ClinVar Miner

List of variants in gene TTN reported as likely benign by GeneDx

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 2224
Download table as spreadsheet
HGVS dbSNP
NC_000002.12:g.178584654del
NC_000002.12:g.178644816_178644819del
NC_000002.12:g.178652190_178652192del
NC_000002.12:g.178680243del
NC_000002.12:g.178689900dup
NC_000002.12:g.178700829_178700831del
NC_000002.12:g.178782191_178782192del
NM_001256850.1(TTN):c.102758-21_102758-18delTTTT rs148707308
NM_001256850.1(TTN):c.13141+20delA rs560021681
NM_001256850.1(TTN):c.15104-16_15104-14delCTT rs1064795240
NM_001256850.1(TTN):c.15671-9C>T rs752362183
NM_001256850.1(TTN):c.18197-4A>G rs1025136671
NM_001256850.1(TTN):c.2076+13_2076+15delGTT rs777562481
NM_001256850.1(TTN):c.21578-7C>A rs769076842
NM_001256850.1(TTN):c.22709-7C>T rs771244164
NM_001256850.1(TTN):c.24400+20delC rs749062982
NM_001256850.1(TTN):c.2493+6_2493+8delAAG rs1238359547
NM_001256850.1(TTN):c.26099-9delT rs888604866
NM_001256850.1(TTN):c.26657-21_26657-18delGATT rs760040610
NM_001256850.1(TTN):c.29273-7T>G rs778458915
NM_001256850.1(TTN):c.30475+4_30475+5delTA rs763616324
NM_001256850.1(TTN):c.31604-6T>C rs375742678
NM_001256850.1(TTN):c.32222-4G>A rs727504440
NM_001256850.1(TTN):c.33586+8C>A rs762808097
NM_001256850.1(TTN):c.33733+9_33733+11delTCT rs1196572661
NM_001256850.1(TTN):c.34106-9T>A rs537626868
NM_001256850.1(TTN):c.34523-784T>C rs200819643
NM_001256850.1(TTN):c.35188+9G>C rs765647346
NM_001256850.1(TTN):c.35189-4A>G rs781589169
NM_001256850.1(TTN):c.35711-10T>A rs375097334
NM_001256850.1(TTN):c.36005-12_36005-8delACTTT rs1064795940
NM_001256850.1(TTN):c.39359-6G>A rs372166634
NM_001256850.1(TTN):c.40160-19_40160-15delGTTTT rs781409618
NM_001256850.1(TTN):c.45935-9A>C rs146208555
NM_001256850.1(TTN):c.52340-4C>T rs373552048
NM_001256850.1(TTN):c.52622-11_52622-9delCTT rs767743244
NM_001256850.1(TTN):c.54703+7delA rs766734794
NM_001256850.1(TTN):c.54704-10C>T rs775224600
NM_001256850.1(TTN):c.55004-10_55004-8delCTT rs1338225091
NM_001256850.1(TTN):c.60050-4C>G rs369934310
NM_001256850.1(TTN):c.60352+20delT rs747219831
NM_001256850.1(TTN):c.60653-15_60653-11delCTTAT rs1064795987
NM_001256850.1(TTN):c.63407-11delG rs1004563596
NM_001256850.1(TTN):c.63604+10_63604+12delTAT rs762941263
NM_001256850.1(TTN):c.83383+8T>C rs369690199
NM_001256850.1(TTN):c.8902+12_8902+13delAA rs774238749
NM_001256850.1(TTN):c.93175+3G>A rs556524594
NM_001256850.1:c.2775+4G>A
NM_001256850.1:c.31360+9T>C
NM_001256850.1:c.33664+8A>G
NM_001256850.1:c.34265-615G>A
NM_001256850.1:c.34522+858T>C
NM_001256850.1:c.34523-337C>T
NM_001256850.1:c.4646-7C>A
NM_001256850.1:c.583+4C>T
NM_001256850.1:c.92873-10T>C
NM_001267550.1(TTN):c.45599C>G rs201057307
NM_001267550.1(TTN):c.83315A>T rs578191491
NM_001267550.2(TTN):c.100044G>A (p.Val33348=) rs56080118
NM_001267550.2(TTN):c.100049C>T (p.Thr33350Ile) rs370300135
NM_001267550.2(TTN):c.100093C>T (p.Arg33365Trp) rs543226487
NM_001267550.2(TTN):c.100116C>T (p.Phe33372=) rs770089807
NM_001267550.2(TTN):c.1001C>A (p.Thr334Asn) rs1042860959
NM_001267550.2(TTN):c.100257T>C (p.Asp33419=) rs727505046
NM_001267550.2(TTN):c.10049C>T (p.Pro3350Leu) rs139504522
NM_001267550.2(TTN):c.10050G>A (p.Pro3350=) rs759936737
NM_001267550.2(TTN):c.100578C>T (p.Ile33526=) rs764709619
NM_001267550.2(TTN):c.100653C>A (p.Gly33551=) rs727505326
NM_001267550.2(TTN):c.100696A>G (p.Thr33566Ala) rs878854282
NM_001267550.2(TTN):c.10088G>A (p.Arg3363His) rs148169214
NM_001267550.2(TTN):c.100982G>A (p.Arg33661Lys) rs201857158
NM_001267550.2(TTN):c.101055T>C (p.Asp33685=) rs372788551
NM_001267550.2(TTN):c.10115-17T>G rs932815761
NM_001267550.2(TTN):c.101245G>A (p.Val33749Met) rs201554140
NM_001267550.2(TTN):c.101262A>G (p.Gly33754=) rs374878689
NM_001267550.2(TTN):c.101291C>T (p.Ala33764Val) rs773542514
NM_001267550.2(TTN):c.101391T>C (p.Asp33797=) rs374228740
NM_001267550.2(TTN):c.101409C>T (p.Ser33803=) rs1387260088
NM_001267550.2(TTN):c.101546T>C (p.Phe33849Ser) rs1434361992
NM_001267550.2(TTN):c.101565T>G (p.Thr33855=) rs1553498268
NM_001267550.2(TTN):c.10162C>T (p.Arg3388Trp)
NM_001267550.2(TTN):c.101637T>C (p.His33879=) rs373461875
NM_001267550.2(TTN):c.101684T>C (p.Ile33895Thr)
NM_001267550.2(TTN):c.101692C>T (p.Leu33898Phe) rs371930491
NM_001267550.2(TTN):c.101708G>A (p.Arg33903His) rs72629782
NM_001267550.2(TTN):c.101728G>A (p.Glu33910Lys)
NM_001267550.2(TTN):c.101890C>A (p.Arg33964Ser) rs779064623
NM_001267550.2(TTN):c.101925A>G (p.Leu33975=) rs201246720
NM_001267550.2(TTN):c.101936C>G (p.Pro33979Arg) rs200238877
NM_001267550.2(TTN):c.102064C>G (p.Gln34022Glu)
NM_001267550.2(TTN):c.102103G>A (p.Asp34035Asn) rs144963736
NM_001267550.2(TTN):c.102156G>T (p.Arg34052=) rs376894729
NM_001267550.2(TTN):c.102183C>T (p.Arg34061=) rs727504536
NM_001267550.2(TTN):c.102217T>C (p.Leu34073=)
NM_001267550.2(TTN):c.102293T>A (p.Ile34098Asn)
NM_001267550.2(TTN):c.102363G>A (p.Lys34121=) rs758224214
