thr) rs181189778
NM_001267550.2(TTN):c.43702G>A (p.Val14568Ile) rs372384272
NM_001267550.2(TTN):c.43761T>C (p.Tyr14587=) rs397517574
NM_001267550.2(TTN):c.43984G>C (p.Asp14662His) rs876658059
NM_001267550.2(TTN):c.43G>A (p.Val15Ile) rs201857541
NM_001267550.2(TTN):c.44014+15A>C rs876657605
NM_001267550.2(TTN):c.44040C>A (p.Pro14680=) rs397517575
NM_001267550.2(TTN):c.44077C>T (p.Arg14693Cys) rs200445568
NM_001267550.2(TTN):c.44104G>C (p.Asp14702His) rs727503627
NM_001267550.2(TTN):c.44272C>T (p.Arg14758Ter) rs140743001
NM_001267550.2(TTN):c.44281+8T>C rs369121980
NM_001267550.2(TTN):c.44281C>T (p.Pro14761Ser) rs192766485
NM_001267550.2(TTN):c.44285G>A (p.Arg14762Gln) rs727505019
NM_001267550.2(TTN):c.44350G>A (p.Asp14784Asn) rs72677216
NM_001267550.2(TTN):c.44364del (p.Tyr14789fs) rs397517576
NM_001267550.2(TTN):c.44366A>G (p.Tyr14789Cys) rs397517577
NM_001267550.2(TTN):c.44390A>G (p.Tyr14797Cys) rs876658060
NM_001267550.2(TTN):c.44400del (p.Lys14801fs) rs727503628
NM_001267550.2(TTN):c.44423A>C (p.Lys14808Thr) rs374419129
NM_001267550.2(TTN):c.44481_44483AGA[1] (p.Glu14828del) rs727505315
NM_001267550.2(TTN):c.44529C>T (p.His14843=) rs55973744
NM_001267550.2(TTN):c.44531C>G (p.Ala14844Gly) rs1053826157
NM_001267550.2(TTN):c.44589G>A (p.Thr14863=) rs369800903
NM_001267550.2(TTN):c.44592C>T (p.Val14864=) rs397517578
NM_001267550.2(TTN):c.44593G>A (p.Glu14865Lys) rs543102139
NM_001267550.2(TTN):c.44734C>T (p.His14912Tyr) rs766391823
NM_001267550.2(TTN):c.44784T>C (p.Asp14928=) rs186105748
NM_001267550.2(TTN):c.44899C>T (p.Arg14967Ter) rs727505350
NM_001267550.2(TTN):c.44937T>C (p.Ala14979=) rs370413913
NM_001267550.2(TTN):c.44987G>A (p.Arg14996His) rs762128685
NM_001267550.2(TTN):c.45001A>C (p.Asn15001His) rs373109469
NM_001267550.2(TTN):c.45003C>T (p.Asn15001=) rs727505079
NM_001267550.2(TTN):c.45053C>T (p.Ala15018Val) rs72677221
NM_001267550.2(TTN):c.45082+6A>G rs876658061
NM_001267550.2(TTN):c.45083-12C>T rs377143579
NM_001267550.2(TTN):c.45120T>C (p.Ile15040=) rs74580375
NM_001267550.2(TTN):c.45120T>G (p.Ile15040Met) rs74580375
NM_001267550.2(TTN):c.45143T>C (p.Ile15048Thr) rs727505261
NM_001267550.2(TTN):c.45174C>T (p.Gly15058=) rs372609980
NM_001267550.2(TTN):c.45175G>A (p.Ala15059Thr) rs144668626
NM_001267550.2(TTN):c.45206A>T (p.Glu15069Val) rs114331773
NM_001267550.2(TTN):c.45247C>T (p.Arg15083Trp) rs199834143
NM_001267550.2(TTN):c.45268C>A (p.Gln15090Lys) rs397517579
NM_001267550.2(TTN):c.45273C>T (p.Asn15091=) rs72677223
NM_001267550.2(TTN):c.45307C>T (p.Arg15103Ter) rs397517580
NM_001267550.2(TTN):c.45328G>A (p.Asp15110Asn) rs17354992
NM_001267550.2(TTN):c.45350-13T>C rs113084617
NM_001267550.2(TTN):c.45408G>T (p.Lys15136Asn) rs72677225
NM_001267550.2(TTN):c.45499G>A (p.Val15167Ile) rs183245562
NM_001267550.2(TTN):c.45526C>T (p.Leu15176=) rs61004744
NM_001267550.2(TTN):c.45606G>A (p.Leu15202=) rs397517581
NM_001267550.2(TTN):c.45738T>C (p.Ala15246=) rs2303829
NM_001267550.2(TTN):c.45895+10T>A rs373140286
NM_001267550.2(TTN):c.45895+1G>A rs727504589
NM_001267550.2(TTN):c.45895G>A (p.Glu15299Lys) rs397517582
NM_001267550.2(TTN):c.46065G>C (p.Lys15355Asn) rs397517583
NM_001267550.2(TTN):c.46069_46070del (p.Met15357fs) rs397517584
NM_001267550.2(TTN):c.46078_46092del (p.Ile15360_Gly15364del) rs727505075
NM_001267550.2(TTN):c.46150C>G (p.Leu15384Val) rs727505078
NM_001267550.2(TTN):c.46160T>C (p.Ile15387Thr) rs397517585
NM_001267550.2(TTN):c.46369G>A (p.Glu15457Lys) rs753664074
NM_001267550.2(TTN):c.46386C>T (p.Cys15462=) rs147703145
NM_001267550.2(TTN):c.46451G>A (p.Arg15484Lys) rs72677229
NM_001267550.2(TTN):c.46489G>T (p.Val15497Phe) rs371299188
NM_001267550.2(TTN):c.46521_46601del (p.Lys15507_His15534delinsAsn) rs1553713878
NM_001267550.2(TTN):c.46557T>G (p.Val15519=) rs727503626
NM_001267550.2(TTN):c.46580T>A (p.Met15527Lys) rs77496539
NM_001267550.2(TTN):c.46611G>T (p.Gln15537His) rs727503625
NM_001267550.2(TTN):c.46659C>G (p.Ala15553=) rs876657606
NM_001267550.2(TTN):c.46667_46669AAG[1] (p.Glu15557del) rs876658062
NM_001267550.2(TTN):c.46693G>T (p.Ala15565Ser) rs145520397
NM_001267550.2(TTN):c.46697-12C>T rs727504699
NM_001267550.2(TTN):c.46773T>A (p.Tyr15591Ter) rs397517586
NM_001267550.2(TTN):c.46782C>A (p.Tyr15594Ter) rs397517587
NM_001267550.2(TTN):c.46823T>C (p.Leu15608Ser) rs397517588
NM_001267550.2(TTN):c.46847C>T (p.Thr15616Met) rs368057764
NM_001267550.2(TTN):c.46880C>T (p.Ala15627Val) rs115813214
NM_001267550.2(TTN):c.46928A>G (p.His15643Arg) rs368502650
NM_001267550.2(TTN):c.46951A>G (p.Asn15651Asp) rs727505035
NM_001267550.2(TTN):c.46966G>A (p.Asp15656Asn) rs727504572
NM_001267550.2(TTN):c.47077G>A (p.Val15693Ile) rs201717871
NM_001267550.2(TTN):c.47191C>T (p.Arg15731Cys) rs72677231
NM_001267550.2(TTN):c.47196G>C (p.Val15732=) rs369979598
NM_001267550.2(TTN):c.47211A>C (p.Arg15737Ser) rs727503624
NM_001267550.2(TTN):c.47242A>C (p.Asn15748His) rs368988689
NM_001267550.2(TTN):c.47248G>A (p.Val15750Ile) rs72677232
NM_001267550.2(TTN):c.47271T>C (p.Asp15757=) rs76081119
NM_001267550.2(TTN):c.47315G>A (p.Arg15772Gln) rs72677233
NM_001267550.2(TTN):c.47379C>T (p.Tyr15793=) rs374281025
NM_001267550.2(TTN):c.47380G>A (p.Val15794Ile) rs727504878
NM_001267550.2(TTN):c.47400G>A (p.Lys15800=) rs114145817
NM_001267550.2(TTN):c.47506C>T (p.Gln15836Ter) rs397517589
NM_001267550.2(TTN):c.47513G>A (p.Arg15838Gln) rs199640194
NM_001267550.2(TTN):c.47545C>A (p.Pro15849Thr) rs146181477
NM_001267550.2(TTN):c.47723G>A (p.Arg15908His) rs72677237
NM_001267550.2(TTN):c.47737C>T (p.Leu15913Phe) rs138576504
NM_001267550.2(TTN):c.47767G>A (p.Gly15923Arg) rs371943746
NM_001267550.2(TTN):c.47860G>A (p.Ala15954Thr) rs377037421
NM_001267550.2(TTN):c.47887A>G (p.Met15963Val) rs397517590
NM_001267550.2(TTN):c.47892T>G (p.Asp15964Glu) rs727503623
NM_001267550.2(TTN):c.47978C>A (p.Thr15993Asn) rs727503622
NM_001267550.2(TTN):c.47998G>C (p.Asp16000His) rs201388509
NM_001267550.2(TTN):c.48021C>T (p.Asp16007=) rs368404578
NM_001267550.2(TTN):c.48074G>A (p.Ser16025Asn) rs727504720
NM_001267550.2(TTN):c.48161-11dup rs730880371
NM_001267550.2(TTN):c.48270C>T (p.Tyr16090=) rs397517592
NM_001267550.2(TTN):c.48353A>G (p.Asp16118Gly) rs376273101
NM_001267550.2(TTN):c.48359T>C (p.Val16120Ala) rs745999025
NM_001267550.2(TTN):c.48395G>A (p.Arg16132His) rs397517593
NM_001267550.2(TTN):c.48432T>C (p.Asp16144=) rs776643336
NM_001267550.2(TTN):c.48457G>T (p.Ala16153Ser) rs876658063
NM_001267550.2(TTN):c.48557G>T (p.Arg16186Leu) rs769784536
NM_001267550.2(TTN):c.48638+5G>T rs397517594
NM_001267550.2(TTN):c.48727C>T (p.Pro16243Ser) rs72677242
NM_001267550.2(TTN):c.48761-1G>C rs876657665
NM_001267550.2(TTN):c.48843C>T (p.Thr16281=) rs547682223
NM_001267550.2(TTN):c.48953T>C (p.Ile16318Thr) rs72677243
NM_001267550.2(TTN):c.48996G>A (p.Glu16332=) rs72677244
NM_001267550.2(TTN):c.49008G>A (p.Val16336=) rs781078888
NM_001267550.2(TTN):c.49126C>T (p.Arg16376Cys) rs772152172
NM_001267550.2(TTN):c.49172G>A (p.Arg16391Gln) rs200944827
NM_001267550.2(TTN):c.49189G>A (p.Val16397Met) rs397517595
NM_001267550.2(TTN):c.49258G>A (p.Glu16420Lys) rs764682084
NM_001267550.2(TTN):c.49296_49315del (p.Val16433fs) rs727504825
NM_001267550.2(TTN):c.49366C>T (p.Arg16456Cys) rs727504986
NM_001267550.2(TTN):c.49371A>T (p.Leu16457=) rs146163169
NM_001267550.2(TTN):c.49379C>G (p.Ser16460Cys) rs397517596
NM_001267550.2(TTN):c.49413G>T (p.Trp16471Cys) rs202094100
NM_001267550.2(TTN):c.49443A>C (p.Pro16481=) rs74321406
NM_001267550.2(TTN):c.49527A>G (p.Thr16509=) rs727505248
NM_001267550.2(TTN):c.49532+8C>T rs397517597
NM_001267550.2(TTN):c.4960C>G (p.Pro1654Ala) rs876658070
NM_001267550.2(TTN):c.49648+13T>A rs368996176
NM_001267550.2(TTN):c.49649-11T>C rs727504474
NM_001267550.2(TTN):c.49701A>G (p.Ser16567=) rs369646977
NM_001267550.2(TTN):c.49731T>C (p.His16577=) rs2115558
NM_001267550.2(TTN):c.49732G>T (p.Asp16578Tyr) rs727505143
NM_001267550.2(TTN):c.49758T>C (p.Tyr16586=) rs72677247
NM_001267550.2(TTN):c.49919G>C (p.Ser16640Thr) rs55663050
NM_001267550.2(TTN):c.49942A>G (p.Lys16648Glu) rs727505156
NM_001267550.2(TTN):c.49955C>T (p.Pro16652Leu) rs727504966
NM_001267550.2(TTN):c.49985A>C (p.Asn16662Thr) rs36043230
NM_001267550.2(TTN):c.49998T>C (p.Asn16666=) rs376917681
NM_001267550.2(TTN):c.50028G>A (p.Glu16676=) rs727503621
NM_001267550.2(TTN):c.50076C>T (p.Asp16692=) rs397517598
NM_001267550.2(TTN):c.50083C>A (p.Arg16695=) rs751502842
NM_001267550.2(TTN):c.50244C>T (p.Thr16748=) rs778337707
NM_001267550.2(TTN):c.50249-15T>G rs727504732
NM_001267550.2(TTN):c.50355A>G (p.Arg16785=) rs192143556
NM_001267550.2(TTN):c.50363T>C (p.Ile16788Thr) rs397517599
NM_001267550.2(TTN):c.50385T>C (p.Gly16795=) rs374672630
NM_001267550.2(TTN):c.50452G>A (p.Glu16818Lys) rs397517600
NM_001267550.2(TTN):c.50479C>T (p.Arg16827Trp) rs727503620
NM_001267550.2(TTN):c.50480G>A (p.Arg16827Gln) rs138896856
NM_001267550.2(TTN):c.50494G>A (p.Ala16832Thr) rs1465354124
NM_001267550.2(TTN):c.5052T>C (p.Tyr1684=) rs727503694
NM_001267550.2(TTN):c.50614G>C (p.Ala16872Pro) rs727503619
NM_001267550.2(TTN):c.50618G>A (p.Trp16873Ter) rs397517601
NM_001267550.2(TTN):c.50642G>C (p.Gly16881Ala) rs201302681
NM_001267550.2(TTN):c.50647C>T (p.Pro16883Ser) rs397517602
NM_001267550.2(TTN):c.50714G>A (p.Arg16905His) rs191539637
NM_001267550.2(TTN):c.50719A>G (p.Ile16907Val) rs750610895
NM_001267550.2(TTN):c.50758C>G (p.Pro16920Ala) rs377289817
NM_001267550.2(TTN):c.50774T>C (p.Val16925Ala) rs370067597
NM_001267550.2(TTN):c.50812G>C (p.Glu16938Gln) rs72677250
NM_001267550.2(TTN):c.50869A>G (p.Ile16957Val) rs372013419
NM_001267550.2(TTN):c.51118A>G (p.Ile17040Val) rs727505039
NM_001267550.2(TTN):c.51185G>A (p.Ser17062Asn) rs876658064
NM_001267550.2(TTN):c.51221A>G (p.Asp17074Gly) rs1553693510
NM_001267550.2(TTN):c.5132C>T (p.Ser1711Phe) rs397517641
NM_001267550.2(TTN):c.51338C>T (p.Pro17113Leu) rs763635220
NM_001267550.2(TTN):c.51379G>T (p.Val17127Phe) rs397517603
NM_001267550.2(TTN):c.51437-9G>A rs183060991
NM_001267550.2(TTN):c.51439C>A (p.Pro17147Thr) rs876658065
NM_001267550.2(TTN):c.51482C>T (p.Ala17161Val) rs16866412
NM_001267550.2(TTN):c.51483G>A (p.Ala17161=) rs397517604
NM_001267550.2(TTN):c.51547A>T (p.Ile17183Phe) rs397517605
NM_001267550.2(TTN):c.51565A>G (p.Lys17189Glu) rs727503618
NM_001267550.2(TTN):c.51570T>G (p.Gly17190=) rs876657607
NM_001267550.2(TTN):c.51668G>A (p.Arg17223Gln) rs142395261
NM_001267550.2(TTN):c.51678C>T (p.Asn17226=) rs372635204
NM_001267550.2(TTN):c.51684G>A (p.Ala17228=) rs2288566
NM_001267550.2(TTN):c.51739+14C>A rs727505018
NM_001267550.2(TTN):c.51739+1G>C rs727504799
NM_001267550.2(TTN):c.51782G>A (p.Arg17261Gln) rs201825412
NM_001267550.2(TTN):c.51809G>T (p.Ser17270Ile) rs200650668
NM_001267550.2(TTN):c.51841T>C (p.Trp17281Arg) rs368846015
NM_001267550.2(TTN):c.51870del (p.Glu17291fs) rs1553691320
NM_001267550.2(TTN):c.51896C>T (p.Pro17299Leu) rs369648778
NM_001267550.2(TTN):c.5192A>G (p.Asp1731Gly) rs876658072
NM_001267550.2(TTN):c.5198C>T (p.Thr1733Met) rs367700246
NM_001267550.2(TTN):c.52004G>A (p.Arg17335His) rs367603302
NM_001267550.2(TTN):c.52006G>A (p.Val17336Ile) rs567781604
NM_001267550.2(TTN):c.52061A>T (p.Asp17354Val) rs397517606
NM_001267550.2(TTN):c.52098G>A (p.Val17366=) rs727503617
NM_001267550.2(TTN):c.52110G>A (p.Pro17370=) rs139789997
NM_001267550.2(TTN):c.52144A>G (p.Arg17382Gly) rs397517607
NM_001267550.2(TTN):c.52181T>C (p.Leu17394Pro) rs727503616
NM_001267550.2(TTN):c.52199A>C (p.Glu17400Ala) rs773027240
NM_001267550.2(TTN):c.52222_52225AAGA[1] (p.Lys17409fs) rs727503615
NM_001267550.2(TTN):c.52223A>C (p.Lys17408Thr) rs876658066
NM_001267550.2(TTN):c.52230C>T (p.Asp17410=) rs397517608
NM_001267550.2(TTN):c.52243G>A (p.Asp17415Asn) rs397517609
NM_001267550.2(TTN):c.5231C>T (p.Pro1744Leu) rs75686037
NM_001267550.2(TTN):c.52330C>T (p.Arg17444Cys) rs778094750
NM_001267550.2(TTN):c.52406-6T>A rs727504767
NM_001267550.2(TTN):c.52414G>A (p.Asp17472Asn) rs727503614
NM_001267550.2(TTN):c.52448C>T (p.Thr17483Ile) rs1553688779
NM_001267550.2(TTN):c.52557C>T (p.Val17519=) rs397517610
NM_001267550.2(TTN):c.52589A>G (p.Asn17530Ser) rs762214300
NM_001267550.2(TTN):c.52656_52684delinsCAGATCCCAAAACAGATCCC (p.Gly17553_Lys17562delinsArgSerGlnAsnArgSerGln) rs727503613
NM_001267550.2(TTN):c.52667G>A (p.Ser17556Asn) rs750715335
NM_001267550.2(TTN):c.52681C>A (p.Pro17561Thr) rs727503612
NM_001267550.2(TTN):c.52821T>C (p.Asp17607=) rs2303831
NM_001267550.2(TTN):c.52826A>T (p.Gln17609Leu) rs368820294
NM_001267550.2(TTN):c.52852C>T (p.Arg17618Cys) rs201213901
NM_001267550.2(TTN):c.52853G>A (p.Arg17618His) rs371538664
NM_001267550.2(TTN):c.52860A>G (p.Thr17620=) rs397517611
NM_001267550.2(TTN):c.52917T>C (p.Asp17639=) rs73036398
NM_001267550.2(TTN):c.52927C>T (p.Arg17643Trp) rs375944265
NM_001267550.2(TTN):c.53002+10G>T rs370352450
NM_001267550.2(TTN):c.53002+9C>T rs374671774
NM_001267550.2(TTN):c.53012C>T (p.Ala17671Val) rs549478203
NM_001267550.2(TTN):c.53055G>A (p.Met17685Ile) rs200387466
NM_001267550.2(TTN):c.53080G>C (p.Ala17694Pro) rs727503611
NM_001267550.2(TTN):c.53096G>A (p.Arg17699His) rs72646808
NM_001267550.2(TTN):c.53096G>C (p.Arg17699Pro) rs72646808
NM_001267550.2(TTN):c.53123A>T (p.Lys17708Ile) rs2303832
NM_001267550.2(TTN):c.53149C>T (p.Arg17717Cys) rs369001587
NM_001267550.2(TTN):c.5314A>G (p.Ser1772Gly) rs150725992
NM_001267550.2(TTN):c.53166C>T (p.Asn17722=) rs371730757
NM_001267550.2(TTN):c.53180C>G (p.Ser17727Cys) rs369262757
NM_001267550.2(TTN):c.53192T>C (p.Ile17731Thr) rs72646809
NM_001267550.2(TTN):c.53260T>C (p.Phe17754Leu) rs397517612
NM_001267550.2(TTN):c.53287+1G>A
NM_001267550.2(TTN):c.53390C>T (p.Thr17797Ile) rs727503610
NM_001267550.2(TTN):c.53393del (p.Gly17798fs) rs794729324
NM_001267550.2(TTN):c.53517_53519del (p.Lys17840del) rs727504701
NM_001267550.2(TTN):c.5354C>G (p.Thr1785Arg) rs397517649
NM_001267550.2(TTN):c.53558C>G (p.Pro17853Arg) rs727503609
NM_001267550.2(TTN):c.53582-6C>G rs727503608
NM_001267550.2(TTN):c.53592A>G (p.Thr17864=) rs397517613
NM_001267550.2(TTN):c.53625A>G (p.Thr17875=) rs373277508
NM_001267550.2(TTN):c.53653G>T (p.Glu17885Ter) rs727503607
NM_001267550.2(TTN):c.53696T>C (p.Ile17899Thr) rs369723141
NM_001267550.2(TTN):c.53717A>G (p.Lys17906Arg) rs727503606
NM_001267550.2(TTN):c.5373C>A (p.Thr1791=) rs727503693
NM_001267550.2(TTN):c.53807G>A (p.Arg17936His) rs727503604
NM_001267550.2(TTN):c.5388T>C (p.Asp1796=) rs72647878
NM_001267550.2(TTN):c.53903G>A (p.Arg17968His) rs200100660
NM_001267550.2(TTN):c.53915G>A (p.Arg17972Gln) rs377169251
NM_001267550.2(TTN):c.53924C>G (p.Thr17975Ser) rs727503605
NM_001267550.2(TTN):c.54057A>C (p.Glu18019Asp) rs397517614
NM_001267550.2(TTN):c.54068G>A (p.Arg18023Gln) rs727503603
NM_001267550.2(TTN):c.54091A>G (p.Ser18031Gly) rs397517615
NM_001267550.2(TTN):c.54104C>T (p.Ala18035Val) rs182445366
NM_001267550.2(TTN):c.54105G>A (p.Ala18035=) rs371155050
NM_001267550.2(TTN):c.54109C>T (p.Arg18037Trp) rs201623791
NM_001267550.2(TTN):c.54130A>G (p.Thr18044Ala) rs397517616
NM_001267550.2(TTN):c.54148C>T (p.Arg18050Cys) rs55734111
NM_001267550.2(TTN):c.54160G>C (p.Val18054Leu) rs200968679
NM_001267550.2(TTN):c.54167G>A (p.Arg18056Gln) rs376932266
NM_001267550.2(TTN):c.54178G>A (p.Val18060Ile) rs190574498
NM_001267550.2(TTN):c.54188A>G (p.Tyr18063Cys) rs397517617
NM_001267550.2(TTN):c.54189T>C (p.Tyr18063=) rs2303834
NM_001267550.2(TTN):c.5418G>T (p.Leu1806Phe) rs397517650
NM_001267550.2(TTN):c.54201C>T (p.Ser18067=) rs397517618
NM_001267550.2(TTN):c.54207A>G (p.Pro18069=) rs372686070
NM_001267550.2(TTN):c.54208A>C (p.Arg18070=) rs138240658
NM_001267550.2(TTN):c.5423A>C (p.Glu1808Ala) rs746238242
NM_001267550.2(TTN):c.542G>A (p.Ser181Asn) rs72647843
NM_001267550.2(TTN):c.54321A>G (p.Ala18107=) rs368021072
NM_001267550.2(TTN):c.54324T>C (p.Ser18108=) rs397517619
NM_001267550.2(TTN):c.54381+6C>G rs368265962
NM_001267550.2(TTN):c.54490T>C (p.Tyr18164His) rs370135374
NM_001267550.2(TTN):c.54493C>T (p.Arg18165Cys) rs377575788
NM_001267550.2(TTN):c.54517C>T (p.Pro18173Ser) rs766074604
NM_001267550.2(TTN):c.54636T>G (p.Tyr18212Ter) rs397517620
NM_001267550.2(TTN):c.54638G>A (p.Trp18213Ter) rs727503602
NM_001267550.2(TTN):c.54685G>A (p.Val18229Met) rs116142642
NM_001267550.2(TTN):c.54710T>C (p.Leu18237Pro) rs201412693
NM_001267550.2(TTN):c.54793G>A (p.Val18265Ile) rs397517621
NM_001267550.2(TTN):c.5479G>T (p.Ala1827Ser) rs141213991
NM_001267550.2(TTN):c.54811+15G>A rs201450276
NM_001267550.2(TTN):c.54812-5A>G rs375343798
NM_001267550.2(TTN):c.54812T>G (p.Phe18271Cys) rs727503601
NM_001267550.2(TTN):c.54818C>T (p.Pro18273Leu) rs201035511
NM_001267550.2(TTN):c.54874G>C (p.Gly18292Arg) rs377512675
NM_001267550.2(TTN):c.54903C>G (p.Gly18301=) rs190830121
NM_001267550.2(TTN):c.55029G>A (p.Arg18343=) rs62178963
NM_001267550.2(TTN):c.5503C>A (p.Gln1835Lys) rs537070177
NM_001267550.2(TTN):c.55079C>T (p.Pro18360Leu) rs192788942
NM_001267550.2(TTN):c.55139T>C (p.Ile18380Thr) rs72646819
NM_001267550.2(TTN):c.55206C>A (p.Ile18402=) rs368272978
NM_001267550.2(TTN):c.55269G>C (p.Lys18423Asn) rs367799017
NM_001267550.2(TTN):c.55270-3T>C rs749109513
NM_001267550.2(TTN):c.55278T>C (p.Val18426=) rs368013796
NM_001267550.2(TTN):c.55306G>A (p.Glu18436Lys) rs201510986
NM_001267550.2(TTN):c.55340C>T (p.Pro18447Leu) rs397517622
NM_001267550.2(TTN):c.55374C>G (p.Ser18458Arg) rs200550947
NM_001267550.2(TTN):c.55378A>G (p.Thr18460Ala) rs727503600
NM_001267550.2(TTN):c.55396G>A (p.Gly18466Arg) rs772677752
NM_001267550.2(TTN):c.55417A>G (p.Arg18473Gly) rs72646822
NM_001267550.2(TTN):c.55449C>T (p.Pro18483=) rs187366691
NM_001267550.2(TTN):c.55512C>T (p.Asp18504=) rs377164046
NM_001267550.2(TTN):c.55547T>C (p.Ile18516Thr) rs146608896
NM_001267550.2(TTN):c.55553A>G (p.Lys18518Arg) rs72646823
NM_001267550.2(TTN):c.55598G>A (p.Cys18533Tyr) rs727503599
NM_001267550.2(TTN):c.55673G>A (p.Arg18558His) rs115867512
NM_001267550.2(TTN):c.55692T>A (p.Pro18564=) rs200864020
NM_001267550.2(TTN):c.55728G>A (p.Pro18576=) rs727504598
NM_001267550.2(TTN):c.55745C>T (p.Pro18582Leu) rs201194435
NM_001267550.2(TTN):c.55800G>A (p.Trp18600Ter) rs727503598
NM_001267550.2(TTN):c.55805C>A (p.Pro18602His) rs559554374
NM_001267550.2(TTN):c.5582G>A (p.Arg1861His) rs140914855
NM_001267550.2(TTN):c.55880A>C (p.Lys18627Thr) rs727503597
NM_001267550.2(TTN):c.55915G>A (p.Val18639Met) rs727503596
NM_001267550.2(TTN):c.55925T>A (p.Leu18642Gln) rs140714512
NM_001267550.2(TTN):c.55929A>G (p.Gln18643=) rs151335428
NM_001267550.2(TTN):c.55952A>G (p.Glu18651Gly) rs876658067
NM_001267550.2(TTN):c.55973G>A (p.Arg18658Gln) rs370888932
NM_001267550.2(TTN):c.56019T>C (p.Thr18673=) rs183047238
NM_001267550.2(TTN):c.56101A>G (p.Asn18701Asp) rs1001238
NM_001267550.2(TTN):c.561G>A (p.Ser187=) rs141444282
NM_001267550.2(TTN):c.56296G>C (p.Ala18766Pro) rs727505268
NM_001267550.2(TTN):c.56403A>G (p.Gln18801=) rs553313488
NM_001267550.2(TTN):c.5644C>T (p.Arg1882Cys) rs397517658
NM_001267550.2(TTN):c.56529G>A (p.Thr18843=) rs72646827
NM_001267550.2(TTN):c.56533A>C (p.Thr18845Pro) rs375000725
NM_001267550.2(TTN):c.56557C>T (p.His18853Tyr) rs397517623
NM_001267550.2(TTN):c.56647+1G>A rs397517624
NM_001267550.2(TTN):c.56679T>C (p.Val18893=) rs397517625
NM_001267550.2(TTN):c.5668C>T (p.Arg1890Cys) rs146496197
NM_001267550.2(TTN):c.56732dup (p.Asp18911fs) rs397517626
NM_001267550.2(TTN):c.56747T>A (p.Val18916Glu) rs1296926879
NM_001267550.2(TTN):c.56788A>G (p.Arg18930Gly) rs727503595
NM_001267550.2(TTN):c.56801T>A (p.Val18934Asp) rs1553663624
NM_001267550.2(TTN):c.56872G>A (p.Asp18958Asn) rs576158850
NM_001267550.2(TTN):c.56900A>G (p.Asn18967Ser) rs727503594
NM_001267550.2(TTN):c.56910C>T (p.Gly18970=) rs148299739
NM_001267550.2(TTN):c.56942C>T (p.Ala18981Val) rs397517627
NM_001267550.2(TTN):c.56947G>A (p.Ala18983Thr) rs377000174
NM_001267550.2(TTN):c.56956C>A (p.Pro18986Thr) rs568015697
NM_001267550.2(TTN):c.56970T>C (p.Pro18990=) rs372019333
NM_001267550.2(TTN):c.5697C>T (p.Ile1899=) rs148434577
NM_001267550.2(TTN):c.57017A>G (p.Asp19006Gly) rs747343924
NM_001267550.2(TTN):c.57070A>G (p.Ile19024Val) rs876658068
NM_001267550.2(TTN):c.57073G>A (p.Val19025Ile) rs181957743
NM_001267550.2(TTN):c.57112-11T>C rs553667328
NM_001267550.2(TTN):c.57212T>C (p.Ile19071Thr) rs200001206
NM_001267550.2(TTN):c.57215del (p.Gly19072fs) rs397517628
NM_001267550.2(TTN):c.57232A>G (p.Thr19078Ala) rs727503593
NM_001267550.2(TTN):c.57262G>T (p.Val19088Phe) rs727505347
NM_001267550.2(TTN):c.57292G>A (p.Val19098Ile) rs727503592
NM_001267550.2(TTN):c.57300T>G (p.Asp19100Glu) rs876658069
NM_001267550.2(TTN):c.57315T>C (p.His19105=) rs35833641
NM_001267550.2(TTN):c.57331C>T (p.Arg19111Ter) rs72646831
NM_001267550.2(TTN):c.57367A>G (p.Thr19123Ala) rs587782985
NM_001267550.2(TTN):c.57415A>C (p.Ile19139Leu) rs397517629
NM_001267550.2(TTN):c.57416T>C (p.Ile19139Thr) rs727503591
NM_001267550.2(TTN):c.5741C>T (p.Ala1914Val) rs374203813
NM_001267550.2(TTN):c.57442A>G (p.Met19148Val) rs188185141
NM_001267550.2(TTN):c.57462G>A (p.Gln19154=) rs72646832
NM_001267550.2(TTN):c.57464G>A (p.Arg19155Lys) rs72646833
NM_001267550.2(TTN):c.57478G>A (p.Val19160Ile) rs200778464
NM_001267550.2(TTN):c.57478G>C (p.Val19160Leu) rs200778464
NM_001267550.2(TTN):c.57544+7dup rs750881309
NM_001267550.2(TTN):c.57586C>G (p.Leu19196Val) rs397517630
NM_001267550.2(TTN):c.57648C>T (p.Ile19216=) rs55956577
NM_001267550.2(TTN):c.57683G>A (p.Arg19228His) rs114711705
NM_001267550.2(TTN):c.57693G>T (p.Trp19231Cys) rs876658071
NM_001267550.2(TTN):c.57786T>C (p.Asn19262=) rs876657608
NM_001267550.2(TTN):c.57847+1G>A rs397517631
NM_001267550.2(TTN):c.57860G>A (p.Arg19287His) rs371422299
NM_001267550.2(TTN):c.57933T>C (p.Asp19311=) rs554555894
NM_001267550.2(TTN):c.57971G>A (p.Arg19324Gln) rs186809500
NM_001267550.2(TTN):c.57995del (p.His19332fs) rs397517633
NM_001267550.2(TTN):c.58017G>C (p.Leu19339Phe) rs368025965
NM_001267550.2(TTN):c.58049_58051AAG[1] (p.Glu19351del) rs397517634
NM_001267550.2(TTN):c.58072C>T (p.Arg19358Cys) rs371973579