NM_001267550.2(TTN):c.10244C>T (p.Thr3415Met) rs761799688
NM_001267550.2(TTN):c.102520G>A (p.Val34174Ile) rs200430493
NM_001267550.2(TTN):c.102561C>T (p.Tyr34187=) rs375625664
NM_001267550.2(TTN):c.102562G>A (p.Glu34188Lys) rs577667352
NM_001267550.2(TTN):c.102603A>G (p.Lys34201=) rs1414951574
NM_001267550.2(TTN):c.102609T>C (p.Asp34203=) rs879218563
NM_001267550.2(TTN):c.102657T>A (p.Ser34219Arg) rs370077023
NM_001267550.2(TTN):c.102737G>A (p.Arg34246His) rs372716177
NM_001267550.2(TTN):c.102751A>G (p.Met34251Val) rs56173891
NM_001267550.2(TTN):c.102877A>G (p.Lys34293Glu) rs72629783
NM_001267550.2(TTN):c.102882A>G (p.Ser34294=) rs373384005
NM_001267550.2(TTN):c.10288A>C (p.Asn3430His) rs376029089
NM_001267550.2(TTN):c.102965G>A (p.Ser34322Asn) rs763242057
NM_001267550.2(TTN):c.102966T>C (p.Ser34322=) rs200172231
NM_001267550.2(TTN):c.102984C>T (p.Asp34328=) rs541125667
NM_001267550.2(TTN):c.10304-207G>A
NM_001267550.2(TTN):c.103207C>T (p.Leu34403=) rs773892755
NM_001267550.2(TTN):c.103236C>T (p.Ile34412=) rs745465328
NM_001267550.2(TTN):c.103263G>A (p.Leu34421=) rs1057521288
NM_001267550.2(TTN):c.103267A>G (p.Ile34423Val)
NM_001267550.2(TTN):c.103292C>T (p.Thr34431Met) rs192001910
NM_001267550.2(TTN):c.103302T>C (p.Tyr34434=) rs773408387
NM_001267550.2(TTN):c.103365C>T (p.Arg34455=) rs398124462
NM_001267550.2(TTN):c.103417G>A (p.Val34473Ile) rs188917199
NM_001267550.2(TTN):c.103514A>T (p.Glu34505Val) rs761105256
NM_001267550.2(TTN):c.103576G>C (p.Glu34526Gln) rs770742837
NM_001267550.2(TTN):c.103686C>T (p.Phe34562=) rs777864853
NM_001267550.2(TTN):c.103688T>C (p.Val34563Ala) rs55945684
NM_001267550.2(TTN):c.103713T>C (p.Tyr34571=) rs1057523313
NM_001267550.2(TTN):c.103772G>A (p.Arg34591Gln) rs778021095
NM_001267550.2(TTN):c.103913G>A (p.Arg34638His) rs371528685
NM_001267550.2(TTN):c.103914T>C (p.Arg34638=)
NM_001267550.2(TTN):c.103968G>C (p.Gly34656=) rs1057523617
NM_001267550.2(TTN):c.104049T>C (p.Leu34683=) rs1553489508
NM_001267550.2(TTN):c.104093G>A (p.Arg34698Gln) rs757940030
NM_001267550.2(TTN):c.104106C>G (p.His34702Gln) rs1168028409
NM_001267550.2(TTN):c.104202A>G (p.Pro34734=) rs777542393
NM_001267550.2(TTN):c.104261C>T (p.Ala34754Val) rs727505020
NM_001267550.2(TTN):c.104277G>A (p.Lys34759=) rs377391143
NM_001267550.2(TTN):c.104298T>C (p.Ala34766=) rs751788327
NM_001267550.2(TTN):c.104328A>C (p.Pro34776=)
NM_001267550.2(TTN):c.104333C>A (p.Thr34778Lys) rs762158917
NM_001267550.2(TTN):c.104334G>A (p.Thr34778=) rs550108694
NM_001267550.2(TTN):c.104364C>T (p.Ser34788=) rs181679744
NM_001267550.2(TTN):c.104365G>A (p.Glu34789Lys) rs190565627
NM_001267550.2(TTN):c.104385G>A (p.Lys34795=) rs397517790
NM_001267550.2(TTN):c.104414G>A (p.Arg34805Gln) rs115150240
NM_001267550.2(TTN):c.104449G>A (p.Glu34817Lys) rs1553488312
NM_001267550.2(TTN):c.104516G>A (p.Arg34839Gln)
NM_001267550.2(TTN):c.104581C>T (p.Arg34861Cys) rs398124463
NM_001267550.2(TTN):c.104605G>A (p.Glu34869Lys) rs563430855
NM_001267550.2(TTN):c.104640G>A (p.Glu34880=) rs373134178
NM_001267550.2(TTN):c.104774A>C (p.Glu34925Ala) rs201218828
NM_001267550.2(TTN):c.104812C>T (p.Leu34938=) rs755726554
NM_001267550.2(TTN):c.104978C>T (p.Thr34993Met) rs368945564
NM_001267550.2(TTN):c.105006G>A (p.Leu35002=) rs1320843432
NM_001267550.2(TTN):c.105090C>T (p.Asp35030=) rs72629789
NM_001267550.2(TTN):c.1050C>T (p.Tyr350=) rs375448572
NM_001267550.2(TTN):c.105127C>T (p.Arg35043Cys) rs200378865
NM_001267550.2(TTN):c.105183G>A (p.Ala35061=) rs371075036
NM_001267550.2(TTN):c.105210A>G (p.Thr35070=) rs1553486016
NM_001267550.2(TTN):c.105212C>G (p.Ser35071Cys) rs3813249
NM_001267550.2(TTN):c.105336G>A (p.Lys35112=) rs546048021
NM_001267550.2(TTN):c.105383C>T (p.Ala35128Val) rs758458467
NM_001267550.2(TTN):c.105404C>T (p.Pro35135Leu)
NM_001267550.2(TTN):c.105406C>T (p.Arg35136Trp) rs372875128
NM_001267550.2(TTN):c.105412A>G (p.Met35138Val) rs368992068
NM_001267550.2(TTN):c.105413T>C (p.Met35138Thr) rs771741670
NM_001267550.2(TTN):c.105424G>A (p.Glu35142Lys)
NM_001267550.2(TTN):c.105653T>C (p.Ile35218Thr) rs143499441
NM_001267550.2(TTN):c.105719G>A (p.Arg35240Gln) rs530537991
NM_001267550.2(TTN):c.105737C>G (p.Ala35246Gly) rs370476812
NM_001267550.2(TTN):c.105780C>T (p.His35260=) rs373486593
NM_001267550.2(TTN):c.105787_105788delinsTT (p.Ala35263Phe) rs794729250
NM_001267550.2(TTN):c.105790G>A (p.Val35264Ile) rs770730954
NM_001267550.2(TTN):c.105876G>A (p.Leu35292=) rs372521529
NM_001267550.2(TTN):c.105920T>C (p.Val35307Ala) rs780629996
NM_001267550.2(TTN):c.106087G>C (p.Gly35363Arg)
NM_001267550.2(TTN):c.106121T>A (p.Phe35374Tyr) rs727504609
NM_001267550.2(TTN):c.106127G>C (p.Gly35376Ala) rs752758517
NM_001267550.2(TTN):c.106133C>T (p.Ala35378Val) rs555476312
NM_001267550.2(TTN):c.106143T>C (p.Ser35381=) rs961119478
NM_001267550.2(TTN):c.106343G>A (p.Arg35448Gln) rs369703073
NM_001267550.2(TTN):c.106442A>G (p.Lys35481Arg) rs200716018
NM_001267550.2(TTN):c.106532-19del