NM_001267550.2(TTN):c.58074T>C (p.Arg19358=) rs397517632
NM_001267550.2(TTN):c.58122C>G (p.Thr19374=) rs189818369
NM_001267550.2(TTN):c.58150+10T>C rs397517635
NM_001267550.2(TTN):c.58155C>A (p.Pro19385=) rs373587801
NM_001267550.2(TTN):c.58190C>T (p.Thr19397Met) rs373527448
NM_001267550.2(TTN):c.58226G>A (p.Arg19409His) rs201505306
NM_001267550.2(TTN):c.5823A>G (p.Arg1941=) rs149668487
NM_001267550.2(TTN):c.58274C>G (p.Ala19425Gly) rs727504525
NM_001267550.2(TTN):c.58363G>A (p.Gly19455Ser) rs191927501
NM_001267550.2(TTN):c.58392T>C (p.Ser19464=) rs876657609
NM_001267550.2(TTN):c.58394C>G (p.Thr19465Arg) rs571477228
NM_001267550.2(TTN):c.58395A>G (p.Thr19465=) rs375134177
NM_001267550.2(TTN):c.58419A>G (p.Gln19473=) rs186563991
NM_001267550.2(TTN):c.58426G>A (p.Val19476Ile) rs397517636
NM_001267550.2(TTN):c.58436G>A (p.Arg19479His) rs2288569
NM_001267550.2(TTN):c.58576G>A (p.Val19526Ile) rs377682563
NM_001267550.2(TTN):c.58612A>G (p.Thr19538Ala) rs200017524
NM_001267550.2(TTN):c.58636G>C (p.Glu19546Gln) rs201840554
NM_001267550.2(TTN):c.58653T>C (p.Ile19551=) rs727504980
NM_001267550.2(TTN):c.58684A>G (p.Ile19562Val) rs397517637
NM_001267550.2(TTN):c.58705G>A (p.Asp19569Asn) rs397517638
NM_001267550.2(TTN):c.58711A>G (p.Met19571Val) rs770228515
NM_001267550.2(TTN):c.58728T>C (p.Arg19576=) rs727504475
NM_001267550.2(TTN):c.58796C>T (p.Thr19599Ile) rs367816473
NM_001267550.2(TTN):c.587_589AAG[2] (p.Glu198del) rs771898264
NM_001267550.2(TTN):c.58869A>G (p.Lys19623=) rs191066933
NM_001267550.2(TTN):c.58897A>G (p.Ile19633Val) rs727505028
NM_001267550.2(TTN):c.58902T>C (p.His19634=) rs397517639
NM_001267550.2(TTN):c.58933C>T (p.Leu19645=) rs2303836
NM_001267550.2(TTN):c.58982G>A (p.Gly19661Asp) rs397517640
NM_001267550.2(TTN):c.59073T>C (p.Asp19691=) rs775577598
NM_001267550.2(TTN):c.59081G>A (p.Cys19694Tyr) rs727505276
NM_001267550.2(TTN):c.59092G>T (p.Asp19698Tyr) rs397517642
NM_001267550.2(TTN):c.59113C>T (p.Arg19705Cys) rs72646839
NM_001267550.2(TTN):c.59114G>A (p.Arg19705His) rs727503590
NM_001267550.2(TTN):c.59165T>C (p.Val19722Ala) rs116592778
NM_001267550.2(TTN):c.5917A>G (p.Thr1973Ala) rs397517666
NM_001267550.2(TTN):c.59205del (p.Glu19735fs) rs397517643
NM_001267550.2(TTN):c.5929G>A (p.Val1977Met) rs876658075
NM_001267550.2(TTN):c.59315C>T (p.Pro19772Leu) rs72646840
NM_001267550.2(TTN):c.59318A>G (p.Glu19773Gly) rs371719028
NM_001267550.2(TTN):c.59319G>A (p.Glu19773=) rs367622770
NM_001267550.2(TTN):c.59322A>G (p.Pro19774=) rs188063446
NM_001267550.2(TTN):c.59360T>A (p.Ile19787Asn) rs768765076
NM_001267550.2(TTN):c.59504T>G (p.Val19835Gly) rs727504511
NM_001267550.2(TTN):c.59570T>C (p.Leu19857Ser) rs547180437
NM_001267550.2(TTN):c.59585C>T (p.Pro19862Leu) rs16866406
NM_001267550.2(TTN):c.59618T>C (p.Leu19873Pro) rs727503589
NM_001267550.2(TTN):c.59632C>T (p.Pro19878Ser) rs752854931
NM_001267550.2(TTN):c.59685C>T (p.Tyr19895=) rs397517644
NM_001267550.2(TTN):c.59693G>A (p.Trp19898Ter) rs974671846
NM_001267550.2(TTN):c.59707G>A (p.Asp19903Asn) rs374163882
NM_001267550.2(TTN):c.59729C>T (p.Thr19910Ile) rs369476725
NM_001267550.2(TTN):c.597A>G (p.Val199=) rs144214844
NM_001267550.2(TTN):c.59835C>T (p.Asn19945=) rs72646842
NM_001267550.2(TTN):c.59926C>T (p.His19976Tyr) rs727503588
NM_001267550.2(TTN):c.5992C>T (p.Arg1998Cys) rs727503692
NM_001267550.2(TTN):c.59937G>A (p.Gly19979=) rs727505101
NM_001267550.2(TTN):c.5993G>A (p.Arg1998His) rs144135510
NM_001267550.2(TTN):c.59943C>A (p.Pro19981=) rs202017608
NM_001267550.2(TTN):c.60002C>T (p.Pro20001Leu) rs727505345
NM_001267550.2(TTN):c.60023C>T (p.Pro20008Leu) rs199839492
NM_001267550.2(TTN):c.60055G>A (p.Glu20019Lys) rs201487340
NM_001267550.2(TTN):c.60146G>A (p.Arg20049His) rs200455644
NM_001267550.2(TTN):c.60180C>T (p.Leu20060=) rs876657610
NM_001267550.2(TTN):c.60197C>T (p.Pro20066Leu) rs750217838
NM_001267550.2(TTN):c.60198G>A (p.Pro20066=) rs767152563
NM_001267550.2(TTN):c.60232G>A (p.Val20078Met) rs77351975
NM_001267550.2(TTN):c.6029A>G (p.Tyr2010Cys) rs397517672
NM_001267550.2(TTN):c.60314T>G (p.Val20105Gly) rs727504490
NM_001267550.2(TTN):c.60399del (p.Ser20134fs) rs727504466
NM_001267550.2(TTN):c.60471C>T (p.Ala20157=) rs397517645
NM_001267550.2(TTN):c.60490G>C (p.Val20164Leu) rs72646843
NM_001267550.2(TTN):c.60524C>T (p.Pro20175Leu) rs771358314
NM_001267550.2(TTN):c.60571A>C (p.Ile20191Leu) rs745806239
NM_001267550.2(TTN):c.60721G>C (p.Glu20241Gln) rs200212521
NM_001267550.2(TTN):c.60746A>C (p.Glu20249Ala) rs397517646
NM_001267550.2(TTN):c.60756A>G (p.Ile20252Met) rs876657611
NM_001267550.2(TTN):c.60816G>A (p.Pro20272=) rs727504529
NM_001267550.2(TTN):c.60821C>T (p.Pro20274Leu) rs72646845
NM_001267550.2(TTN):c.60876G>C (p.Trp20292Cys) rs397517647
NM_001267550.2(TTN):c.60932G>A (p.Arg20311Gln) rs373062007
NM_001267550.2(TTN):c.60975C>T (p.Ile20325=) rs727505195
NM_001267550.2(TTN):c.609G>C (p.Lys203Asn) rs1554042109
NM_001267550.2(TTN):c.61029T>C (p.Phe20343=) rs6706088
NM_001267550.2(TTN):c.61099C>T (p.Arg20367Trp) rs727504479
NM_001267550.2(TTN):c.61100G>A (p.Arg20367Gln) rs141973925
NM_001267550.2(TTN):c.61138C>A (p.Leu20380Met) rs201167216
NM_001267550.2(TTN):c.61138C>T (p.Leu20380=) rs201167216
NM_001267550.2(TTN):c.61149G>C (p.Lys20383Asn) rs727504968
NM_001267550.2(TTN):c.61163C>G (p.Ala20388Gly) rs397517648
NM_001267550.2(TTN):c.61224G>A (p.Val20408=) rs566188777
NM_001267550.2(TTN):c.61245A>G (p.Thr20415=) rs2163009
NM_001267550.2(TTN):c.61289G>A (p.Cys20430Tyr) rs527704660
NM_001267550.2(TTN):c.61322A>G (p.Asn20441Ser) rs147580753
NM_001267550.2(TTN):c.61366G>A (p.Gly20456Ser) rs756873840
NM_001267550.2(TTN):c.61409T>C (p.Ile20470Thr) rs202012910
NM_001267550.2(TTN):c.61556G>A (p.Arg20519Gln) rs727504191
NM_001267550.2(TTN):c.61615G>A (p.Ala20539Thr) rs754756569
NM_001267550.2(TTN):c.6162C>T (p.Ala2054=) rs143265948
NM_001267550.2(TTN):c.61631A>G (p.His20544Arg) rs876658073
NM_001267550.2(TTN):c.61742T>G (p.Val20581Gly) rs727504849
NM_001267550.2(TTN):c.61761A>C (p.Thr20587=) rs727505259
NM_001267550.2(TTN):c.61876C>T (p.Arg20626Ter) rs72646846
NM_001267550.2(TTN):c.61915T>C (p.Tyr20639His) rs727503587
NM_001267550.2(TTN):c.61922G>A (p.Arg20641Gln) rs199895260
NM_001267550.2(TTN):c.61992C>G (p.Asn20664Lys) rs376455983
NM_001267550.2(TTN):c.62030T>C (p.Ile20677Thr) rs558670891
NM_001267550.2(TTN):c.62058T>C (p.Tyr20686=) rs1560221
NM_001267550.2(TTN):c.62178T>C (p.Thr20726=) rs72646847
NM_001267550.2(TTN):c.62217T>A (p.Tyr20739Ter) rs727503586
NM_001267550.2(TTN):c.62275G>A (p.Glu20759Lys) rs562680371
NM_001267550.2(TTN):c.6227A>G (p.Glu2076Gly) rs397517680
NM_001267550.2(TTN):c.62290G>C (p.Glu20764Gln) rs397517651
NM_001267550.2(TTN):c.62385C>A (p.Gly20795=) rs72646848
NM_001267550.2(TTN):c.62432A>G (p.Asp20811Gly) rs72646849
NM_001267550.2(TTN):c.62459T>C (p.Ile20820Thr) rs369446270
NM_001267550.2(TTN):c.62534C>G (p.Thr20845Arg) rs727505316
NM_001267550.2(TTN):c.62572A>G (p.Thr20858Ala) rs200689750
NM_001267550.2(TTN):c.62644A>G (p.Thr20882Ala) rs538308579
NM_001267550.2(TTN):c.62761C>A (p.Pro20921Thr) rs935268567
NM_001267550.2(TTN):c.62780G>A (p.Arg20927His) rs397517652
NM_001267550.2(TTN):c.62909dup (p.Glu20971fs) rs876657666
NM_001267550.2(TTN):c.62931_62933AGA[1] (p.Glu20979del) rs727505236
NM_001267550.2(TTN):c.62943T>C (p.Thr20981=) rs184863287
NM_001267550.2(TTN):c.62994C>T (p.Tyr20998=) rs375006117
NM_001267550.2(TTN):c.63023C>T (p.Thr21008Ile) rs72646850
NM_001267550.2(TTN):c.63026G>A (p.Arg21009Gln) rs72646851
NM_001267550.2(TTN):c.63035C>T (p.Pro21012Leu) rs1476856667
NM_001267550.2(TTN):c.63065G>A (p.Arg21022His) rs727503585
NM_001267550.2(TTN):c.63114C>A (p.Val21038=) rs201642579
NM_001267550.2(TTN):c.63165G>A (p.Pro21055=) rs72646852
NM_001267550.2(TTN):c.63181C>T (p.Pro21061Ser) rs375401971
NM_001267550.2(TTN):c.63187+8G>A rs727503584
NM_001267550.2(TTN):c.63241A>T (p.Ile21081Leu) rs876658074
NM_001267550.2(TTN):c.63269A>T (p.Tyr21090Phe) rs377480514
NM_001267550.2(TTN):c.63291T>C (p.Ile21097=) rs397517653
NM_001267550.2(TTN):c.63329C>T (p.Ala21110Val) rs370687831
NM_001267550.2(TTN):c.63330G>A (p.Ala21110=) rs727504885
NM_001267550.2(TTN):c.63352C>T (p.Arg21118Trp) rs200726948
NM_001267550.2(TTN):c.63439G>A (p.Ala21147Thr) rs72646853
NM_001267550.2(TTN):c.63463C>T (p.Arg21155Cys) rs374727686
NM_001267550.2(TTN):c.6353T>C (p.Ile2118Thr) rs56404770
NM_001267550.2(TTN):c.63558G>A (p.Val21186=) rs200261892
NM_001267550.2(TTN):c.63577C>T (p.Arg21193Cys) rs376800688
NM_001267550.2(TTN):c.63578G>A (p.Arg21193His) rs372267046
NM_001267550.2(TTN):c.63589A>G (p.Ile21197Val) rs72646855
NM_001267550.2(TTN):c.63632T>C (p.Val21211Ala) rs397517654
NM_001267550.2(TTN):c.63800C>T (p.Pro21267Leu) rs200365508
NM_001267550.2(TTN):c.6380A>G (p.Tyr2127Cys) rs397517688
NM_001267550.2(TTN):c.63876C>T (p.Asn21292=) rs199598302
NM_001267550.2(TTN):c.63879C>T (p.Asp21293=) rs200463088
NM_001267550.2(TTN):c.63887G>A (p.Ser21296Asn) rs727503583
NM_001267550.2(TTN):c.63917G>A (p.Arg21306His) rs202240487
NM_001267550.2(TTN):c.63921G>A (p.Glu21307=) rs1466883677
NM_001267550.2(TTN):c.63942G>A (p.Ser21314=) rs201285872
NM_001267550.2(TTN):c.63960T>A (p.Val21320=) rs397517655
NM_001267550.2(TTN):c.63981A>G (p.Val21327=) rs397517656
NM_001267550.2(TTN):c.64005G>A (p.Glu21335=) rs749889687
NM_001267550.2(TTN):c.64032C>T (p.Asn21344=) rs72646857
NM_001267550.2(TTN):c.64094-2A>G rs876657667
NM_001267550.2(TTN):c.64101G>A (p.Pro21367=) rs397517657
NM_001267550.2(TTN):c.64147G>A (p.Ala21383Thr) rs727503582
NM_001267550.2(TTN):c.64174C>T (p.Arg21392Cys) rs72646859
NM_001267550.2(TTN):c.64184G>C (p.Gly21395Ala) rs769161359
NM_001267550.2(TTN):c.64193T>G (p.Ile21398Ser) rs727504754
NM_001267550.2(TTN):c.64208C>T (p.Thr21403Ile) rs2042996
NM_001267550.2(TTN):c.6420T>A (p.Asp2140Glu) rs777009984
NM_001267550.2(TTN):c.64241G>A (p.Arg21414His) rs727504690
NM_001267550.2(TTN):c.64318A>T (p.Arg21440Ter)
NM_001267550.2(TTN):c.64326G>A (p.Ala21442=) rs377109969
NM_001267550.2(TTN):c.64338T>C (p.Ala21446=) rs371514555
NM_001267550.2(TTN):c.64397-1G>C rs876657668
NM_001267550.2(TTN):c.64589C>T (p.Thr21530Ile) rs397517659
NM_001267550.2(TTN):c.64682G>T (p.Gly21561Val) rs111829923
NM_001267550.2(TTN):c.64719C>T (p.Asp21573=) rs727504967
NM_001267550.2(TTN):c.64762G>A (p.Gly21588Arg) rs181717727
NM_001267550.2(TTN):c.64774A>G (p.Ile21592Val) rs727503581
NM_001267550.2(TTN):c.64789G>A (p.Val21597Met) rs150661999
NM_001267550.2(TTN):c.6478A>G (p.Thr2160Ala) rs397517693
NM_001267550.2(TTN):c.64811G>A (p.Arg21604Gln) rs188996850
NM_001267550.2(TTN):c.64826C>T (p.Thr21609Met) rs765913263
NM_001267550.2(TTN):c.64860G>A (p.Arg21620=) rs373713828
NM_001267550.2(TTN):c.64903C>T (p.Arg21635Cys) rs201614524
NM_001267550.2(TTN):c.64998A>G (p.Ala21666=) rs876657612
NM_001267550.2(TTN):c.6508+14C>A rs771328770
NM_001267550.2(TTN):c.6508+15T>C rs747722195
NM_001267550.2(TTN):c.65092C>T (p.Arg21698Cys) rs72646861
NM_001267550.2(TTN):c.65147C>T (p.Ser21716Leu) rs13021201