NM_001267550.2(TTN):c.106532-266C>T
NM_001267550.2(TTN):c.106580A>T (p.Glu35527Val) rs55725279
NM_001267550.2(TTN):c.106675G>C (p.Glu35559Gln) rs199632397
NM_001267550.2(TTN):c.106955G>A (p.Arg35652Gln) rs200497615
NM_001267550.2(TTN):c.107080C>G (p.Leu35694Val) rs769369764
NM_001267550.2(TTN):c.107089G>C (p.Glu35697Gln) rs199531140
NM_001267550.2(TTN):c.107092C>T (p.Leu35698Phe) rs1435670489
NM_001267550.2(TTN):c.107097A>C (p.Ser35699=) rs771821464
NM_001267550.2(TTN):c.107134A>C (p.Asn35712His) rs727504949
NM_001267550.2(TTN):c.107161T>C (p.Phe35721Leu) rs794729251
NM_001267550.2(TTN):c.107230A>G (p.Ile35744Val) rs142336788
NM_001267550.2(TTN):c.107289T>C (p.Asn35763=)
NM_001267550.2(TTN):c.107301C>A (p.Ser35767Arg) rs1558965303
NM_001267550.2(TTN):c.107319A>C (p.Thr35773=) rs1553479126
NM_001267550.2(TTN):c.107364C>T (p.Ser35788=) rs1057521273
NM_001267550.2(TTN):c.107377+14C>T rs367908657
NM_001267550.2(TTN):c.107591T>C (p.Val35864Ala) rs374859388
NM_001267550.2(TTN):c.107593G>A (p.Glu35865Lys) rs372841288
NM_001267550.2(TTN):c.107605A>G (p.Ser35869Gly) rs201835888
NM_001267550.2(TTN):c.107647T>G (p.Ser35883Ala) rs1553477432
NM_001267550.2(TTN):c.107657A>G (p.Lys35886Arg) rs727504465
NM_001267550.2(TTN):c.107680+19G>A rs771282051
NM_001267550.2(TTN):c.107688G>A (p.Pro35896=) rs542575761
NM_001267550.2(TTN):c.107753G>A (p.Cys35918Tyr) rs193212275
NM_001267550.2(TTN):c.107766T>C (p.Gly35922=) rs147293964
NM_001267550.2(TTN):c.11255-7A>G
NM_001267550.2(TTN):c.11311+1350G>T rs370206902
NM_001267550.2(TTN):c.11311+1994C>G rs777777663
NM_001267550.2(TTN):c.11311+213T>C
NM_001267550.2(TTN):c.11311+2573T>C rs72647897
NM_001267550.2(TTN):c.11311+2649G>A rs562072193
NM_001267550.2(TTN):c.11311+3137A>C rs781665805
NM_001267550.2(TTN):c.11311+3423T>C rs185931752
NM_001267550.2(TTN):c.11311+3483T>C rs772354003
NM_001267550.2(TTN):c.11311+4088A>G rs142304137
NM_001267550.2(TTN):c.11311+4523A>C rs200760091
NM_001267550.2(TTN):c.11311+4672C>T rs149748934
NM_001267550.2(TTN):c.11311+860A>G
NM_001267550.2(TTN):c.11312-3593G>A
NM_001267550.2(TTN):c.11312-3877G>A rs141624211
NM_001267550.2(TTN):c.11312-5199A>C rs141105907
NM_001267550.2(TTN):c.11312-5363A>G rs1322304017
NM_001267550.2(TTN):c.11312-5534C>G
NM_001267550.2(TTN):c.11338G>A (p.Glu3780Lys) rs727504586
NM_001267550.2(TTN):c.11391A>G (p.Thr3797=) rs373708340
NM_001267550.2(TTN):c.11392C>T (p.Leu3798Phe) rs370110992
NM_001267550.2(TTN):c.11440G>A (p.Glu3814Lys) rs375103237
NM_001267550.2(TTN):c.11475A>G (p.Glu3825=) rs1057523983
NM_001267550.2(TTN):c.11499G>A (p.Met3833Ile) rs756868500
NM_001267550.2(TTN):c.11565T>A (p.Phe3855Leu)
NM_001267550.2(TTN):c.11583C>T (p.Thr3861=) rs11899887
NM_001267550.2(TTN):c.11614G>A (p.Gly3872Ser) rs754936734
NM_001267550.2(TTN):c.1161C>T (p.Thr387=) rs753484667
NM_001267550.2(TTN):c.11672C>T (p.Thr3891Ile) rs148164929
NM_001267550.2(TTN):c.11756C>A (p.Thr3919Asn) rs727503661
NM_001267550.2(TTN):c.11788G>A (p.Glu3930Lys) rs186624523
NM_001267550.2(TTN):c.11811T>C (p.Pro3937=) rs571602215
NM_001267550.2(TTN):c.11842C>T (p.Arg3948Cys) rs397517827
NM_001267550.2(TTN):c.11856G>T (p.Gly3952=) rs1057524094
NM_001267550.2(TTN):c.1185C>T (p.Ala395=) rs372346898
NM_001267550.2(TTN):c.11902A>G (p.Thr3968Ala)
NM_001267550.2(TTN):c.11959A>G (p.Ile3987Val) rs551387805
NM_001267550.2(TTN):c.11996A>G (p.Asn3999Ser) rs199844346
NM_001267550.2(TTN):c.12024C>T (p.Leu4008=) rs371694842
NM_001267550.2(TTN):c.12049T>G (p.Leu4017Val) rs367635055
NM_001267550.2(TTN):c.12078G>A (p.Leu4026=) rs926556907
NM_001267550.2(TTN):c.1212C>T (p.Tyr404=) rs139187345
NM_001267550.2(TTN):c.12145C>T (p.Pro4049Ser) rs201888760
NM_001267550.2(TTN):c.12181G>A (p.Ala4061Thr) rs397517829
NM_001267550.2(TTN):c.12195T>C (p.Leu4065=) rs201129413
NM_001267550.2(TTN):c.12276A>G (p.Leu4092=) rs1553940209
NM_001267550.2(TTN):c.12294T>C (p.Ala4098=) rs1386491689
NM_001267550.2(TTN):c.12332C>G (p.Ala4111Gly) rs140289517
NM_001267550.2(TTN):c.12401T>A (p.Ile4134Asn) rs112009206
NM_001267550.2(TTN):c.12405T>C (p.Asn4135=) rs767823868
NM_001267550.2(TTN):c.12446A>G (p.Asn4149Ser) rs768083269
NM_001267550.2(TTN):c.1245+15G>A rs778180261
NM_001267550.2(TTN):c.1245+20G>T rs371234481
NM_001267550.2(TTN):c.1246-14C>T rs753427490
NM_001267550.2(TTN):c.12498T>C (p.Ile4166=) rs756194386
NM_001267550.2(TTN):c.12547A>G (p.Lys4183Glu) rs201565932
NM_001267550.2(TTN):c.12653T>C (p.Ile4218Thr) rs374631591
NM_001267550.2(TTN):c.12679A>T (p.Thr4227Ser) rs1553939161
NM_001267550.2(TTN):c.12721G>A (p.Val4241Ile) rs1553939072
NM_001267550.2(TTN):c.12733A>C (p.Asn4245His) rs199652066
NM_001267550.2(TTN):c.12741G>A (p.Glu4247=) rs879121745
NM_001267550.2(TTN):c.12743A>C (p.Gln4248Pro) rs770583611
NM_001267550.2(TTN):c.12748G>A (p.Val4250Met) rs201437752
NM_001267550.2(TTN):c.12873C>G (p.Val4291=) rs747114179
NM_001267550.2(TTN):c.1288G>A (p.Val430Ile) rs371639583
NM_001267550.2(TTN):c.12955G>A (p.Ala4319Thr)
NM_001267550.2(TTN):c.12956C>T (p.Ala4319Val)
NM_001267550.2(TTN):c.12986G>A (p.Arg4329Lys) rs199560188
NM_001267550.2(TTN):c.13044C>T (p.Asn4348=) rs879161892
NM_001267550.2(TTN):c.13048G>A (p.Val4350Met) rs781206839
NM_001267550.2(TTN):c.13071T>G (p.Ile4357Met) rs1553938053
NM_001267550.2(TTN):c.13090G>A (p.Val4364Met) rs201506104
NM_001267550.2(TTN):c.13202G>A (p.Arg4401Gln) rs200431386
NM_001267550.2(TTN):c.13213G>A (p.Ala4405Thr) rs794729253
NM_001267550.2(TTN):c.13227C>T (p.Ser4409=) rs571473566
NM_001267550.2(TTN):c.13262A>G (p.Asn4421Ser) rs72648922
NM_001267550.2(TTN):c.1332C>T (p.Ser444=) rs759520186
NM_001267550.2(TTN):c.1333G>A (p.Ala445Thr) rs142414432
NM_001267550.2(TTN):c.13340C>T (p.Ser4447Leu) rs777547090
NM_001267550.2(TTN):c.13361A>G (p.Glu4454Gly)
NM_001267550.2(TTN):c.13446T>C (p.Tyr4482=)
NM_001267550.2(TTN):c.13458C>T (p.Asp4486=) rs748885610
NM_001267550.2(TTN):c.13499A>G (p.Lys4500Arg) rs727503655
NM_001267550.2(TTN):c.13518A>G (p.Glu4506=) rs764376907
NM_001267550.2(TTN):c.13520T>C (p.Met4507Thr) rs191968963
NM_001267550.2(TTN):c.13584T>C (p.Tyr4528=) rs780863409
NM_001267550.2(TTN):c.13641G>A (p.Leu4547=) rs768023034
NM_001267550.2(TTN):c.1365G>A (p.Thr455=) rs145211131
NM_001267550.2(TTN):c.13689C>T (p.Asp4563=) rs369466156
NM_001267550.2(TTN):c.13700A>G (p.Asp4567Gly) rs745641339
NM_001267550.2(TTN):c.13701T>G (p.Asp4567Glu) rs200422152
NM_001267550.2(TTN):c.13786G>T (p.Ala4596Ser) rs1308710134
NM_001267550.2(TTN):c.13819A>G (p.Met4607Val) rs371275648
NM_001267550.2(TTN):c.13884C>T (p.Ser4628=) rs183328495
NM_001267550.2(TTN):c.13899A>G (p.Lys4633=) rs539117866
NM_001267550.2(TTN):c.13908T>C (p.Asn4636=) rs1553936091
NM_001267550.2(TTN):c.1398+12G>C rs1033605445
NM_001267550.2(TTN):c.1398+216_1398+237dup
NM_001267550.2(TTN):c.1398+4C>T rs368548209
NM_001267550.2(TTN):c.13G>A (p.Ala5Thr) rs552620474
NM_001267550.2(TTN):c.14002A>G (p.Thr4668Ala) rs758920941
NM_001267550.2(TTN):c.14093-16C>T rs1057523430
NM_001267550.2(TTN):c.14136A>C (p.Ala4712=) rs370115946
NM_001267550.2(TTN):c.14232C>T (p.Asp4744=)
NM_001267550.2(TTN):c.14235G>A (p.Lys4745=) rs756868442
NM_001267550.2(TTN):c.14302G>A (p.Gly4768Ser) rs727503652
NM_001267550.2(TTN):c.14372-73G>A
NM_001267550.2(TTN):c.14410C>G (p.Leu4804Val) rs1553932306
NM_001267550.2(TTN):c.14451A>G (p.Thr4817=) rs370621465
NM_001267550.2(TTN):c.1449C>T (p.Ala483=) rs141617218
NM_001267550.2(TTN):c.1450G>A (p.Asp484Asn) rs768211726
NM_001267550.2(TTN):c.14532C>T (p.Ser4844=) rs977012928
NM_001267550.2(TTN):c.14535C>T (p.Asp4845=) rs184307461
NM_001267550.2(TTN):c.14662C>G (p.Pro4888Ala) rs376799249
NM_001267550.2(TTN):c.14697C>T (p.Ser4899=) rs372740215
NM_001267550.2(TTN):c.14721T>C (p.Leu4907=) rs1470683370
NM_001267550.2(TTN):c.14759C>T (p.Thr4920Met) rs371455094
NM_001267550.2(TTN):c.14788C>A (p.Pro4930Thr) rs201744218
NM_001267550.2(TTN):c.14830A>G (p.Thr4944Ala) rs1479138931
NM_001267550.2(TTN):c.14869A>C (p.Thr4957Pro) rs780405420
NM_001267550.2(TTN):c.14898T>C (p.Ala4966=) rs370105333
NM_001267550.2(TTN):c.14935+14G>A rs1553931045
NM_001267550.2(TTN):c.14936-220T>G
NM_001267550.2(TTN):c.14998C>T (p.Arg5000Cys) rs369933152
NM_001267550.2(TTN):c.15003C>G (p.Leu5001=) rs1430516736
NM_001267550.2(TTN):c.15006T>C (p.His5002=) rs771278620
NM_001267550.2(TTN):c.15032T>C (p.Ile5011Thr) rs794729607
NM_001267550.2(TTN):c.1506G>A (p.Lys502=) rs757142612
NM_001267550.2(TTN):c.15086G>A (p.Arg5029Gln) rs200792058
NM_001267550.2(TTN):c.15150G>T (p.Gly5050=)
NM_001267550.2(TTN):c.15185G>A (p.Ser5062Asn) rs371687650
NM_001267550.2(TTN):c.1521C>T (p.His507=) rs372875660
NM_001267550.2(TTN):c.15333C>T (p.Asp5111=) rs368695667
NM_001267550.2(TTN):c.1537-18T>C rs1057520497
NM_001267550.2(TTN):c.1537-53T>G
NM_001267550.2(TTN):c.15388G>A (p.Val5130Met)
NM_001267550.2(TTN):c.15430G>A (p.Glu5144Lys) rs766612317
NM_001267550.2(TTN):c.15542G>C (p.Gly5181Ala) rs201185434
NM_001267550.2(TTN):c.15544G>A (p.Gly5182Arg) rs775552018
NM_001267550.2(TTN):c.15552C>T (p.Thr5184=) rs146353237
NM_001267550.2(TTN):c.15625A>C (p.Arg5209=) rs1392727449
NM_001267550.2(TTN):c.15659A>G (p.Asn5220Ser)
NM_001267550.2(TTN):c.15775+14C>T rs151057960
NM_001267550.2(TTN):c.15775+15A>C rs776801864
NM_001267550.2(TTN):c.15775+22C>T
NM_001267550.2(TTN):c.15775+8T>C rs371673901
NM_001267550.2(TTN):c.15822A>T (p.Ala5274=) rs779456916
NM_001267550.2(TTN):c.1584C>T (p.Ser528=) rs267599093
NM_001267550.2(TTN):c.15860C>T (p.Thr5287Met) rs148551876
NM_001267550.2(TTN):c.15861G>A (p.Thr5287=) rs370299812
NM_001267550.2(TTN):c.15956A>C (p.Lys5319Thr) rs779733584
NM_001267550.2(TTN):c.15972G>A (p.Glu5324=) rs1057522988
NM_001267550.2(TTN):c.15986G>A (p.Gly5329Asp) rs202234492
NM_001267550.2(TTN):c.16078A>G (p.Thr5360Ala) rs749081117
NM_001267550.2(TTN):c.16113T>C (p.Asn5371=) rs143845692
NM_001267550.2(TTN):c.16126C>A (p.Leu5376Met) rs72648936
NM_001267550.2(TTN):c.16157T>C (p.Met5386Thr) rs375417155