NM_001267550.2(TTN):c.65158C>A (p.Pro21720Thr) rs776953525
NM_001267550.2(TTN):c.65161T>C (p.Cys21721Arg) rs745497694
NM_001267550.2(TTN):c.65173G>A (p.Val21725Ile) rs368716894
NM_001267550.2(TTN):c.65179G>A (p.Gly21727Ser) rs756099303
NM_001267550.2(TTN):c.65187G>A (p.Glu21729=) rs397517660
NM_001267550.2(TTN):c.65194T>C (p.Phe21732Leu) rs397517661
NM_001267550.2(TTN):c.65243C>T (p.Pro21748Leu) rs1419714561
NM_001267550.2(TTN):c.65275+13G>T rs727504999
NM_001267550.2(TTN):c.65319T>C (p.Thr21773=) rs746956869
NM_001267550.2(TTN):c.65369T>C (p.Ile21790Thr) rs727503580
NM_001267550.2(TTN):c.65371G>A (p.Gly21791Ser) rs370878527
NM_001267550.2(TTN):c.65379C>T (p.Phe21793=) rs377017745
NM_001267550.2(TTN):c.65459C>T (p.Thr21820Ile) rs56130023
NM_001267550.2(TTN):c.65516C>T (p.Ala21839Val) rs55948748
NM_001267550.2(TTN):c.65534C>T (p.Pro21845Leu) rs201662134
NM_001267550.2(TTN):c.65574T>C (p.Asn21858=) rs374858668
NM_001267550.2(TTN):c.65604T>C (p.Ala21868=) rs200825430
NM_001267550.2(TTN):c.65649G>T (p.Leu21883Phe) rs374736305
NM_001267550.2(TTN):c.65672C>T (p.Pro21891Leu) rs397517662
NM_001267550.2(TTN):c.65682A>G (p.Thr21894=) rs4894029
NM_001267550.2(TTN):c.65729T>C (p.Ile21910Thr) rs146941600
NM_001267550.2(TTN):c.65743C>A (p.Gln21915Lys) rs62618736
NM_001267550.2(TTN):c.65746C>T (p.Arg21916Trp) rs200155485
NM_001267550.2(TTN):c.65747G>A (p.Arg21916Gln) rs148849567
NM_001267550.2(TTN):c.65775C>T (p.Ser21925=) rs72646867
NM_001267550.2(TTN):c.65776G>A (p.Val21926Met) rs145527033
NM_001267550.2(TTN):c.65782C>T (p.Arg21928Trp) rs371856109
NM_001267550.2(TTN):c.65871G>A (p.Pro21957=) rs771651842
NM_001267550.2(TTN):c.66054G>A (p.Glu22018=) rs727503579
NM_001267550.2(TTN):c.66086G>A (p.Arg22029His) rs72646868
NM_001267550.2(TTN):c.66160+15C>T rs377288086
NM_001267550.2(TTN):c.66172C>T (p.Arg22058Cys) rs199643269
NM_001267550.2(TTN):c.66240A>C (p.Ala22080=) rs375181938
NM_001267550.2(TTN):c.66275T>G (p.Leu22092Arg) rs1553627146
NM_001267550.2(TTN):c.66349G>A (p.Ala22117Thr) rs727505036
NM_001267550.2(TTN):c.66391A>G (p.Thr22131Ala) rs140842479
NM_001267550.2(TTN):c.66430G>A (p.Ala22144Thr) rs183276016
NM_001267550.2(TTN):c.66441C>T (p.Ala22147=) rs727503578
NM_001267550.2(TTN):c.66450T>G (p.Ala22150=) rs727504643
NM_001267550.2(TTN):c.66479C>T (p.Pro22160Leu) rs777364605
NM_001267550.2(TTN):c.66480G>A (p.Pro22160=) rs372814670
NM_001267550.2(TTN):c.66491A>T (p.Lys22164Ile) rs371081043
NM_001267550.2(TTN):c.66590G>A (p.Arg22197Gln) rs374656017
NM_001267550.2(TTN):c.66610G>A (p.Val22204Met) rs376238023
NM_001267550.2(TTN):c.66614G>A (p.Arg22205Lys) rs72646869
NM_001267550.2(TTN):c.66618C>A (p.Cys22206Ter) rs397517664
NM_001267550.2(TTN):c.66673G>A (p.Asp22225Asn) rs72646870
NM_001267550.2(TTN):c.66681A>G (p.Gln22227=) rs397517665
NM_001267550.2(TTN):c.66692G>A (p.Arg22231His) rs200971254
NM_001267550.2(TTN):c.66702C>T (p.Ala22234=) rs371802557
NM_001267550.2(TTN):c.66778G>A (p.Glu22260Lys) rs553988103
NM_001267550.2(TTN):c.6678_6681del (p.Lys2227fs) rs397517698
NM_001267550.2(TTN):c.66804G>A (p.Arg22268=) rs370501197
NM_001267550.2(TTN):c.66898G>A (p.Val22300Ile) rs200343420
NM_001267550.2(TTN):c.66917T>C (p.Ile22306Thr) rs397517667
NM_001267550.2(TTN):c.66959G>A (p.Arg22320His) rs771424865
NM_001267550.2(TTN):c.66977A>G (p.Lys22326Arg) rs202125813
NM_001267550.2(TTN):c.66996T>C (p.Tyr22332=) rs397517668
NM_001267550.2(TTN):c.67075G>A (p.Val22359Ile) rs2303838
NM_001267550.2(TTN):c.67099T>C (p.Ser22367Pro) rs72646873
NM_001267550.2(TTN):c.67104A>C (p.Lys22368Asn) rs727503577
NM_001267550.2(TTN):c.6713C>T (p.Thr2238Met) rs201284459
NM_001267550.2(TTN):c.67147G>A (p.Gly22383Arg) rs372388682
NM_001267550.2(TTN):c.67246G>C (p.Ala22416Pro) rs4145333
NM_001267550.2(TTN):c.6727G>T (p.Asp2243Tyr) rs138787974
NM_001267550.2(TTN):c.67318G>A (p.Gly22440Ser) rs727503576
NM_001267550.2(TTN):c.67348+11G>C rs587780982
NM_001267550.2(TTN):c.67444C>T (p.Arg22482Trp) rs563233842
NM_001267550.2(TTN):c.67445G>A (p.Arg22482Gln) rs200146608
NM_001267550.2(TTN):c.67487A>G (p.Lys22496Arg) rs397517669
NM_001267550.2(TTN):c.67537T>C (p.Leu22513=) rs727504507
NM_001267550.2(TTN):c.67542T>G (p.Thr22514=) rs72646876
NM_001267550.2(TTN):c.67571G>A (p.Ser22524Asn) rs397517670
NM_001267550.2(TTN):c.67635T>C (p.Val22545=) rs2288570
NM_001267550.2(TTN):c.67681T>C (p.Leu22561=) rs397517671
NM_001267550.2(TTN):c.67683G>C (p.Leu22561Phe) rs876658076
NM_001267550.2(TTN):c.67706G>A (p.Arg22569Gln) rs185620750
NM_001267550.2(TTN):c.67808C>T (p.Ala22603Val) rs199583938
NM_001267550.2(TTN):c.67833C>T (p.Tyr22611=) rs375538420
NM_001267550.2(TTN):c.6783T>A (p.Ile2261=) rs876657614
NM_001267550.2(TTN):c.6790+12C>T rs200187117
NM_001267550.2(TTN):c.6790+13G>A rs758773000
NM_001267550.2(TTN):c.67960G>C (p.Asp22654His) rs144295295
NM_001267550.2(TTN):c.68079G>A (p.Thr22693=) rs11904444
NM_001267550.2(TTN):c.68082C>T (p.Cys22694=) rs79406408
NM_001267550.2(TTN):c.68097G>C (p.Gln22699His) rs727504520
NM_001267550.2(TTN):c.68160C>T (p.Ala22720=) rs397517673
NM_001267550.2(TTN):c.68161G>A (p.Glu22721Lys) rs374492812
NM_001267550.2(TTN):c.68165A>G (p.Asn22722Ser) rs200493270
NM_001267550.2(TTN):c.68195C>A (p.Ser22732Ter) rs727505352
NM_001267550.2(TTN):c.68196G>A (p.Ser22732=) rs397517674
NM_001267550.2(TTN):c.68208T>A (p.Val22736=) rs727503575
NM_001267550.2(TTN):c.68217T>C (p.His22739=) rs10497517
NM_001267550.2(TTN):c.68225-5T>C rs758273663
NM_001267550.2(TTN):c.68251A>C (p.Asn22751His) rs727504970
NM_001267550.2(TTN):c.68272G>A (p.Asp22758Asn) rs397517675
NM_001267550.2(TTN):c.68282C>T (p.Ser22761Phe) rs397517676
NM_001267550.2(TTN):c.68335C>A (p.His22779Asn) rs727504702
NM_001267550.2(TTN):c.68379T>C (p.Ala22793=) rs727503574
NM_001267550.2(TTN):c.68410A>G (p.Lys22804Glu) rs397517677
NM_001267550.2(TTN):c.68417C>T (p.Thr22806Ile) rs727503573
NM_001267550.2(TTN):c.68437G>A (p.Glu22813Lys) rs200797552
NM_001267550.2(TTN):c.68449C>A (p.Arg22817=) rs371678190
NM_001267550.2(TTN):c.68449C>T (p.Arg22817Ter) rs371678190
NM_001267550.2(TTN):c.6844T>C (p.Tyr2282His) rs727503691
NM_001267550.2(TTN):c.68458G>C (p.Ala22820Pro) rs72646880
NM_001267550.2(TTN):c.68498C>T (p.Ser22833Leu) rs876658077
NM_001267550.2(TTN):c.68525T>C (p.Ile22842Thr) rs368301580
NM_001267550.2(TTN):c.68605G>A (p.Gly22869Ser) rs876658078
NM_001267550.2(TTN):c.68612A>C (p.His22871Pro) rs761622490
NM_001267550.2(TTN):c.68654C>T (p.Ser22885Leu) rs376574861
NM_001267550.2(TTN):c.68712T>C (p.Thr22904=) rs397517678
NM_001267550.2(TTN):c.68762C>T (p.Thr22921Ile) rs534567766
NM_001267550.2(TTN):c.68792G>A (p.Ser22931Asn) rs201567815
NM_001267550.2(TTN):c.687T>C (p.Phe229=) rs376527094
NM_001267550.2(TTN):c.68823C>T (p.Tyr22941=) rs200717463
NM_001267550.2(TTN):c.68824G>A (p.Glu22942Lys) rs199506676
NM_001267550.2(TTN):c.68864G>C (p.Gly22955Ala) rs201381085
NM_001267550.2(TTN):c.69117T>A (p.Asp23039Glu) rs727503572
NM_001267550.2(TTN):c.69130C>T (p.Pro23044Ser) rs55980498
NM_001267550.2(TTN):c.6913G>A (p.Glu2305Lys) rs367761468
NM_001267550.2(TTN):c.69145A>G (p.Ile23049Val) rs72646881
NM_001267550.2(TTN):c.69227T>C (p.Ile23076Thr) rs765930349
NM_001267550.2(TTN):c.69231T>C (p.Leu23077=) rs12615797
NM_001267550.2(TTN):c.69325G>A (p.Glu23109Lys) rs727503571
NM_001267550.2(TTN):c.69338G>A (p.Arg23113Gln) rs370890454
NM_001267550.2(TTN):c.69383C>A (p.Ser23128Tyr) rs72646882
NM_001267550.2(TTN):c.69393C>G (p.Val23131=) rs727504692
NM_001267550.2(TTN):c.6941T>C (p.Ile2314Thr) rs397517708
NM_001267550.2(TTN):c.69458_69461dup (p.Asn23154fs) rs397517679
NM_001267550.2(TTN):c.6949C>T (p.Arg2317Cys) rs750101152
NM_001267550.2(TTN):c.69517G>A (p.Gly23173Arg) rs773592810
NM_001267550.2(TTN):c.69546A>G (p.Lys23182=) rs876657613
NM_001267550.2(TTN):c.69585C>T (p.Ser23195=) rs67041405
NM_001267550.2(TTN):c.69676A>G (p.Ser23226Gly) rs72646885
NM_001267550.2(TTN):c.69740C>T (p.Pro23247Leu) rs115658240
NM_001267550.2(TTN):c.6981T>C (p.Asp2327=) rs397517709
NM_001267550.2(TTN):c.69821G>A (p.Gly23274Asp) rs201043950
NM_001267550.2(TTN):c.69844G>A (p.Val23282Ile) rs876658079
NM_001267550.2(TTN):c.69853G>A (p.Glu23285Lys) rs376870149
NM_001267550.2(TTN):c.69864A>G (p.Ile23288Met) rs368867993
NM_001267550.2(TTN):c.69903C>A (p.Phe23301Leu) rs372799151
NM_001267550.2(TTN):c.69904G>A (p.Val23302Ile) rs190421400
NM_001267550.2(TTN):c.70036C>T (p.Leu23346=) rs397517681
NM_001267550.2(TTN):c.70045G>A (p.Glu23349Lys) rs397517682
NM_001267550.2(TTN):c.70056A>G (p.Arg23352=) rs75948012
NM_001267550.2(TTN):c.70102A>G (p.Ile23368Val) rs367914610
NM_001267550.2(TTN):c.70131A>G (p.Thr23377=) rs369503828
NM_001267550.2(TTN):c.70172T>C (p.Ile23391Thr) rs375202101
NM_001267550.2(TTN):c.70181C>T (p.Thr23394Met) rs397517683
NM_001267550.2(TTN):c.70250T>C (p.Ile23417Thr) rs201836227
NM_001267550.2(TTN):c.70275del (p.Ser23425fs) rs727504655
NM_001267550.2(TTN):c.70305G>A (p.Thr23435=) rs397517684
NM_001267550.2(TTN):c.70473A>G (p.Lys23491=) rs397517685
NM_001267550.2(TTN):c.70477A>T (p.Thr23493Ser) rs375675901
NM_001267550.2(TTN):c.70491C>T (p.Thr23497=) rs372382315
NM_001267550.2(TTN):c.70492G>A (p.Gly23498Ser) rs370771532
NM_001267550.2(TTN):c.70506G>T (p.Gly23502=) rs181702963
NM_001267550.2(TTN):c.70530G>A (p.Met23510Ile) rs727503569
NM_001267550.2(TTN):c.70600T>A (p.Ser23534Thr) rs397517686
NM_001267550.2(TTN):c.7060C>T (p.Arg2354Cys) rs145039979
NM_001267550.2(TTN):c.7061G>A (p.Arg2354His) rs75031300
NM_001267550.2(TTN):c.70625T>C (p.Met23542Thr) rs727503570
NM_001267550.2(TTN):c.70644C>T (p.Thr23548=) rs148210834
NM_001267550.2(TTN):c.70651C>T (p.Leu23551=) rs72646889
NM_001267550.2(TTN):c.70677T>C (p.Asp23559=) rs72646890
NM_001267550.2(TTN):c.70686C>T (p.Ser23562=) rs371481540
NM_001267550.2(TTN):c.70696G>C (p.Gly23566Arg) rs55801134
NM_001267550.2(TTN):c.70748C>A (p.Thr23583Lys) rs397517687
NM_001267550.2(TTN):c.70796A>T (p.Glu23599Val) rs727503568
NM_001267550.2(TTN):c.70815G>A (p.Val23605=) rs55847238
NM_001267550.2(TTN):c.70830C>T (p.Ser23610=) rs12464787
NM_001267550.2(TTN):c.70832C>T (p.Ala23611Val) rs72646891
NM_001267550.2(TTN):c.70833G>A (p.Ala23611=) rs377220635
NM_001267550.2(TTN):c.70907G>A (p.Arg23636His) rs56071233
NM_001267550.2(TTN):c.70952T>G (p.Ile23651Ser) rs149075285
NM_001267550.2(TTN):c.70967C>T (p.Pro23656Leu) rs368938701
NM_001267550.2(TTN):c.71036G>A (p.Arg23679Lys) rs200144345
NM_001267550.2(TTN):c.71321G>A (p.Trp23774Ter) rs727503567
NM_001267550.2(TTN):c.71332G>A (p.Ala23778Thr) rs727503566
NM_001267550.2(TTN):c.7133A>G (p.Lys2378Arg) rs727503690
NM_001267550.2(TTN):c.71369G>A (p.Arg23790His) rs55677134
NM_001267550.2(TTN):c.71373T>G (p.Leu23791=) rs56245285
NM_001267550.2(TTN):c.7157G>A (p.Gly2386Asp) rs142926566
NM_001267550.2(TTN):c.71602C>T (p.Arg23868Ter) rs397517689
NM_001267550.2(TTN):c.71608G>A (p.Gly23870Ser) rs727503564
NM_001267550.2(TTN):c.71634del (p.Ala23879fs) rs727503565
NM_001267550.2(TTN):c.71705T>C (p.Ile23902Thr) rs55837610
NM_001267550.2(TTN):c.71723G>A (p.Gly23908Asp) rs540161344