NM_001267550.2(TTN):c.1616T>A (p.Ile539Asn) rs774503024
NM_001267550.2(TTN):c.16313A>G (p.Lys5438Arg) rs190636272
NM_001267550.2(TTN):c.16339C>A (p.Gln5447Lys) rs1390008275
NM_001267550.2(TTN):c.16477G>A (p.Gly5493Ser) rs377042940
NM_001267550.2(TTN):c.16515T>C (p.Ser5505=) rs201625116
NM_001267550.2(TTN):c.16546G>T (p.Asp5516Tyr) rs72648940
NM_001267550.2(TTN):c.16581C>T (p.Val5527=) rs373179717
NM_001267550.2(TTN):c.1662+42A>G
NM_001267550.2(TTN):c.1662+6T>A rs1057520818
NM_001267550.2(TTN):c.16621+8T>C rs1057524119
NM_001267550.2(TTN):c.16661T>G (p.Leu5554Arg)
NM_001267550.2(TTN):c.16716A>G (p.Pro5572=) rs367821526
NM_001267550.2(TTN):c.16738A>G (p.Asn5580Asp) rs376598696
NM_001267550.2(TTN):c.16751T>A (p.Ile5584Asn) rs779652311
NM_001267550.2(TTN):c.16790C>T (p.Ser5597Phe) rs754116386
NM_001267550.2(TTN):c.16891G>A (p.Val5631Ile)
NM_001267550.2(TTN):c.16956C>T (p.Tyr5652=) rs755186242
NM_001267550.2(TTN):c.16959T>C (p.Asp5653=) rs770260995
NM_001267550.2(TTN):c.16964T>C (p.Met5655Thr) rs886044306
NM_001267550.2(TTN):c.17082G>T (p.Leu5694=) rs750996600
NM_001267550.2(TTN):c.1709C>T (p.Ala570Val) rs146690035
NM_001267550.2(TTN):c.17115C>T (p.Gly5705=) rs370036981
NM_001267550.2(TTN):c.17129G>A (p.Arg5710Gln) rs200018866
NM_001267550.2(TTN):c.17183-5G>A rs1553924621
NM_001267550.2(TTN):c.17228G>A (p.Arg5743Gln) rs753892271
NM_001267550.2(TTN):c.17300G>A (p.Ser5767Asn) rs200692495
NM_001267550.2(TTN):c.17356A>C (p.Ser5786Arg) rs745386654
NM_001267550.2(TTN):c.17478C>T (p.Thr5826=) rs376968974
NM_001267550.2(TTN):c.17488G>A (p.Val5830Met)
NM_001267550.2(TTN):c.1748C>T (p.Ala583Val) rs772836198
NM_001267550.2(TTN):c.17740+17T>C rs369532031
NM_001267550.2(TTN):c.17741-6G>A rs748443352
NM_001267550.2(TTN):c.17806A>G (p.Ile5936Val) rs72648945
NM_001267550.2(TTN):c.17833T>G (p.Ser5945Ala) rs776790387
NM_001267550.2(TTN):c.17893T>C (p.Tyr5965His) rs752226947
NM_001267550.2(TTN):c.1800+10T>C rs767071465
NM_001267550.2(TTN):c.18029-9T>C
NM_001267550.2(TTN):c.18075C>T (p.Pro6025=) rs557350005
NM_001267550.2(TTN):c.180T>C (p.Asp60=) rs144750850
NM_001267550.2(TTN):c.18172C>T (p.Arg6058Cys) rs189127014
NM_001267550.2(TTN):c.18249T>C (p.Ile6083=) rs1057522780
NM_001267550.2(TTN):c.18267T>A (p.Asp6089Glu)
NM_001267550.2(TTN):c.18307+12A>G rs376899412
NM_001267550.2(TTN):c.18307+13C>T rs201930482
NM_001267550.2(TTN):c.1830A>G (p.Val610=)
NM_001267550.2(TTN):c.18325A>G (p.Lys6109Glu) rs73973139
NM_001267550.2(TTN):c.1834A>G (p.Lys612Glu) rs727505256
NM_001267550.2(TTN):c.18363G>A (p.Gln6121=) rs375032616
NM_001267550.2(TTN):c.18379T>G (p.Cys6127Gly) rs370812788
NM_001267550.2(TTN):c.18407G>A (p.Arg6136Gln) rs117551279
NM_001267550.2(TTN):c.18437T>C (p.Ile6146Thr)
NM_001267550.2(TTN):c.18470T>C (p.Ile6157Thr) rs371882162
NM_001267550.2(TTN):c.18550G>A (p.Ala6184Thr) rs72648947
NM_001267550.2(TTN):c.18557C>T (p.Thr6186Met) rs200359082
NM_001267550.2(TTN):c.18590-14T>G rs781455893
NM_001267550.2(TTN):c.18645C>T (p.Asp6215=) rs372400829
NM_001267550.2(TTN):c.18659G>C (p.Cys6220Ser) rs191692293
NM_001267550.2(TTN):c.18681G>A (p.Pro6227=) rs372273496
NM_001267550.2(TTN):c.18684T>C (p.Phe6228=) rs368427156
NM_001267550.2(TTN):c.18717T>A (p.Ile6239=) rs765483284
NM_001267550.2(TTN):c.18719G>A (p.Arg6240Gln) rs761993856
NM_001267550.2(TTN):c.18720A>G (p.Arg6240=) rs201395913
NM_001267550.2(TTN):c.18744C>T (p.Thr6248=)
NM_001267550.2(TTN):c.18745G>A (p.Asp6249Asn) rs201263441
NM_001267550.2(TTN):c.18777C>A (p.Thr6259=) rs750180579
NM_001267550.2(TTN):c.18778A>C (p.Lys6260Gln) rs375652574
NM_001267550.2(TTN):c.18869-15C>T rs749315046
NM_001267550.2(TTN):c.18893T>C (p.Ile6298Thr) rs375571785
NM_001267550.2(TTN):c.18942C>T (p.Thr6314=) rs572285982
NM_001267550.2(TTN):c.1895G>A (p.Gly632Asp) rs150231219
NM_001267550.2(TTN):c.189T>C (p.Ala63=) rs1057520389
NM_001267550.2(TTN):c.189T>G (p.Ala63=) rs1057520389
NM_001267550.2(TTN):c.19008T>A (p.Asp6336Glu) rs1416824072
NM_001267550.2(TTN):c.19054A>G (p.Arg6352Gly) rs569003242
NM_001267550.2(TTN):c.19063G>T (p.Asp6355Tyr) rs188878341
NM_001267550.2(TTN):c.19148-13A>G
NM_001267550.2(TTN):c.19148-19A>G rs760577918
NM_001267550.2(TTN):c.1914A>G (p.Glu638=) rs727504691
NM_001267550.2(TTN):c.19150C>A (p.Pro6384Thr) rs72648953
NM_001267550.2(TTN):c.19152A>G (p.Pro6384=) rs956813031
NM_001267550.2(TTN):c.19153G>A (p.Ala6385Thr) rs1032273558
NM_001267550.2(TTN):c.19162G>A (p.Val6388Ile) rs550617268
NM_001267550.2(TTN):c.19180G>C (p.Val6394Leu)
NM_001267550.2(TTN):c.19356C>T (p.Ser6452=) rs369275615
NM_001267550.2(TTN):c.1938+115C>T
NM_001267550.2(TTN):c.1939A>T (p.Met647Leu) rs1554027673
NM_001267550.2(TTN):c.19433A>G (p.Asn6478Ser) rs775984790
NM_001267550.2(TTN):c.1943G>C (p.Arg648Thr) rs550441902
NM_001267550.2(TTN):c.1953C>T (p.Ala651=) rs778742098
NM_001267550.2(TTN):c.19715-12_19715-11del rs748695304
NM_001267550.2(TTN):c.19715-7T>C rs532527175
NM_001267550.2(TTN):c.19728C>T (p.Phe6576=) rs751902051
NM_001267550.2(TTN):c.19770A>G (p.Thr6590=) rs775289296
NM_001267550.2(TTN):c.197C>T (p.Thr66Met) rs372755739
NM_001267550.2(TTN):c.19881G>A (p.Ser6627=) rs371495674
NM_001267550.2(TTN):c.19995A>T (p.Glu6665Asp) rs146828735
NM_001267550.2(TTN):c.20169C>T (p.Ala6723=) rs727504776
NM_001267550.2(TTN):c.20236G>A (p.Ala6746Thr) rs202108224
NM_001267550.2(TTN):c.20275+136C>T
NM_001267550.2(TTN):c.20335A>T (p.Ser6779Cys) rs149470241
NM_001267550.2(TTN):c.20341G>A (p.Glu6781Lys) rs72648958
NM_001267550.2(TTN):c.20355G>A (p.Ser6785=) rs549470227
NM_001267550.2(TTN):c.20355G>C (p.Ser6785=) rs549470227
NM_001267550.2(TTN):c.2035A>G (p.Met679Val) rs1554027460
NM_001267550.2(TTN):c.20418A>C (p.Lys6806Asn) rs768932465
NM_001267550.2(TTN):c.2061A>G (p.Gln687=) rs188680791
NM_001267550.2(TTN):c.20630T>C (p.Ile6877Thr) rs142794598
NM_001267550.2(TTN):c.20670G>A (p.Glu6890=) rs1553915541
NM_001267550.2(TTN):c.20743G>T (p.Ala6915Ser) rs201728165
NM_001267550.2(TTN):c.2076+13G>A rs778505099
NM_001267550.2(TTN):c.2076+55A>C
NM_001267550.2(TTN):c.20792A>G (p.Asn6931Ser) rs200866883
NM_001267550.2(TTN):c.20798G>C (p.Gly6933Ala) rs200118743
NM_001267550.2(TTN):c.20808G>A (p.Arg6936=) rs773342572
NM_001267550.2(TTN):c.20837-12G>A
NM_001267550.2(TTN):c.20874G>A (p.Thr6958=)
NM_001267550.2(TTN):c.20880T>C (p.Thr6960=) rs1466462241
NM_001267550.2(TTN):c.20892G>A (p.Thr6964=) rs727504623
NM_001267550.2(TTN):c.20905T>C (p.Cys6969Arg) rs368762020
NM_001267550.2(TTN):c.20924C>T (p.Pro6975Leu) rs374493881
NM_001267550.2(TTN):c.20964G>A (p.Leu6988=) rs1553914054
NM_001267550.2(TTN):c.20999A>G (p.Asn7000Ser)
NM_001267550.2(TTN):c.21002A>G (p.Lys7001Arg) rs200594798
NM_001267550.2(TTN):c.21013T>C (p.Leu7005=) rs774841915
NM_001267550.2(TTN):c.21036G>T (p.Arg7012Ser)
NM_001267550.2(TTN):c.21162T>G (p.Gly7054=) rs1553913456
NM_001267550.2(TTN):c.21279A>G (p.Thr7093=) rs727504765
NM_001267550.2(TTN):c.21307T>A (p.Leu7103Met) rs1235519093
NM_001267550.2(TTN):c.21363C>T (p.Val7121=) rs751090506
NM_001267550.2(TTN):c.21364G>A (p.Ala7122Thr) rs201394117
NM_001267550.2(TTN):c.21378A>C (p.Glu7126Asp) rs786205315
NM_001267550.2(TTN):c.21389T>C (p.Val7130Ala)
NM_001267550.2(TTN):c.21403+12G>C
NM_001267550.2(TTN):c.21545G>A (p.Arg7182Gln) rs200447686
NM_001267550.2(TTN):c.21605C>G (p.Ser7202Cys) rs747376234
NM_001267550.2(TTN):c.21624C>T (p.Thr7208=) rs372818044
NM_001267550.2(TTN):c.21642C>T (p.Asn7214=) rs752620885
NM_001267550.2(TTN):c.21668G>A (p.Arg7223His) rs138853909
NM_001267550.2(TTN):c.21689C>T (p.Ala7230Val) rs761223583
NM_001267550.2(TTN):c.21744T>C (p.Ile7248=) rs779975469
NM_001267550.2(TTN):c.21777T>A (p.Ile7259=) rs727505220
NM_001267550.2(TTN):c.21961+17T>C
NM_001267550.2(TTN):c.21966G>A (p.Pro7322=) rs773546767
NM_001267550.2(TTN):c.21981G>T (p.Thr7327=) rs775230627
NM_001267550.2(TTN):c.22111A>G (p.Thr7371Ala) rs1381030080
NM_001267550.2(TTN):c.22134C>T (p.Ala7378=) rs879172660
NM_001267550.2(TTN):c.22155G>A (p.Val7385=) rs767194863
NM_001267550.2(TTN):c.22240+7A>C rs368101794
NM_001267550.2(TTN):c.22241-5T>C rs397517501
NM_001267550.2(TTN):c.2226C>A (p.Ser742=) rs151025677
NM_001267550.2(TTN):c.2226C>T (p.Ser742=) rs151025677
NM_001267550.2(TTN):c.22439A>C (p.Gln7480Pro) rs201065037
NM_001267550.2(TTN):c.22440A>G (p.Gln7480=) rs1057521208
NM_001267550.2(TTN):c.22510G>A (p.Ala7504Thr) rs753276275
NM_001267550.2(TTN):c.22536G>A (p.Lys7512=) rs1553910053
NM_001267550.2(TTN):c.22575T>A (p.Asp7525Glu) rs200061856
NM_001267550.2(TTN):c.22620T>C (p.Gly7540=) rs1553909881
NM_001267550.2(TTN):c.2264C>T (p.Ser755Leu) rs533384820
NM_001267550.2(TTN):c.22653T>C (p.Asp7551=) rs371736246
NM_001267550.2(TTN):c.22692A>T (p.Thr7564=) rs187182557
NM_001267550.2(TTN):c.22816+59A>T
NM_001267550.2(TTN):c.22817-42A>G
NM_001267550.2(TTN):c.2301A>G (p.Arg767=) rs746831560
NM_001267550.2(TTN):c.23076C>T (p.Cys7692=) rs769505705
NM_001267550.2(TTN):c.23085G>T (p.Ala7695=) rs768936623
NM_001267550.2(TTN):c.23114C>T (p.Thr7705Ile) rs772162626
NM_001267550.2(TTN):c.23178G>A (p.Ser7726=) rs753546095
NM_001267550.2(TTN):c.23302G>A (p.Asp7768Asn) rs72648973
NM_001267550.2(TTN):c.23382T>A (p.Pro7794=) rs768874223
NM_001267550.2(TTN):c.23387G>A (p.Arg7796Gln) rs267599059
NM_001267550.2(TTN):c.23423T>C (p.Ile7808Thr)
NM_001267550.2(TTN):c.23521A>T (p.Asn7841Tyr)
NM_001267550.2(TTN):c.23585A>C (p.Asn7862Thr) rs794729629
NM_001267550.2(TTN):c.23622T>C (p.Ala7874=) rs777752532
NM_001267550.2(TTN):c.23844C>A (p.Ile7948=) rs536536380
NM_001267550.2(TTN):c.23898T>C (p.Ser7966=) rs773116614
NM_001267550.2(TTN):c.2391A>G (p.Leu797=) rs147124267
NM_001267550.2(TTN):c.23939-24G>A
NM_001267550.2(TTN):c.23939-5C>T rs1214280183
NM_001267550.2(TTN):c.24045A>T (p.Ser8015=) rs1060503946
NM_001267550.2(TTN):c.240G>A (p.Leu80=) rs1554045220
NM_001267550.2(TTN):c.24156A>G (p.Thr8052=) rs749823104
NM_001267550.2(TTN):c.24165C>T (p.Tyr8055=) rs376896085
NM_001267550.2(TTN):c.2426C>G (p.Pro809Arg)