NM_001267550.2(TTN):c.7173C>T (p.Asp2391=) rs374509926
NM_001267550.2(TTN):c.7174G>A (p.Gly2392Ser) rs4894048
NM_001267550.2(TTN):c.71789A>T (p.Lys23930Ile) rs752648041
NM_001267550.2(TTN):c.71881G>A (p.Val23961Ile) rs397517690
NM_001267550.2(TTN):c.71909G>A (p.Arg23970Gln) rs727503563
NM_001267550.2(TTN):c.71940G>A (p.Leu23980=) rs72646893
NM_001267550.2(TTN):c.71952T>C (p.Phe23984=) rs727504881
NM_001267550.2(TTN):c.71980_71986delinsTA (p.Ala23994_Glu23996delinsTer) rs794729338
NM_001267550.2(TTN):c.71981C>T (p.Ala23994Val) rs772886864
NM_001267550.2(TTN):c.71993G>A (p.Arg23998His) rs10164753
NM_001267550.2(TTN):c.72033A>G (p.Pro24011=) rs72646894
NM_001267550.2(TTN):c.72105T>C (p.Phe24035=) rs397517691
NM_001267550.2(TTN):c.72132T>C (p.Gly24044=) rs56169243
NM_001267550.2(TTN):c.72137C>T (p.Ala24046Val) rs146767076
NM_001267550.2(TTN):c.72171A>G (p.Pro24057=) rs397517692
NM_001267550.2(TTN):c.72181A>G (p.Met24061Val) rs201482015
NM_001267550.2(TTN):c.72182T>C (p.Met24061Thr) rs200471370
NM_001267550.2(TTN):c.72232A>G (p.Ile24078Val) rs876658080
NM_001267550.2(TTN):c.72236A>G (p.Lys24079Arg) rs775482499
NM_001267550.2(TTN):c.72302C>A (p.Thr24101Asn) rs192962624
NM_001267550.2(TTN):c.72331G>C (p.Ala24111Pro) rs369671334
NM_001267550.2(TTN):c.72379G>A (p.Glu24127Lys) rs149763294
NM_001267550.2(TTN):c.7242T>C (p.Ile2414=) rs727503689
NM_001267550.2(TTN):c.72488G>A (p.Arg24163His) rs374712231
NM_001267550.2(TTN):c.72587G>A (p.Arg24196His) rs200317412
NM_001267550.2(TTN):c.72624A>G (p.Pro24208=) rs56293906
NM_001267550.2(TTN):c.72652A>C (p.Asn24218His) rs727505243
NM_001267550.2(TTN):c.72669del (p.Asp24224fs) rs727504531
NM_001267550.2(TTN):c.72782G>A (p.Arg24261Gln) rs142874389
NM_001267550.2(TTN):c.72832dup (p.Thr24278fs) rs876657669
NM_001267550.2(TTN):c.72874G>A (p.Glu24292Lys) rs727505240
NM_001267550.2(TTN):c.72931A>G (p.Thr24311Ala) rs56201325
NM_001267550.2(TTN):c.72985A>G (p.Asn24329Asp) rs397517694
NM_001267550.2(TTN):c.72994G>T (p.Val24332Phe) rs876658081
NM_001267550.2(TTN):c.72C>G (p.Thr24=) rs876657615
NM_001267550.2(TTN):c.73124C>T (p.Pro24375Leu) rs376041680
NM_001267550.2(TTN):c.73146T>A (p.Thr24382=) rs372092427
NM_001267550.2(TTN):c.73168A>G (p.Thr24390Ala) rs182491843
NM_001267550.2(TTN):c.7316G>A (p.Arg2439His) rs142129359
NM_001267550.2(TTN):c.732C>T (p.Ala244=) rs761859812
NM_001267550.2(TTN):c.73334C>T (p.Thr24445Ile) rs377334665
NM_001267550.2(TTN):c.73336C>T (p.Leu24446=) rs189768015
NM_001267550.2(TTN):c.73340G>A (p.Arg24447Lys) rs377190830
NM_001267550.2(TTN):c.73385G>C (p.Trp24462Ser) rs1553607435
NM_001267550.2(TTN):c.73387del (p.Ala24463fs) rs1553607425
NM_001267550.2(TTN):c.73390C>T (p.Arg24464Trp) rs369098292
NM_001267550.2(TTN):c.73517G>A (p.Gly24506Asp) rs567446185
NM_001267550.2(TTN):c.73540G>T (p.Val24514Phe) rs1553607188
NM_001267550.2(TTN):c.73604C>A (p.Ser24535Tyr) rs201804005
NM_001267550.2(TTN):c.73743C>A (p.Asp24581Glu) rs727504603
NM_001267550.2(TTN):c.73770T>C (p.Tyr24590=) rs201380749
NM_001267550.2(TTN):c.73825G>C (p.Glu24609Gln) rs55762754
NM_001267550.2(TTN):c.73827del (p.Glu24609fs) rs397517695
NM_001267550.2(TTN):c.73845del (p.Glu24615fs) rs397517696
NM_001267550.2(TTN):c.7392T>C (p.Leu2464=) rs565784637
NM_001267550.2(TTN):c.73994C>T (p.Thr24665Met) rs144398602
NM_001267550.2(TTN):c.74057C>G (p.Ser24686Cys) rs727504921
NM_001267550.2(TTN):c.74112T>C (p.Ser24704=) rs397517697
NM_001267550.2(TTN):c.74181A>G (p.Val24727=) rs374889737
NM_001267550.2(TTN):c.74305A>G (p.Asn24769Asp) rs372787601
NM_001267550.2(TTN):c.74331C>T (p.Asp24777=) rs368530092
NM_001267550.2(TTN):c.74416C>T (p.Leu24806Phe) rs866687107
NM_001267550.2(TTN):c.74527A>G (p.Asn24843Asp) rs373527654
NM_001267550.2(TTN):c.74545C>T (p.Arg24849Trp) rs727503562
NM_001267550.2(TTN):c.74549A>G (p.Asp24850Gly) rs573415766
NM_001267550.2(TTN):c.74597_74599CAA[1] (p.Thr24867del) rs543318580
NM_001267550.2(TTN):c.74673G>C (p.Lys24891Asn) rs727504855
NM_001267550.2(TTN):c.74839C>T (p.Arg24947Cys) rs744426
NM_001267550.2(TTN):c.74844G>A (p.Lys24948=) rs371884545
NM_001267550.2(TTN):c.74891C>T (p.Pro24964Leu) rs72646899
NM_001267550.2(TTN):c.74895A>C (p.Gln24965His) rs201512527
NM_001267550.2(TTN):c.74961C>T (p.Asn24987=) rs754043680
NM_001267550.2(TTN):c.74968G>A (p.Gly24990Ser) rs727503561
NM_001267550.2(TTN):c.74972T>C (p.Ile24991Thr) rs744427
NM_001267550.2(TTN):c.74981C>T (p.Pro24994Leu) rs531281558
NM_001267550.2(TTN):c.75034C>T (p.Arg25012Trp) rs368914555
NM_001267550.2(TTN):c.75044C>T (p.Ala25015Val) rs397517699
NM_001267550.2(TTN):c.75104G>A (p.Gly25035Glu) rs727503560
NM_001267550.2(TTN):c.75127G>T (p.Val25043Phe) rs559907766
NM_001267550.2(TTN):c.75155G>A (p.Arg25052His) rs542720402
NM_001267550.2(TTN):c.7523A>G (p.His2508Arg) rs146970027
NM_001267550.2(TTN):c.75274G>A (p.Glu25092Lys) rs397517700
NM_001267550.2(TTN):c.7530A>G (p.Ser2510=) rs189187431
NM_001267550.2(TTN):c.75361A>G (p.Ile25121Val) rs199508062
NM_001267550.2(TTN):c.75364G>A (p.Val25122Met) rs376821762
NM_001267550.2(TTN):c.75441A>G (p.Lys25147=) rs56151652
NM_001267550.2(TTN):c.75443del (p.Gly25148fs) rs1553603456
NM_001267550.2(TTN):c.7545C>T (p.Tyr2515=) rs2291306
NM_001267550.2(TTN):c.75490G>A (p.Asp25164Asn) rs192468365
NM_001267550.2(TTN):c.75504T>G (p.Ser25168Arg) rs375204371
NM_001267550.2(TTN):c.75522A>C (p.Ala25174=) rs6732060
NM_001267550.2(TTN):c.7556T>C (p.Val2519Ala) rs372361514
NM_001267550.2(TTN):c.7556T>G (p.Val2519Gly) rs372361514
NM_001267550.2(TTN):c.75621A>C (p.Pro25207=) rs1553603053
NM_001267550.2(TTN):c.75734G>A (p.Arg25245Lys) rs397517701
NM_001267550.2(TTN):c.75745C>T (p.Arg25249Cys) rs397517702
NM_001267550.2(TTN):c.75762G>T (p.Val25254=) rs374003257
NM_001267550.2(TTN):c.75833G>A (p.Arg25278His) rs769729114
NM_001267550.2(TTN):c.75969T>C (p.Val25323=) rs368759398
NM_001267550.2(TTN):c.76027A>G (p.Lys25343Glu) rs727504596
NM_001267550.2(TTN):c.76070G>A (p.Arg25357His) rs397517703
NM_001267550.2(TTN):c.76113A>G (p.Glu25371=) rs140350441
NM_001267550.2(TTN):c.76124A>T (p.Tyr25375Phe) rs374494927
NM_001267550.2(TTN):c.76199G>C (p.Cys25400Ser) rs397517704
NM_001267550.2(TTN):c.7619G>A (p.Arg2540His) rs397517725
NM_001267550.2(TTN):c.76200T>C (p.Cys25400=) rs397517705
NM_001267550.2(TTN):c.76229A>T (p.Asn25410Ile) rs397517706
NM_001267550.2(TTN):c.76343G>A (p.Ser25448Asn) rs3813243
NM_001267550.2(TTN):c.7642C>T (p.Gln2548Ter) rs727503688
NM_001267550.2(TTN):c.76492C>G (p.Pro25498Ala) rs377754701
NM_001267550.2(TTN):c.76559T>C (p.Ile25520Thr) rs1553601714
NM_001267550.2(TTN):c.76565T>C (p.Ile25522Thr) rs372963832
NM_001267550.2(TTN):c.76673A>T (p.Asp25558Val) rs201095164
NM_001267550.2(TTN):c.76674T>C (p.Asp25558=) rs375553630
NM_001267550.2(TTN):c.76720T>C (p.Tyr25574His) rs3813245
NM_001267550.2(TTN):c.76722T>C (p.Tyr25574=) rs55696153
NM_001267550.2(TTN):c.76739C>A (p.Thr25580Lys) rs56372592
NM_001267550.2(TTN):c.76739C>T (p.Thr25580Met) rs56372592
NM_001267550.2(TTN):c.76854A>G (p.Val25618=) rs192902075
NM_001267550.2(TTN):c.76922G>A (p.Arg25641His) rs369707906
NM_001267550.2(TTN):c.77013T>C (p.Tyr25671=) rs397517707
NM_001267550.2(TTN):c.77035A>C (p.Asn25679His) rs770512378
NM_001267550.2(TTN):c.77073T>C (p.Asp25691=) rs375398118
NM_001267550.2(TTN):c.77171A>T (p.His25724Leu) rs768382014
NM_001267550.2(TTN):c.77182A>G (p.Ser25728Gly) rs1306199809
NM_001267550.2(TTN):c.77205G>A (p.Val25735=) rs55857909
NM_001267550.2(TTN):c.77216C>G (p.Ala25739Gly) rs56391938
NM_001267550.2(TTN):c.77279A>G (p.Asn25760Ser) rs3813246
NM_001267550.2(TTN):c.7740T>G (p.Ile2580Met) rs146590898
NM_001267550.2(TTN):c.77421dup (p.Ser25808fs) rs730880343
NM_001267550.2(TTN):c.77564T>A (p.Leu25855His) rs397517710
NM_001267550.2(TTN):c.77638A>G (p.Thr25880Ala) rs56018860
NM_001267550.2(TTN):c.77716G>A (p.Glu25906Lys) rs56341835
NM_001267550.2(TTN):c.77772C>T (p.Thr25924=) rs727505107
NM_001267550.2(TTN):c.77789A>C (p.Lys25930Thr) rs397517711
NM_001267550.2(TTN):c.77799A>T (p.Thr25933=) rs727505210
NM_001267550.2(TTN):c.77813G>C (p.Trp25938Ser) rs186681106
NM_001267550.2(TTN):c.77816A>C (p.Asp25939Ala) rs397517712
NM_001267550.2(TTN):c.77848C>T (p.Leu25950Phe) rs376814602
NM_001267550.2(TTN):c.78062C>G (p.Pro26021Arg) rs727504982
NM_001267550.2(TTN):c.78147A>G (p.Gln26049=) rs149127072
NM_001267550.2(TTN):c.7830G>C (p.Met2610Ile) rs56142888
NM_001267550.2(TTN):c.78370A>T (p.Ile26124Phe) rs397517713
NM_001267550.2(TTN):c.78481T>A (p.Phe26161Ile) rs876658082
NM_001267550.2(TTN):c.78577A>C (p.Ile26193Leu) rs727505241
NM_001267550.2(TTN):c.78674T>C (p.Ile26225Thr) rs12463674
NM_001267550.2(TTN):c.78711T>A (p.Ser26237=) rs727504808
NM_001267550.2(TTN):c.78774A>G (p.Arg26258=) rs368270588
NM_001267550.2(TTN):c.78855T>C (p.Asp26285=) rs139953862
NM_001267550.2(TTN):c.78892G>A (p.Gly26298Arg) rs72648205
NM_001267550.2(TTN):c.78896T>A (p.Val26299Asp) rs73036377
NM_001267550.2(TTN):c.78980G>A (p.Arg26327Gln) rs370367786
NM_001267550.2(TTN):c.79062T>A (p.Gly26354=) rs3731744
NM_001267550.2(TTN):c.79072G>A (p.Val26358Ile) rs774747865
NM_001267550.2(TTN):c.79109G>A (p.Gly26370Glu) rs727505061
NM_001267550.2(TTN):c.79122A>G (p.Glu26374=) rs727504497
NM_001267550.2(TTN):c.79127C>A (p.Ala26376Glu) rs397517714
NM_001267550.2(TTN):c.79145A>C (p.Asn26382Thr) rs727505049
NM_001267550.2(TTN):c.79207A>G (p.Met26403Val) rs876658083
NM_001267550.2(TTN):c.79217G>C (p.Cys26406Ser) rs727505223
NM_001267550.2(TTN):c.79225C>T (p.Arg26409Cys) rs748258568
NM_001267550.2(TTN):c.79226G>A (p.Arg26409His) rs72648206
NM_001267550.2(TTN):c.79265T>C (p.Ile26422Thr) rs3731745
NM_001267550.2(TTN):c.79318C>T (p.Arg26440Cys) rs55861600
NM_001267550.2(TTN):c.79319G>A (p.Arg26440His) rs56044609
NM_001267550.2(TTN):c.79343T>G (p.Val26448Gly) rs1553590427
NM_001267550.2(TTN):c.79410G>A (p.Gly26470=) rs140942979
NM_001267550.2(TTN):c.79518T>C (p.Leu26506=) rs367608273
NM_001267550.2(TTN):c.79612A>G (p.Thr26538Ala) rs150682764
NM_001267550.2(TTN):c.7961G>A (p.Arg2654Lys) rs147207100
NM_001267550.2(TTN):c.79689C>A (p.Val26563=) rs10185798
NM_001267550.2(TTN):c.79700A>G (p.Asn26567Ser) rs183844833
NM_001267550.2(TTN):c.79783G>C (p.Asp26595His) rs56307213
NM_001267550.2(TTN):c.79827del (p.Ala26610fs) rs397517715
NM_001267550.2(TTN):c.79862C>T (p.Thr26621Met) rs3731746
NM_001267550.2(TTN):c.79863G>A (p.Thr26621=) rs186402008
NM_001267550.2(TTN):c.79885G>C (p.Glu26629Gln) rs727504673
NM_001267550.2(TTN):c.79941A>G (p.Gln26647=) rs72648208
NM_001267550.2(TTN):c.80006G>A (p.Ser26669Asn) rs727505214
NM_001267550.2(TTN):c.80115G>T (p.Glu26705Asp) rs558830502
NM_001267550.2(TTN):c.80263T>C (p.Phe26755Leu) rs200181804
NM_001267550.2(TTN):c.80271C>T (p.Val26757=) rs199875474
NM_001267550.2(TTN):c.80290G>A (p.Gly26764Arg) rs727505213
NM_001267550.2(TTN):c.80322C>T (p.Ala26774=) rs55892928
NM_001267550.2(TTN):c.80323G>A (p.Val26775Met) rs370589806
NM_001267550.2(TTN):c.80425G>A (p.Gly26809Ser) rs369941201
NM_001267550.2(TTN):c.80494G>T (p.Glu26832Ter) rs780512337
NM_001267550.2(TTN):c.80542G>C (p.Glu26848Gln) rs898433512