NM_001267550.2(TTN):c.24453C>T (p.Leu8151=) rs772386098
NM_001267550.2(TTN):c.24506-17_24506-16del rs776041749
NM_001267550.2(TTN):c.24588C>A (p.Gly8196=) rs1057523933
NM_001267550.2(TTN):c.24622G>A (p.Glu8208Lys) rs190192954
NM_001267550.2(TTN):c.24636A>G (p.Ser8212=) rs1553903322
NM_001267550.2(TTN):c.24719A>G (p.Gln8240Arg) rs747625896
NM_001267550.2(TTN):c.24785-3T>C rs771432456
NM_001267550.2(TTN):c.24820G>A (p.Glu8274Lys) rs72648981
NM_001267550.2(TTN):c.24833G>C (p.Gly8278Ala) rs778611558
NM_001267550.2(TTN):c.24867A>G (p.Gly8289=) rs1553902696
NM_001267550.2(TTN):c.24888T>C (p.Ser8296=) rs535603112
NM_001267550.2(TTN):c.2493+119G>A
NM_001267550.2(TTN):c.24952G>A (p.Val8318Ile) rs200103997
NM_001267550.2(TTN):c.24957T>C (p.Ala8319=) rs758868965
NM_001267550.2(TTN):c.24960C>T (p.Ser8320=) rs1057522331
NM_001267550.2(TTN):c.24964G>T (p.Val8322Leu) rs201571580
NM_001267550.2(TTN):c.24972C>A (p.Asn8324Lys) rs879030954
NM_001267550.2(TTN):c.25002T>C (p.Tyr8334=) rs371334680
NM_001267550.2(TTN):c.25005A>C (p.Ser8335=) rs879229692
NM_001267550.2(TTN):c.25023T>A (p.Ser8341Arg) rs1221926854
NM_001267550.2(TTN):c.25041T>C (p.Ser8347=) rs397517512
NM_001267550.2(TTN):c.2505C>T (p.Ala835=) rs754725705
NM_001267550.2(TTN):c.25063+18C>T rs541890371
NM_001267550.2(TTN):c.25065G>A (p.Ala8355=) rs397517514
NM_001267550.2(TTN):c.25066C>T (p.Arg8356Cys) rs201810836
NM_001267550.2(TTN):c.25087G>T (p.Ala8363Ser) rs200972189
NM_001267550.2(TTN):c.25223C>T (p.Thr8408Ile) rs201432372
NM_001267550.2(TTN):c.25296C>T (p.Cys8432=) rs375720439
NM_001267550.2(TTN):c.25351+13C>G rs138362885
NM_001267550.2(TTN):c.25392A>C (p.Ser8464=) rs766560212
NM_001267550.2(TTN):c.25481G>A (p.Arg8494Gln) rs201418615
NM_001267550.2(TTN):c.25546C>G (p.Leu8516Val)
NM_001267550.2(TTN):c.25600G>A (p.Ala8534Thr) rs779163897
NM_001267550.2(TTN):c.25619C>T (p.Ser8540Phe) rs201523784
NM_001267550.2(TTN):c.25637A>G (p.Gln8546Arg) rs548471822
NM_001267550.2(TTN):c.25639+11G>C rs1054934179
NM_001267550.2(TTN):c.25640-247A>C
NM_001267550.2(TTN):c.25758C>T (p.Asp8586=) rs372802604
NM_001267550.2(TTN):c.25937G>A (p.Arg8646His) rs144587343
NM_001267550.2(TTN):c.2596C>A (p.Pro866Thr) rs1320484376
NM_001267550.2(TTN):c.2599A>G (p.Ser867Gly) rs148631577
NM_001267550.2(TTN):c.26055C>T (p.Ser8685=) rs727505250
NM_001267550.2(TTN):c.26064G>A (p.Lys8688=) rs1057523745
NM_001267550.2(TTN):c.26094C>A (p.Thr8698=) rs1553897341
NM_001267550.2(TTN):c.2611G>T (p.Val871Leu) rs72647861
NM_001267550.2(TTN):c.26120C>T (p.Ala8707Val) rs773760649
NM_001267550.2(TTN):c.26148A>G (p.Lys8716=) rs778772942
NM_001267550.2(TTN):c.26169C>T (p.Ser8723=) rs1304915212
NM_001267550.2(TTN):c.26201-11dup rs727503644
NM_001267550.2(TTN):c.26221A>G (p.Lys8741Glu) rs538959125
NM_001267550.2(TTN):c.26257G>A (p.Val8753Ile) rs373070956
NM_001267550.2(TTN):c.26281G>A (p.Gly8761Ser) rs369385294
NM_001267550.2(TTN):c.26283C>T (p.Gly8761=) rs376046284
NM_001267550.2(TTN):c.2629C>A (p.Pro877Thr) rs751640052
NM_001267550.2(TTN):c.26329G>A (p.Val8777Ile) rs376823283
NM_001267550.2(TTN):c.26380T>G (p.Leu8794Val)
NM_001267550.2(TTN):c.26397G>A (p.Val8799=) rs1445714877
NM_001267550.2(TTN):c.26463C>T (p.Phe8821=) rs551600321
NM_001267550.2(TTN):c.26468C>T (p.Thr8823Met) rs368151971
NM_001267550.2(TTN):c.26481C>T (p.Leu8827=)
NM_001267550.2(TTN):c.26483-7A>C rs1057524590
NM_001267550.2(TTN):c.26494A>G (p.Ile8832Val) rs72648989
NM_001267550.2(TTN):c.2650G>A (p.Ala884Thr) rs772195446
NM_001267550.2(TTN):c.26528C>T (p.Thr8843Met) rs72648990
NM_001267550.2(TTN):c.26544C>T (p.Thr8848=) rs1185075181
NM_001267550.2(TTN):c.2656A>G (p.Thr886Ala)
NM_001267550.2(TTN):c.26600G>A (p.Gly8867Glu) rs369142169
NM_001267550.2(TTN):c.26605G>A (p.Glu8869Lys)
NM_001267550.2(TTN):c.26672A>G (p.Asn8891Ser) rs146057575
NM_001267550.2(TTN):c.26723T>C (p.Val8908Ala)
NM_001267550.2(TTN):c.26762-10_26762-9insTTGTTTTGTA rs1553893826
NM_001267550.2(TTN):c.26762-12_26762-11insTTTTG
NM_001267550.2(TTN):c.26762-19_26762-10delTTTGTTTTGT rs71393436
NM_001267550.2(TTN):c.26762-39TTTGT[5] rs71393436
NM_001267550.2(TTN):c.267G>A (p.Ala89=) rs577716745
NM_001267550.2(TTN):c.26818G>A (p.Gly8940Ser) rs201005813
NM_001267550.2(TTN):c.26831T>C (p.Val8944Ala)
NM_001267550.2(TTN):c.26849A>G (p.Tyr8950Cys) rs199557654
NM_001267550.2(TTN):c.26869G>A (p.Val8957Ile) rs1008014872
NM_001267550.2(TTN):c.2686G>A (p.Val896Ile) rs376768790
NM_001267550.2(TTN):c.26928G>A (p.Leu8976=) rs370973715
NM_001267550.2(TTN):c.26932G>C (p.Asp8978His) rs773744166
NM_001267550.2(TTN):c.27049+10C>A rs780979988
NM_001267550.2(TTN):c.27050-6G>A rs765624428
NM_001267550.2(TTN):c.27123C>A (p.Ile9041=) rs890920556
NM_001267550.2(TTN):c.27193T>C (p.Cys9065Arg) rs201229221
NM_001267550.2(TTN):c.27198C>G (p.Asn9066Lys) rs369529493
NM_001267550.2(TTN):c.27246T>C (p.Asp9082=) rs183503760
NM_001267550.2(TTN):c.27328+14C>T rs781624389
NM_001267550.2(TTN):c.27328+16C>T rs915309849