NM_001267550.2(TTN):c.80553_80554delinsTT (p.Arg26852Cys) rs397517716
NM_001267550.2(TTN):c.80562G>A (p.Lys26854=) rs397517717
NM_001267550.2(TTN):c.80608C>A (p.Pro26870Thr) rs397517718
NM_001267550.2(TTN):c.80635C>A (p.Gln26879Lys) rs79926414
NM_001267550.2(TTN):c.80661C>T (p.Asn26887=) rs201069672
NM_001267550.2(TTN):c.8069C>T (p.Thr2690Ile) rs374620001
NM_001267550.2(TTN):c.80701A>G (p.Ile26901Val) rs201562505
NM_001267550.2(TTN):c.80716C>T (p.Arg26906Ter) rs727505284
NM_001267550.2(TTN):c.80717G>A (p.Arg26906Gln) rs536183519
NM_001267550.2(TTN):c.80774G>A (p.Arg26925Lys) rs748215561
NM_001267550.2(TTN):c.80799C>A (p.Thr26933=) rs3813247
NM_001267550.2(TTN):c.80858C>T (p.Thr26953Met) rs377506142
NM_001267550.2(TTN):c.80898T>C (p.Ser26966=) rs374042845
NM_001267550.2(TTN):c.80944T>C (p.Phe26982Leu) rs200406978
NM_001267550.2(TTN):c.80983G>A (p.Glu26995Lys) rs397517719
NM_001267550.2(TTN):c.80997_81012del (p.Ala26998_Tyr26999insTer) rs727503559
NM_001267550.2(TTN):c.81005_81028del (p.Gly27002_Ile27009del) rs727504756
NM_001267550.2(TTN):c.81057T>C (p.Thr27019=) rs114908705
NM_001267550.2(TTN):c.81105C>A (p.Thr27035=) rs72648212
NM_001267550.2(TTN):c.81178G>T (p.Asp27060Tyr) rs372875889
NM_001267550.2(TTN):c.81247T>C (p.Ser27083Pro) rs186273940
NM_001267550.2(TTN):c.81297T>C (p.Asp27099=) rs727505134
NM_001267550.2(TTN):c.8131A>C (p.Lys2711Gln) rs727504735
NM_001267550.2(TTN):c.81321C>G (p.Tyr27107Ter) rs557312035
NM_001267550.2(TTN):c.81464T>C (p.Ile27155Thr) rs397517720
NM_001267550.2(TTN):c.81511T>C (p.Cys27171Arg) rs727504678
NM_001267550.2(TTN):c.81521del (p.Pro27174fs) rs1553577362
NM_001267550.2(TTN):c.81532G>T (p.Glu27178Ter) rs397517721
NM_001267550.2(TTN):c.81539T>C (p.Ile27180Thr) rs182126530
NM_001267550.2(TTN):c.81558T>C (p.Asn27186=) rs56181243
NM_001267550.2(TTN):c.81565C>G (p.Leu27189Val) rs142391957
NM_001267550.2(TTN):c.81612T>A (p.Gly27204=) rs397517722
NM_001267550.2(TTN):c.81671A>G (p.Asn27224Ser) rs368443217
NM_001267550.2(TTN):c.81673G>A (p.Val27225Ile) rs375211424
NM_001267550.2(TTN):c.81758A>G (p.Asn27253Ser) rs529055709
NM_001267550.2(TTN):c.81850G>A (p.Val27284Ile) rs746222222
NM_001267550.2(TTN):c.81855C>T (p.Ile27285=) rs56214710
NM_001267550.2(TTN):c.81856G>A (p.Val27286Ile) rs372784067
NM_001267550.2(TTN):c.81858T>C (p.Val27286=) rs727503558
NM_001267550.2(TTN):c.81878_81879del (p.Phe27293fs) rs727504660
NM_001267550.2(TTN):c.81881T>G (p.Val27294Gly) rs876658084
NM_001267550.2(TTN):c.81886del (p.Glu27296fs) rs727503557
NM_001267550.2(TTN):c.81899G>A (p.Arg27300His) rs55850344
NM_001267550.2(TTN):c.81901G>A (p.Gly27301Ser) rs727504650
NM_001267550.2(TTN):c.81938G>A (p.Gly27313Glu) rs199670463
NM_001267550.2(TTN):c.81958G>A (p.Ala27320Thr) rs56365600
NM_001267550.2(TTN):c.82021C>T (p.Arg27341Trp) rs746488250
NM_001267550.2(TTN):c.82061T>G (p.Val27354Gly) rs368023868
NM_001267550.2(TTN):c.82081C>G (p.Pro27361Ala) rs56137800
NM_001267550.2(TTN):c.82103A>G (p.Asp27368Gly) rs145373396
NM_001267550.2(TTN):c.82220T>C (p.Ile27407Thr) rs376037252
NM_001267550.2(TTN):c.82385C>A (p.Thr27462Lys) rs55933739
NM_001267550.2(TTN):c.82402A>C (p.Lys27468Gln) rs201958805
NM_001267550.2(TTN):c.82446C>T (p.Thr27482=) rs768861950
NM_001267550.2(TTN):c.82489G>A (p.Gly27497Arg) rs201158906
NM_001267550.2(TTN):c.82497C>T (p.Thr27499=) rs199629314
NM_001267550.2(TTN):c.82551C>G (p.Thr27517=) rs373634657
NM_001267550.2(TTN):c.82560C>A (p.Asn27520Lys) rs56264840
NM_001267550.2(TTN):c.82575G>A (p.Thr27525=) rs11896779
NM_001267550.2(TTN):c.82605C>T (p.Thr27535=) rs772246177
NM_001267550.2(TTN):c.82616C>G (p.Ser27539Cys) rs727503556
NM_001267550.2(TTN):c.82691C>T (p.Ala27564Val) rs55634791
NM_001267550.2(TTN):c.82692G>A (p.Ala27564=) rs557628408
NM_001267550.2(TTN):c.82740G>A (p.Thr27580=) rs56345408
NM_001267550.2(TTN):c.82754C>A (p.Ser27585Tyr) rs72648215
NM_001267550.2(TTN):c.82759G>A (p.Val27587Ile) rs876658085
NM_001267550.2(TTN):c.82773G>A (p.Trp27591Ter) rs727505288
NM_001267550.2(TTN):c.82797C>T (p.Gly27599=) rs72648216
NM_001267550.2(TTN):c.82798G>A (p.Ala27600Thr) rs11896637
NM_001267550.2(TTN):c.82810G>A (p.Gly27604Ser) rs199929362
NM_001267550.2(TTN):c.82859G>T (p.Cys27620Phe) rs762472521
NM_001267550.2(TTN):c.8292G>A (p.Leu2764=) rs727503687
NM_001267550.2(TTN):c.83056G>A (p.Val27686Ile) rs56309296
NM_001267550.2(TTN):c.8305_8306TG[1] (p.Ala2770fs) rs869312037
NM_001267550.2(TTN):c.83063G>A (p.Arg27688His) rs185002960
NM_001267550.2(TTN):c.83115C>T (p.Pro27705=) rs747021593
NM_001267550.2(TTN):c.8314G>A (p.Val2772Met) rs143035953
NM_001267550.2(TTN):c.83171T>G (p.Val27724Gly) rs201896662
NM_001267550.2(TTN):c.83272T>C (p.Phe27758Leu) rs188323108
NM_001267550.2(TTN):c.83281G>A (p.Val27761Ile) rs371788070
NM_001267550.2(TTN):c.83299C>A (p.Pro27767Thr) rs184643087
NM_001267550.2(TTN):c.83323A>G (p.Ile27775Val) rs3829746
NM_001267550.2(TTN):c.83404A>G (p.Ile27802Val) rs727504723
NM_001267550.2(TTN):c.83407del (p.Val27803fs) rs727504782
NM_001267550.2(TTN):c.83514C>T (p.Phe27838=) rs779213695
NM_001267550.2(TTN):c.83543T>C (p.Ile27848Thr) rs397517723
NM_001267550.2(TTN):c.83560A>G (p.Thr27854Ala) rs876658086
NM_001267550.2(TTN):c.83575A>G (p.Lys27859Glu) rs761633407
NM_001267550.2(TTN):c.835C>T (p.Arg279Trp) rs138060032
NM_001267550.2(TTN):c.83603del (p.Gly27868fs) rs727505014
NM_001267550.2(TTN):c.83611A>T (p.Thr27871Ser) rs397517724
NM_001267550.2(TTN):c.83618T>C (p.Val27873Ala) rs200775919
NM_001267550.2(TTN):c.83673T>C (p.Gly27891=) rs2366751
NM_001267550.2(TTN):c.83740A>G (p.Thr27914Ala) rs188370772
NM_001267550.2(TTN):c.83820C>T (p.Asn27940=) rs727503555
NM_001267550.2(TTN):c.83870G>C (p.Arg27957Thr) rs148067743
NM_001267550.2(TTN):c.83978C>A (p.Thr27993Asn) rs377614000
NM_001267550.2(TTN):c.84095C>A (p.Thr28032Asn) rs876658087
NM_001267550.2(TTN):c.84148A>G (p.Ile28050Val) rs201348580
NM_001267550.2(TTN):c.84263G>A (p.Ser28088Asn) rs200450022
NM_001267550.2(TTN):c.8434G>C (p.Val2812Leu) rs146636599
NM_001267550.2(TTN):c.84352C>T (p.Arg28118Cys) rs56057221
NM_001267550.2(TTN):c.84362C>A (p.Thr28121Lys) rs397517726
NM_001267550.2(TTN):c.84398A>G (p.Asn28133Ser) rs727505053
NM_001267550.2(TTN):c.84448T>C (p.Tyr28150His) rs397517727
NM_001267550.2(TTN):c.84451C>A (p.Pro28151Thr) rs727504873
NM_001267550.2(TTN):c.84453A>G (p.Pro28151=) rs73036373
NM_001267550.2(TTN):c.84461C>T (p.Pro28154Leu) rs200350579
NM_001267550.2(TTN):c.84494A>G (p.His28165Arg) rs876658088
NM_001267550.2(TTN):c.84523T>C (p.Trp28175Arg) rs397517728
NM_001267550.2(TTN):c.84553C>T (p.Arg28185Ter) rs397517729
NM_001267550.2(TTN):c.84625A>G (p.Ile28209Val) rs753472730
NM_001267550.2(TTN):c.84652G>A (p.Gly28218Ser) rs727504693
NM_001267550.2(TTN):c.8467G>T (p.Val2823Phe) rs33917087
NM_001267550.2(TTN):c.84696A>C (p.Glu28232Asp) rs397517730
NM_001267550.2(TTN):c.84871C>T (p.Arg28291Cys) rs192152102
NM_001267550.2(TTN):c.84893G>A (p.Arg28298Gln) rs187270666
NM_001267550.2(TTN):c.84923A>C (p.Gln28308Pro) rs201674674
NM_001267550.2(TTN):c.8492G>A (p.Ser2831Asn) rs2306636
NM_001267550.2(TTN):c.84962A>G (p.Gln28321Arg) rs760149145
NM_001267550.2(TTN):c.84965G>A (p.Arg28322His) rs373532064
NM_001267550.2(TTN):c.84977G>A (p.Arg28326Gln) rs200843338
NM_001267550.2(TTN):c.85040T>C (p.Ile28347Thr) rs397517731
NM_001267550.2(TTN):c.85130T>C (p.Ile28377Thr) rs876658089
NM_001267550.2(TTN):c.85195G>A (p.Glu28399Lys) rs397517732
NM_001267550.2(TTN):c.85351C>T (p.Pro28451Ser) rs727503554
NM_001267550.2(TTN):c.85406C>G (p.Ser28469Cys) rs202040332
NM_001267550.2(TTN):c.85510G>T (p.Glu28504Ter) rs876657670
NM_001267550.2(TTN):c.85516C>A (p.Gln28506Lys) rs201272728
NM_001267550.2(TTN):c.85598_85603del (p.Val28533_Gly28534del) rs727503553
NM_001267550.2(TTN):c.85649T>A (p.Val28550Asp) rs727505194
NM_001267550.2(TTN):c.85691A>T (p.Lys28564Ile) rs199859344
NM_001267550.2(TTN):c.85745T>A (p.Ile28582Lys) rs201688358
NM_001267550.2(TTN):c.85769G>A (p.Arg28590Gln) rs375667028
NM_001267550.2(TTN):c.8589A>G (p.Glu2863=) rs72647883
NM_001267550.2(TTN):c.85979T>C (p.Ile28660Thr) rs397517733
NM_001267550.2(TTN):c.86003T>C (p.Ile28668Thr) rs374022393
NM_001267550.2(TTN):c.86085C>T (p.Asp28695=) rs773001228
NM_001267550.2(TTN):c.8609A>T (p.Gln2870Leu) rs372008728
NM_001267550.2(TTN):c.86117G>A (p.Arg28706Gln) rs199788826
NM_001267550.2(TTN):c.86139C>T (p.Ser28713=) rs750163793
NM_001267550.2(TTN):c.86301G>A (p.Lys28767=) rs56310931
NM_001267550.2(TTN):c.8633_8636del (p.Phe2878fs) rs727503686
NM_001267550.2(TTN):c.86363G>A (p.Trp28788Ter) rs1064793814
NM_001267550.2(TTN):c.86377A>G (p.Thr28793Ala) rs727505234
NM_001267550.2(TTN):c.86393G>A (p.Arg28798Lys) rs781458689
NM_001267550.2(TTN):c.86429T>C (p.Leu28810Pro) rs397517734
NM_001267550.2(TTN):c.86435T>C (p.Ile28812Thr) rs727504959
NM_001267550.2(TTN):c.86437G>T (p.Glu28813Ter) rs868494032
NM_001267550.2(TTN):c.86471C>T (p.Thr28824Ile) rs200709344
NM_001267550.2(TTN):c.86526T>G (p.Val28842=) rs72648226
NM_001267550.2(TTN):c.86683G>A (p.Val28895Met) rs201290358
NM_001267550.2(TTN):c.86700C>T (p.Asn28900=) rs727504793
NM_001267550.2(TTN):c.86729_86731AAG[1] (p.Glu28911del) rs727504797
NM_001267550.2(TTN):c.86799_86802del (p.Glu28935_Gly28936insTer) rs727504856
NM_001267550.2(TTN):c.86811A>G (p.Val28937=) rs55972010
NM_001267550.2(TTN):c.8685G>T (p.Glu2895Asp) rs727503685
NM_001267550.2(TTN):c.86910C>T (p.Gly28970=) rs397517736
NM_001267550.2(TTN):c.86934C>T (p.Val28978=) rs531340219
NM_001267550.2(TTN):c.86935G>A (p.Val28979Ile) rs201687390
NM_001267550.2(TTN):c.87049G>A (p.Ala29017Thr) rs727505050
NM_001267550.2(TTN):c.87077C>T (p.Pro29026Leu) rs876658090
NM_001267550.2(TTN):c.87087T>C (p.Leu29029=) rs12621078
NM_001267550.2(TTN):c.87102T>A (p.Leu29034=) rs781200259
NM_001267550.2(TTN):c.87111G>A (p.Glu29037=) rs374902148
NM_001267550.2(TTN):c.87137T>G (p.Met29046Arg) rs143975327
NM_001267550.2(TTN):c.87345T>C (p.Tyr29115=) rs369444690
NM_001267550.2(TTN):c.87367A>C (p.Ser29123Arg) rs375198596
NM_001267550.2(TTN):c.87377C>G (p.Thr29126Ser) rs559269036
NM_001267550.2(TTN):c.87390T>A (p.Ile29130=) rs876657616
NM_001267550.2(TTN):c.87412C>A (p.Pro29138Thr) rs72648227
NM_001267550.2(TTN):c.87516del (p.Tyr29173fs) rs727503552
NM_001267550.2(TTN):c.87611C>G (p.Thr29204Arg) rs72648228
NM_001267550.2(TTN):c.87623A>T (p.Tyr29208Phe) rs201831707
NM_001267550.2(TTN):c.87663T>C (p.Ser29221=) rs397517737
NM_001267550.2(TTN):c.87669T>C (p.His29223=) rs72648229
NM_001267550.2(TTN):c.87705C>G (p.Tyr29235Ter)
NM_001267550.2(TTN):c.87765T>C (p.Thr29255=) rs397517738
NM_001267550.2(TTN):c.87805G>A (p.Val29269Ile) rs727503551
NM_001267550.2(TTN):c.87808G>A (p.Val29270Ile) rs141624266
NM_001267550.2(TTN):c.87877C>T (p.Arg29293Cys) rs191482653
NM_001267550.2(TTN):c.87878G>A (p.Arg29293His) rs202001776
NM_001267550.2(TTN):c.88009+13C>T rs397517739
NM_001267550.2(TTN):c.88028G>A (p.Arg29343His) rs73036368
NM_001267550.2(TTN):c.88090G>A (p.Gly29364Ser) rs183013408
NM_001267550.2(TTN):c.88123C>T (p.Arg29375Cys) rs368439674
NM_001267550.2(TTN):c.88156A>T (p.Ser29386Cys) rs727505102
NM_001267550.2(TTN):c.88183T>C (p.Phe29395Leu) rs55940667
NM_001267550.2(TTN):c.88187T>C (p.Ile29396Thr) rs9808377
NM_001267550.2(TTN):c.88272G>A (p.Glu29424=) rs9808036
NM_001267550.2(TTN):c.88297G>A (p.Asp29433Asn) rs189202799
NM_001267550.2(TTN):c.88297G>C (p.Asp29433His) rs189202799
NM_001267550.2(TTN):c.88306+1G>C rs727503550
NM_001267550.2(TTN):c.88307-15C>T rs727505307
NM_001267550.2(TTN):c.88340C>G (p.Thr29447Arg) rs140201636
NM_001267550.2(TTN):c.88394C>T (p.Ser29465Phe) rs146181116
NM_001267550.2(TTN):c.88406C>T (p.Ala29469Val) rs397517740
NM_001267550.2(TTN):c.88407G>A (p.Ala29469=) rs531445644
NM_001267550.2(TTN):c.8843C>T (p.Ser2948Leu) rs397517763
NM_001267550.2(TTN):c.88459G>A (p.Val29487Met) rs200899806
NM_001267550.2(TTN):c.88476C>G (p.Thr29492=) rs190406444
NM_001267550.2(TTN):c.88485C>T (p.Leu29495=) rs371612136
NM_001267550.2(TTN):c.88510G>A (p.Asp29504Asn) rs376679796
NM_001267550.2(TTN):c.88685G>A (p.Gly29562Asp) rs72648235
NM_001267550.2(TTN):c.88688G>A (p.Gly29563Asp) rs1335432771
NM_001267550.2(TTN):c.88708A>G (p.Ile29570Val) rs139506970
NM_001267550.2(TTN):c.88720C>T (p.Arg29574Cys) rs200513274
NM_001267550.2(TTN):c.88721G>A (p.Arg29574His) rs111727915
NM_001267550.2(TTN):c.88858C>T (p.Leu29620=) rs115070904
NM_001267550.2(TTN):c.88972A>G (p.Ile29658Val) rs200193877
NM_001267550.2(TTN):c.88983C>T (p.Gly29661=) rs371678936
NM_001267550.2(TTN):c.88984G>A (p.Gly29662Ser) rs187460377
NM_001267550.2(TTN):c.89018G>A (p.Arg29673Gln) rs200639218
NM_001267550.2(TTN):c.8902+13_8902+14delinsGA rs1553993564
NM_001267550.2(TTN):c.89111A>G (p.Tyr29704Cys) rs727504503
NM_001267550.2(TTN):c.89136C>T (p.Asn29712=) rs376289479
NM_001267550.2(TTN):c.89197_89197+2del rs397517741
NM_001267550.2(TTN):c.8919C>G (p.Ser2973=) rs4894045
NM_001267550.2(TTN):c.89252T>C (p.Ile29751Thr) rs397517742
NM_001267550.2(TTN):c.89258T>A (p.Leu29753His) rs369279892
NM_001267550.2(TTN):c.89317A>T (p.Ile29773Leu) rs77853750
NM_001267550.2(TTN):c.89357C>T (p.Thr29786Ile) rs753966916
NM_001267550.2(TTN):c.89368G>A (p.Val29790Ile) rs775906983
NM_001267550.2(TTN):c.89375C>T (p.Thr29792Ile) rs876658091
NM_001267550.2(TTN):c.89386G>A (p.Val29796Met) rs72648237
NM_001267550.2(TTN):c.8938G>A (p.Ala2980Thr) rs72647885
NM_001267550.2(TTN):c.89426G>A (p.Arg29809Gln) rs72648238
NM_001267550.2(TTN):c.89515A>G (p.Ile29839Val) rs750806089
NM_001267550.2(TTN):c.8953A>T (p.Thr2985Ser) rs727503684
NM_001267550.2(TTN):c.89545G>T (p.Val29849Phe) rs727504493
NM_001267550.2(TTN):c.89628T>G (p.Asp29876Glu) rs397517743
NM_001267550.2(TTN):c.89711G>A (p.Arg29904His) rs397517744
NM_001267550.2(TTN):c.89766G>C (p.Lys29922Asn) rs397517745
NM_001267550.2(TTN):c.89839C>T (p.Arg29947Ter) rs727505224
NM_001267550.2(TTN):c.89893A>G (p.Ile29965Val) rs370135800
NM_001267550.2(TTN):c.89946C>T (p.Val29982=) rs373311459
NM_001267550.2(TTN):c.89947G>A (p.Val29983Met) rs397517746
NM_001267550.2(TTN):c.89989T>A (p.Leu29997Met) rs369855092
NM_001267550.2(TTN):c.89994G>A (p.Ser29998=) rs142891278
NM_001267550.2(TTN):c.90103C>T (p.Arg30035Cys) rs397517747
NM_001267550.2(TTN):c.90129A>G (p.Thr30043=) rs727504960
NM_001267550.2(TTN):c.90227C>T (p.Thr30076Met) rs201998913
NM_001267550.2(TTN):c.9031A>G (p.Thr3011Ala) rs727504682
NM_001267550.2(TTN):c.90405T>C (p.Asp30135=) rs371945826
NM_001267550.2(TTN):c.90409C>T (p.Pro30137Ser) rs727505150
NM_001267550.2(TTN):c.90415G>A (p.Ala30139Thr) rs397517748
NM_001267550.2(TTN):c.90536G>A (p.Arg30179His) rs149567378
NM_001267550.2(TTN):c.90587del (p.Lys30196fs) rs397517749
NM_001267550.2(TTN):c.90624T>C (p.Asn30208=) rs370479059
NM_001267550.2(TTN):c.90638T>C (p.Ile30213Thr) rs114026724
NM_001267550.2(TTN):c.90742G>A (p.Val30248Ile) rs727505024
NM_001267550.2(TTN):c.90778dup (p.Tyr30260fs) rs397517750
NM_001267550.2(TTN):c.9077A>T (p.Asn3026Ile) rs11900987
NM_001267550.2(TTN):c.90786C>T (p.Ile30262=) rs727504439
NM_001267550.2(TTN):c.90826T>G (p.Cys30276Gly) rs150430592
NM_001267550.2(TTN):c.90834T>A (p.Ser30278Arg) rs397517751
NM_001267550.2(TTN):c.90904G>A (p.Glu30302Lys) rs1553538924
NM_001267550.2(TTN):c.90950T>C (p.Val30317Ala) rs759474127
NM_001267550.2(TTN):c.90968G>A (p.Arg30323Lys) rs11887722
NM_001267550.2(TTN):c.91+14T>C rs397517777
NM_001267550.2(TTN):c.91071T>G (p.Thr30357=) rs11897366
NM_001267550.2(TTN):c.91108C>G (p.Leu30370Val) rs876658092
NM_001267550.2(TTN):c.91173A>C (p.Glu30391Asp) rs199505541
NM_001267550.2(TTN):c.91326A>G (p.Lys30442=) rs367777281
NM_001267550.2(TTN):c.91332C>T (p.Asn30444=) rs397517752
NM_001267550.2(TTN):c.91339T>C (p.Leu30447=) rs397517753
NM_001267550.2(TTN):c.91341_91343delinsTAAGTGGGTGTGA (p.Leu30447_Arg30448delinsPheLysTrpValTer) rs727505076
NM_001267550.2(TTN):c.91347T>C (p.Asp30449=) rs193022702
NM_001267550.2(TTN):c.91425C>T (p.Asp30475=) rs145133144
NM_001267550.2(TTN):c.91476T>G (p.Tyr30492Ter) rs727504646
NM_001267550.2(TTN):c.91478A>G (p.Glu30493Gly) rs397517754
NM_001267550.2(TTN):c.915-7dup rs730880351
NM_001267550.2(TTN):c.9150A>G (p.Thr3050=) rs72647886
NM_001267550.2(TTN):c.91557T>C (p.Asp30519=) rs202185465
NM_001267550.2(TTN):c.91565-13C>T rs200847757
NM_001267550.2(TTN):c.91573A>G (p.Ile30525Val) rs72648244
NM_001267550.2(TTN):c.91589C>T (p.Pro30530Leu) rs200875379
NM_001267550.2(TTN):c.91601A>T (p.Asp30534Val) rs182549226
NM_001267550.2(TTN):c.9160G>A (p.Glu3054Lys) rs397517779
NM_001267550.2(TTN):c.91621G>A (p.Gly30541Arg) rs200854704
NM_001267550.2(TTN):c.91643C>T (p.Ala30548Val) rs553668520
NM_001267550.2(TTN):c.91731C>T (p.Asp30577=) rs727505073
NM_001267550.2(TTN):c.91732G>A (p.Val30578Ile) rs727504672
NM_001267550.2(TTN):c.91765G>A (p.Ala30589Thr) rs148617456
NM_001267550.2(TTN):c.9176A>T (p.Glu3059Val) rs727504501
NM_001267550.2(TTN):c.91839dup (p.Val30614fs) rs730880365
NM_001267550.2(TTN):c.91879A>G (p.Ile30627Val) rs535151633
NM_001267550.2(TTN):c.91884A>T (p.Arg30628Ser) rs144922355
NM_001267550.2(TTN):c.91937A>G (p.Asn30646Ser) rs72648245
NM_001267550.2(TTN):c.92042C>A (p.Ala30681Asp) rs201400267
NM_001267550.2(TTN):c.92131G>A (p.Val30711Met) rs747122
NM_001267550.2(TTN):c.92176C>T (p.Pro30726Ser) rs72648247
NM_001267550.2(TTN):c.92191A>G (p.Ile30731Val) rs16866391
NM_001267550.2(TTN):c.92294G>C (p.Arg30765Thr) rs373099440
NM_001267550.2(TTN):c.92333C>G (p.Thr30778Arg) rs201019681
NM_001267550.2(TTN):c.92362G>A (p.Gly30788Ser) rs199891245
NM_001267550.2(TTN):c.92383G>A (p.Val30795Ile) rs369025866
NM_001267550.2(TTN):c.92451G>T (p.Glu30817Asp) rs397517755
NM_001267550.2(TTN):c.92455G>A (p.Val30819Ile) rs368511235
NM_001267550.2(TTN):c.92467G>A (p.Gly30823Ser) rs727504934
NM_001267550.2(TTN):c.92498C>T (p.Thr30833Ile) rs727505334
NM_001267550.2(TTN):c.92513T>A (p.Val30838Glu) rs727505344
NM_001267550.2(TTN):c.92537T>C (p.Val30846Ala) rs77968867
NM_001267550.2(TTN):c.92561T>C (p.Ile30854Thr) rs368427408
NM_001267550.2(TTN):c.92666G>A (p.Gly30889Asp) rs727505280
NM_001267550.2(TTN):c.92677A>G (p.Lys30893Glu) rs370541682
NM_001267550.2(TTN):c.92684G>A (p.Arg30895Gln) rs200141081
NM_001267550.2(TTN):c.92696T>C (p.Ile30899Thr) rs373727636
NM_001267550.2(TTN):c.92780T>A (p.Ile30927Lys) rs531432790
NM_001267550.2(TTN):c.92782G>C (p.Asp30928His) rs397517756
NM_001267550.2(TTN):c.92806G>A (p.Val30936Ile) rs200476500
NM_001267550.2(TTN):c.92901C>T (p.Ser30967=) rs11694623
NM_001267550.2(TTN):c.9290T>C (p.Leu3097Pro) rs373366126
NM_001267550.2(TTN):c.93005G>T (p.Ser31002Ile) rs180975448
NM_001267550.2(TTN):c.93101C>A (p.Thr31034Lys) rs727504875
NM_001267550.2(TTN):c.93107T>C (p.Met31036Thr) rs376942948
NM_001267550.2(TTN):c.93130G>A (p.Gly31044Ser) rs750213547
NM_001267550.2(TTN):c.93131G>T (p.Gly31044Val) rs570464905
NM_001267550.2(TTN):c.93178C>T (p.Arg31060Cys) rs750303653
NM_001267550.2(TTN):c.93182G>A (p.Arg31061His) rs727504923
NM_001267550.2(TTN):c.93243C>T (p.Ala31081=) rs3731748
NM_001267550.2(TTN):c.93292G>A (p.Val31098Ile) rs760282296
NM_001267550.2(TTN):c.93322A>G (p.Ile31108Val) rs727504787
NM_001267550.2(TTN):c.93367G>A (p.Val31123Ile) rs202096200
NM_001267550.2(TTN):c.93367G>C (p.Val31123Leu) rs202096200
NM_001267550.2(TTN):c.93387C>T (p.Ser31129=) rs35445420
NM_001267550.2(TTN):c.93444C>T (p.Tyr31148=) rs561739832
NM_001267550.2(TTN):c.93472G>C (p.Asp31158His) rs397517757
NM_001267550.2(TTN):c.93570T>C (p.Asn31190=) rs746309005
NM_001267550.2(TTN):c.9359G>A (p.Arg3120Gln) rs72647894
NM_001267550.2(TTN):c.93674T>C (p.Ile31225Thr) rs727505175
NM_001267550.2(TTN):c.9369T>G (p.Asp3123Glu) rs397517785
NM_001267550.2(TTN):c.93725G>A (p.Arg31242His) rs369899675
NM_001267550.2(TTN):c.93803A>C (p.Lys31268Thr) rs200766837
NM_001267550.2(TTN):c.9384dup (p.Val3129fs) rs727503683
NM_001267550.2(TTN):c.93897del (p.Phe31299fs) rs397517758
NM_001267550.2(TTN):c.93900C>T (p.Ser31300=) rs200173934
NM_001267550.2(TTN):c.93901G>A (p.Val31301Ile) rs67665715
NM_001267550.2(TTN):c.93968C>T (p.Ala31323Val) rs200345129
NM_001267550.2(TTN):c.93972A>G (p.Glu31324=) rs727504528
NM_001267550.2(TTN):c.93981C>G (p.Val31327=) rs370894846
NM_001267550.2(TTN):c.94020A>G (p.Glu31340=) rs547439339
NM_001267550.2(TTN):c.94045C>T (p.Arg31349Cys) rs727503549
NM_001267550.2(TTN):c.94046G>A (p.Arg31349His) rs181104321
NM_001267550.2(TTN):c.94057A>T (p.Thr31353Ser) rs727503548
NM_001267550.2(TTN):c.94180delinsTCTAGCAG (p.Pro31394fs) rs727503547
NM_001267550.2(TTN):c.94230C>T (p.Ser31410=) rs373502790
NM_001267550.2(TTN):c.94283G>A (p.Arg31428His) rs149375775
NM_001267550.2(TTN):c.94340_94343AGAA[1] (p.Lys31448fs) rs727503546
NM_001267550.2(TTN):c.9434G>A (p.Arg3145Lys) rs727503682
NM_001267550.2(TTN):c.9449G>A (p.Arg3150Gln) rs141093658
NM_001267550.2(TTN):c.94524T>C (p.Asp31508=) rs727505200
NM_001267550.2(TTN):c.94553T>C (p.Val31518Ala) rs377016580
NM_001267550.2(TTN):c.9461A>G (p.Lys3154Arg) rs4893853
NM_001267550.2(TTN):c.94623C>T (p.Tyr31541=) rs376539252
NM_001267550.2(TTN):c.94629A>G (p.Ile31543Met) rs397517759
NM_001267550.2(TTN):c.94664G>A (p.Arg31555His) rs727503545
NM_001267550.2(TTN):c.94748G>A (p.Arg31583His) rs727503544
NM_001267550.2(TTN):c.94828G>A (p.Ala31610Thr) rs141357723
NM_001267550.2(TTN):c.94846C>T (p.Leu31616=) rs72648255
NM_001267550.2(TTN):c.94851T>A (p.Asp31617Glu) rs72648256
NM_001267550.2(TTN):c.9485A>G (p.Gln3162Arg) rs727503681
NM_001267550.2(TTN):c.94863C>T (p.His31621=) rs373871146
NM_001267550.2(TTN):c.9487C>T (p.Arg3163Cys) rs140664731
NM_001267550.2(TTN):c.9488G>A (p.Arg3163His) rs149755500
NM_001267550.2(TTN):c.95035G>A (p.Asp31679Asn) rs116567963
NM_001267550.2(TTN):c.95047A>G (p.Ser31683Gly) rs72648257
NM_001267550.2(TTN):c.95068G>A (p.Val31690Met) rs727503543
NM_001267550.2(TTN):c.95078C>A (p.Ala31693Asp) rs2288326
NM_001267550.2(TTN):c.95083G>A (p.Gly31695Arg) rs376403373
NM_001267550.2(TTN):c.95094C>T (p.Ala31698=) rs373509153
NM_001267550.2(TTN):c.95130C>A (p.Gly31710=) rs727504857
NM_001267550.2(TTN):c.95148C>T (p.Thr31716=) rs140663434
NM_001267550.2(TTN):c.95149G>A (p.Val31717Ile) rs150930737
NM_001267550.2(TTN):c.9519C>T (p.Asp3173=) rs151129843
NM_001267550.2(TTN):c.95205C>T (p.Asp31735=) rs373182578
NM_001267550.2(TTN):c.95242C>T (p.Arg31748Cys) rs142525903
NM_001267550.2(TTN):c.95244C>T (p.Arg31748=) rs368243641
NM_001267550.2(TTN):c.95259C>T (p.Leu31753=) rs72648258
NM_001267550.2(TTN):c.95270T>C (p.Ile31757Thr) rs72648259
NM_001267550.2(TTN):c.95281G>A (p.Glu31761Lys) rs727505342
NM_001267550.2(TTN):c.95297C>T (p.Ser31766Phe) rs191484894
NM_001267550.2(TTN):c.95312G>A (p.Arg31771Lys) rs397517760
NM_001267550.2(TTN):c.95363A>G (p.Tyr31788Cys) rs397517761
NM_001267550.2(TTN):c.95406A>G (p.Arg31802=) rs199652273
NM_001267550.2(TTN):c.95409C>T (p.Asn31803=) rs727505040
NM_001267550.2(TTN):c.95468A>G (p.His31823Arg) rs794729539
NM_001267550.2(TTN):c.95521A>G (p.Asn31841Asp) rs794729540
NM_001267550.2(TTN):c.95543_95545AGA[2] (p.Lys31850del) rs727504556
NM_001267550.2(TTN):c.95553C>T (p.Ser31851=) rs72648260
NM_001267550.2(TTN):c.95555T>C (p.Leu31852Pro) rs62621206
NM_001267550.2(TTN):c.95557C>T (p.Arg31853Cys) rs727503542
NM_001267550.2(TTN):c.95567G>A (p.Arg31856His) rs876658093
NM_001267550.2(TTN):c.95582A>G (p.Tyr31861Cys) rs59148238
NM_001267550.2(TTN):c.95594A>T (p.Asp31865Val) rs876658094
NM_001267550.2(TTN):c.95652C>T (p.Thr31884=) rs397517762
NM_001267550.2(TTN):c.95653G>A (p.Ala31885Thr) rs72648263
NM_001267550.2(TTN):c.9571C>G (p.Gln3191Glu) rs33997263
NM_001267550.2(TTN):c.95732G>A (p.Gly31911Glu) rs778837156
NM_001267550.2(TTN):c.95744C>T (p.Ala31915Val) rs1553519431
NM_001267550.2(TTN):c.95806G>A (p.Asp31936Asn) rs267599025
NM_001267550.2(TTN):c.95848G>A (p.Glu31950Lys) rs727505199
NM_001267550.2(TTN):c.95864A>T (p.Gln31955Leu) rs552683796
NM_001267550.2(TTN):c.95923C>T (p.Leu31975Phe) rs757718784
NM_001267550.2(TTN):c.95968G>A (p.Val31990Met) rs727503541
NM_001267550.2(TTN):c.9597A>G (p.Glu3199=) rs2291312
NM_001267550.2(TTN):c.96098G>A (p.Arg32033His) rs200648462
NM_001267550.2(TTN):c.96108G>A (p.Val32036=) rs372773283
NM_001267550.2(TTN):c.96140C>T (p.Thr32047Met) rs375640847
NM_001267550.2(TTN):c.96158T>C (p.Ile32053Thr) rs62621236
NM_001267550.2(TTN):c.96173G>A (p.Arg32058Gln) rs374063064
NM_001267550.2(TTN):c.96180T>C (p.Ile32060=) rs572401798
NM_001267550.2(TTN):c.961G>A (p.Val321Ile) rs876658099
NM_001267550.2(TTN):c.96229C>T (p.Arg32077Trp) rs751316145
NM_001267550.2(TTN):c.96234C>T (p.Tyr32078=) rs376532382
NM_001267550.2(TTN):c.96235G>A (p.Asp32079Asn) rs200540781
NM_001267550.2(TTN):c.96252A>G (p.Thr32084=) rs369626133
NM_001267550.2(TTN):c.96268C>T (p.Gln32090Ter) rs876657671
NM_001267550.2(TTN):c.96286G>A (p.Ala32096Thr) rs376039623
NM_001267550.2(TTN):c.96310+11T>C rs397517764
NM_001267550.2(TTN):c.96315T>G (p.Thr32105=) rs727503540
NM_001267550.2(TTN):c.96478A>G (p.Ser32160Gly) rs727504907
NM_001267550.2(TTN):c.96499T>C (p.Ser32167Pro) rs727504889
NM_001267550.2(TTN):c.96501T>C (p.Ser32167=) rs139223781
NM_001267550.2(TTN):c.96535G>A (p.Val32179Met) rs727505082
NM_001267550.2(TTN):c.965G>A (p.Arg322Lys) rs144557211
NM_001267550.2(TTN):c.96659C>T (p.Thr32220Ile) rs727505204
NM_001267550.2(TTN):c.96684C>T (p.Tyr32228=) rs368423941
NM_001267550.2(TTN):c.9674A>G (p.Asn3225Ser) rs202011992
NM_001267550.2(TTN):c.96807A>T (p.Glu32269Asp) rs876658095
NM_001267550.2(TTN):c.9683C>G (p.Ser3228Cys) rs371249764
NM_001267550.2(TTN):c.96904+8C>T rs528358945
NM_001267550.2(TTN):c.96918C>T (p.Ile32306=) rs72648266
NM_001267550.2(TTN):c.96931A>G (p.Met32311Val) rs727504981
NM_001267550.2(TTN):c.96944C>T (p.Thr32315Ile) rs56027402
NM_001267550.2(TTN):c.96960T>C (p.Ala32320=) rs141431591
NM_001267550.2(TTN):c.96978G>A (p.Leu32326=) rs397517765
NM_001267550.2(TTN):c.96998G>A (p.Arg32333His) rs138846756
NM_001267550.2(TTN):c.9701A>G (p.Asn3234Ser) rs397517791
NM_001267550.2(TTN):c.97051G>A (p.Glu32351Lys) rs727504879
NM_001267550.2(TTN):c.97099C>T (p.Arg32367Cys) rs202064385
NM_001267550.2(TTN):c.970C>T (p.Pro324Ser) rs72647845
NM_001267550.2(TTN):c.97111A>G (p.Ile32371Val) rs397517766
NM_001267550.2(TTN):c.9713C>T (p.Pro3238Leu) rs397517792
NM_001267550.2(TTN):c.97191T>G (p.Leu32397=) rs397517767
NM_001267550.2(TTN):c.97198C>A (p.Pro32400Thr) rs373876117
NM_001267550.2(TTN):c.97204_97205delinsAG (p.Pro32402Arg) rs864622675
NM_001267550.2(TTN):c.97257T>C (p.Ile32419=) rs373206096
NM_001267550.2(TTN):c.97285G>A (p.Gly32429Ser) rs397517768
NM_001267550.2(TTN):c.97319G>A (p.Arg32440His) rs750047570
NM_001267550.2(TTN):c.97331G>A (p.Arg32444His) rs184922462
NM_001267550.2(TTN):c.97348G>A (p.Val32450Ile) rs397517769
NM_001267550.2(TTN):c.97396G>A (p.Glu32466Lys) rs55915651
NM_001267550.2(TTN):c.97418G>A (p.Arg32473His) rs397517770
NM_001267550.2(TTN):c.97433A>C (p.Asn32478Thr) rs876658096
NM_001267550.2(TTN):c.97464T>C (p.Ser32488=) rs571147766
NM_001267550.2(TTN):c.97480C>T (p.Arg32494Cys) rs727503539
NM_001267550.2(TTN):c.97488C>T (p.Ser32496=) rs727504527
NM_001267550.2(TTN):c.97490T>C (p.Ile32497Thr) rs55660660
NM_001267550.2(TTN):c.9749T>G (p.Val3250Gly) rs55634230
NM_001267550.2(TTN):c.97538G>A (p.Arg32513His) rs201080904
NM_001267550.2(TTN):c.97612C>T (p.Arg32538Cys) rs761050391
NM_001267550.2(TTN):c.97613G>A (p.Arg32538His) rs3731749
NM_001267550.2(TTN):c.97642C>T (p.Arg32548Cys) rs377599569
NM_001267550.2(TTN):c.97672C>T (p.Arg32558Trp) rs727505090
NM_001267550.2(TTN):c.97742G>T (p.Gly32581Val) rs397517771
NM_001267550.2(TTN):c.97760G>A (p.Arg32587His) rs55704830
NM_001267550.2(TTN):c.97760G>C (p.Arg32587Pro) rs55704830
NM_001267550.2(TTN):c.97795+6G>T rs3731750
NM_001267550.2(TTN):c.9781G>A (p.Val3261Met) rs2291311
NM_001267550.2(TTN):c.97859C>T (p.Ala32620Val) rs397517772
NM_001267550.2(TTN):c.9789C>T (p.Ser3263=) rs138313387
NM_001267550.2(TTN):c.98000A>G (p.Gln32667Arg) rs397517773
NM_001267550.2(TTN):c.98034T>C (p.Cys32678=) rs727504928
NM_001267550.2(TTN):c.98075C>G (p.Thr32692Arg) rs727505311
NM_001267550.2(TTN):c.98095C>T (p.Leu32699Phe) rs397517774
NM_001267550.2(TTN):c.98098+9T>A rs2288325
NM_001267550.2(TTN):c.9811T>G (p.Ser3271Ala) rs556720151
NM_001267550.2(TTN):c.98134G>T (p.Glu32712Ter) rs727504679
NM_001267550.2(TTN):c.98158G>A (p.Gly32720Ser) rs727504768
NM_001267550.2(TTN):c.98161G>A (p.Val32721Ile) rs533651182
NM_001267550.2(TTN):c.98164A>T (p.Ile32722Phe) rs72648270
NM_001267550.2(TTN):c.98203A>G (p.Ile32735Val) rs761246331
NM_001267550.2(TTN):c.9820A>C (p.Lys3274Gln) rs201696360
NM_001267550.2(TTN):c.98242C>T (p.Arg32748Cys) rs72648272
NM_001267550.2(TTN):c.98243G>A (p.Arg32748His) rs397517775
NM_001267550.2(TTN):c.98267C>T (p.Thr32756Ile) rs199805060
NM_001267550.2(TTN):c.98292A>G (p.Glu32764=) rs750078230
NM_001267550.2(TTN):c.98294C>G (p.Ala32765Gly) rs72648273
NM_001267550.2(TTN):c.98296G>T (p.Asp32766Tyr) rs727504449
NM_001267550.2(TTN):c.98299_98300del (p.Arg32767fs) rs397517776
NM_001267550.2(TTN):c.982C>T (p.Arg328Cys) rs16866538
NM_001267550.2(TTN):c.98390A>G (p.Asn32797Ser) rs149001703
NM_001267550.2(TTN):c.98439G>A (p.Val32813=) rs368487246
NM_001267550.2(TTN):c.98465A>G (p.Asp32822Gly) rs191054704
NM_001267550.2(TTN):c.98499C>T (p.Leu32833=) rs138968178
NM_001267550.2(TTN):c.98528G>A (p.Trp32843Ter) rs727504550
NM_001267550.2(TTN):c.98544C>G (p.Ser32848=) rs756591209
NM_001267550.2(TTN):c.98556T>C (p.Gly32852=) rs373853269
NM_001267550.2(TTN):c.98595A>G (p.Glu32865=) rs55977045
NM_001267550.2(TTN):c.98641C>T (p.Pro32881Ser) rs367979582
NM_001267550.2(TTN):c.98683+7G>C rs141150066
NM_001267550.2(TTN):c.98684-10A>G rs727505072
NM_001267550.2(TTN):c.9870T>C (p.Asp3290=) rs727503680
NM_001267550.2(TTN):c.98721C>A (p.Leu32907=) rs375361462
NM_001267550.2(TTN):c.98721C>T (p.Leu32907=) rs375361462
NM_001267550.2(TTN):c.98726T>C (p.Val32909Ala) rs368877793
NM_001267550.2(TTN):c.9879A>G (p.Glu3293=) rs4894043
NM_001267550.2(TTN):c.98809A>G (p.Lys32937Glu) rs200544701
NM_001267550.2(TTN):c.9884C>T (p.Thr3295Met) rs191708454
NM_001267550.2(TTN):c.98866A>G (p.Met32956Val) rs727503538
NM_001267550.2(TTN):c.98867T>C (p.Met32956Thr) rs727504962
NM_001267550.2(TTN):c.98892C>T (p.Pro32964=) rs374081262
NM_001267550.2(TTN):c.98912G>A (p.Arg32971His) rs4894028
NM_001267550.2(TTN):c.98959_98960delinsCT (p.Ser32987Leu) rs727504588
NM_001267550.2(TTN):c.98989+1G>A rs112240298
NM_001267550.2(TTN):c.98994del (p.Lys32998fs) rs727504535
NM_001267550.2(TTN):c.99031T>A (p.Ser33011Thr) rs78814506
NM_001267550.2(TTN):c.99034A>T (p.Lys33012Ter) rs771511344
NM_001267550.2(TTN):c.9908C>T (p.Pro3303Leu) rs201379132
NM_001267550.2(TTN):c.99102G>C (p.Trp33034Cys) rs397517778
NM_001267550.2(TTN):c.99111T>C (p.Tyr33037=) rs77257306
NM_001267550.2(TTN):c.99162G>A (p.Lys33054=) rs368686031
NM_001267550.2(TTN):c.99273A>G (p.Ile33091Met) rs746305727
NM_001267550.2(TTN):c.99290-6G>T rs727504987
NM_001267550.2(TTN):c.99340T>C (p.Leu33114=) rs371656672
NM_001267550.2(TTN):c.99345T>G (p.Gly33115=) rs56398525
NM_001267550.2(TTN):c.99405C>T (p.Tyr33135=) rs373722322
NM_001267550.2(TTN):c.99434G>A (p.Arg33145Gln) rs371531675
NM_001267550.2(TTN):c.99460C>T (p.Arg33154Cys) rs143556947
NM_001267550.2(TTN):c.99466C>A (p.His33156Asn) rs374666520
NM_001267550.2(TTN):c.99466C>T (p.His33156Tyr) rs374666520
NM_001267550.2(TTN):c.99517T>A (p.Cys33173Ser) rs773021609
NM_001267550.2(TTN):c.99668G>A (p.Arg33223His) rs369081242
NM_001267550.2(TTN):c.99810C>T (p.Val33270=) rs564536939
NM_001267550.2(TTN):c.99814C>T (p.Leu33272Phe) rs397517780
NM_001267550.2(TTN):c.99830G>A (p.Gly33277Glu) rs397517781
NM_001267550.2(TTN):c.99866-1G>A rs876657672
NM_001267550.2(TTN):c.9988+9G>A rs397517801
NM_001267550.2(TTN):c.99901G>A (p.Glu33301Lys) rs72648278
NM_001267550.2(TTN):c.99940C>T (p.Pro33314Ser) rs754605294
NM_001267550.2(TTN):c.99969C>T (p.Ile33323=) rs375403439
NM_001267550.2(TTN):c.99991T>C (p.Cys33331Arg) rs56061641
NM_133378.4(TTN):c.10303+2234G>A rs6433728
NM_133378.4(TTN):c.13451-7C>T rs371785683
NM_133378.4(TTN):c.14009-9A>G rs72648944
NM_133378.4(TTN):c.17672-4A>G rs72648965
NM_133378.4(TTN):c.19367-15_19367-11dup rs876658044
NM_133378.4(TTN):c.2076G>T
NM_133378.4(TTN):c.22468+5G>A rs727503645
NM_133378.4(TTN):c.26492-8T>G rs72650010
NM_133378.4(TTN):c.28030+4C>T rs368538884
NM_133378.4(TTN):c.28990+9G>A rs148231130
NM_133378.4(TTN):c.29608+10T>C rs72650039
NM_133378.4(TTN):c.31825+10A>C rs397517554
NM_133378.4(TTN):c.32854+1G>A rs368219776
NM_133378.4(TTN):c.37379-10A>G rs72677222
NM_133378.4(TTN):c.40756+8C>T rs2288565
NM_133378.4(TTN):c.41829-13G>A
NM_133378.4(TTN):c.45877G>A
NM_133378.4(TTN):c.47178A>C
NM_133378.4(TTN):c.47599-10C>G
NM_133378.4(TTN):c.51070A>G
NM_133378.4(TTN):c.51640+3G>A rs142095604
NM_133378.4(TTN):c.52301A>G rs199512049
NM_133378.4(TTN):c.62012-5C>G rs72646886
NM_133378.4(TTN):c.73246G>T
NM_133378.4(TTN):c.74821C>T
NM_133378.4(TTN):c.80003-4G>T rs201770959
NM_133378.4(TTN):c.84148+8T>A rs56145100
NM_133378.4(TTN):c.87965G>T
NM_133378.4(TTN):c.96125G>A
NM_133378.4(TTN):c.97243C>T
NM_133378.4(TTN):c.[45418A>G;45419A>T]
NM_133378.4(TTN):c.[68689_68692delAACA;98315delG]