NM_001267550.2(TTN):c.27348G>A (p.Lys9116=) rs1057524151
NM_001267550.2(TTN):c.2744G>A (p.Arg915His) rs376922544
NM_001267550.2(TTN):c.27485C>T (p.Thr9162Met) rs199793620
NM_001267550.2(TTN):c.27498G>T (p.Ser9166=) rs372528823
NM_001267550.2(TTN):c.27524C>G (p.Thr9175Arg) rs1438488035
NM_001267550.2(TTN):c.27608-11C>G rs1553890853
NM_001267550.2(TTN):c.2760C>T (p.His920=) rs138788406
NM_001267550.2(TTN):c.27627G>A (p.Lys9209=) rs772596751
NM_001267550.2(TTN):c.2764C>T (p.Arg922Cys) rs72647862
NM_001267550.2(TTN):c.27654T>G (p.Val9218=) rs780101457
NM_001267550.2(TTN):c.27670C>T (p.Leu9224=)
NM_001267550.2(TTN):c.2772C>A (p.Ala924=) rs1442322525
NM_001267550.2(TTN):c.2775+19G>T rs199707799
NM_001267550.2(TTN):c.2776-14T>C rs201611946
NM_001267550.2(TTN):c.27807T>C (p.Ile9269=) rs1553890363
NM_001267550.2(TTN):c.27847G>A (p.Val9283Met) rs727504515
NM_001267550.2(TTN):c.27879C>T (p.Thr9293=) rs751693156
NM_001267550.2(TTN):c.27886+17T>C rs376389312
NM_001267550.2(TTN):c.27915A>G (p.Arg9305=) rs367900368
NM_001267550.2(TTN):c.27947T>G (p.Leu9316Arg) rs78643968
NM_001267550.2(TTN):c.28042C>G (p.Gln9348Glu) rs794727987
NM_001267550.2(TTN):c.28055T>C (p.Leu9352Ser) rs776487201
NM_001267550.2(TTN):c.28080T>A (p.Ile9360=) rs1220122597
NM_001267550.2(TTN):c.28127C>G (p.Thr9376Arg) rs749875409
NM_001267550.2(TTN):c.28135A>T (p.Ile9379Leu)
NM_001267550.2(TTN):c.28151C>G (p.Ser9384Cys) rs760466007
NM_001267550.2(TTN):c.28175-10C>T rs748478445
NM_001267550.2(TTN):c.28187C>T (p.Pro9396Leu) rs373065549
NM_001267550.2(TTN):c.28262C>T (p.Thr9421Met) rs375209383
NM_001267550.2(TTN):c.28299C>G (p.Asp9433Glu) rs372608982
NM_001267550.2(TTN):c.28320C>T (p.Gly9440=) rs375083775
NM_001267550.2(TTN):c.2841+198T>C
NM_001267550.2(TTN):c.28446T>C (p.Ala9482=) rs1270390229
NM_001267550.2(TTN):c.28463-120G>A
NM_001267550.2(TTN):c.28463-201T>C
NM_001267550.2(TTN):c.28465C>A (p.Arg9489=) rs200489972
NM_001267550.2(TTN):c.28492A>G (p.Arg9498Gly)
NM_001267550.2(TTN):c.28507G>A (p.Val9503Ile) rs202160275
NM_001267550.2(TTN):c.28542G>A (p.Glu9514=) rs370604793
NM_001267550.2(TTN):c.28547G>A (p.Arg9516His) rs374156904
NM_001267550.2(TTN):c.2854G>C (p.Val952Leu) rs373848402
NM_001267550.2(TTN):c.28641C>T (p.Asn9547=) rs727505185
NM_001267550.2(TTN):c.28644G>A (p.Thr9548=) rs376744914
NM_001267550.2(TTN):c.28648G>C (p.Val9550Leu) rs879094573
NM_001267550.2(TTN):c.28678G>A (p.Asp9560Asn) rs771843862
NM_001267550.2(TTN):c.28680C>T (p.Asp9560=) rs377713076
NM_001267550.2(TTN):c.28692C>T (p.Tyr9564=) rs749105848
NM_001267550.2(TTN):c.28741A>G (p.Ile9581Val) rs371826762
NM_001267550.2(TTN):c.28754-11T>C rs146738622
NM_001267550.2(TTN):c.28754A>G (p.Glu9585Gly) rs200856239
NM_001267550.2(TTN):c.28849G>A (p.Glu9617Lys) rs144025230
NM_001267550.2(TTN):c.28909A>G (p.Ser9637Gly) rs1160550023
NM_001267550.2(TTN):c.28924A>G (p.Ser9642Gly) rs367888853
NM_001267550.2(TTN):c.28939C>T (p.Leu9647=) rs879099128
NM_001267550.2(TTN):c.28970C>T (p.Ser9657Leu) rs200049911
NM_001267550.2(TTN):c.29115G>A (p.Gln9705=) rs773659138
NM_001267550.2(TTN):c.29134+33C>G
NM_001267550.2(TTN):c.29142T>C (p.Thr9714=) rs773838077
NM_001267550.2(TTN):c.29169T>C (p.Gly9723=) rs750700619
NM_001267550.2(TTN):c.29313C>T (p.Cys9771=) rs375017037
NM_001267550.2(TTN):c.29314G>A (p.Val9772Met) rs563073635
NM_001267550.2(TTN):c.29382A>G (p.Gln9794=) rs1057523227
NM_001267550.2(TTN):c.29397C>T (p.Gly9799=) rs770084292
NM_001267550.2(TTN):c.29420+10A>G rs759753042
NM_001267550.2(TTN):c.29420+234C>T
NM_001267550.2(TTN):c.29421-19del rs1064795938
NM_001267550.2(TTN):c.29448_29450AGA[2] (p.Glu9820del) rs377232641
NM_001267550.2(TTN):c.295+15A>C rs202157373
NM_001267550.2(TTN):c.295+6C>T rs1057524454
NM_001267550.2(TTN):c.29502A>G (p.Glu9834=) rs759468315
NM_001267550.2(TTN):c.29577A>G (p.Gln9859=) rs368780181
NM_001267550.2(TTN):c.29590G>C (p.Glu9864Gln)
NM_001267550.2(TTN):c.29637C>T (p.Asp9879=) rs375591605
NM_001267550.2(TTN):c.29864G>A (p.Arg9955Gln) rs182332374
NM_001267550.2(TTN):c.29938G>A (p.Ala9980Thr) rs189286381
NM_001267550.2(TTN):c.2998C>T (p.Leu1000Phe) rs140953779
NM_001267550.2(TTN):c.3002T>G (p.Met1001Arg) rs148269839
NM_001267550.2(TTN):c.30081C>T (p.Ile10027=) rs1553877658
NM_001267550.2(TTN):c.3010G>A (p.Glu1004Lys) rs200902055
NM_001267550.2(TTN):c.30181A>C (p.Lys10061Gln) rs184153985
NM_001267550.2(TTN):c.30223+204C>T
NM_001267550.2(TTN):c.30224-147A>G
NM_001267550.2(TTN):c.30224-41T>G
NM_001267550.2(TTN):c.30242C>G (p.Thr10081Arg)
NM_001267550.2(TTN):c.30433+15A>T rs371872220
NM_001267550.2(TTN):c.30444G>A (p.Ser10148=) rs367901929
NM_001267550.2(TTN):c.30450C>T (p.Ile10150=) rs761922521
NM_001267550.2(TTN):c.30454C>T (p.Arg10152Trp)
NM_001267550.2(TTN):c.30485C>T (p.Thr10162Met) rs200593368
NM_001267550.2(TTN):c.30512-16T>A rs1553874765
NM_001267550.2(TTN):c.3051T>C (p.Ala1017=) rs1185928356
NM_001267550.2(TTN):c.30539-95A>C
NM_001267550.2(TTN):c.30598+6A>G rs749100259
NM_001267550.2(TTN):c.30683-61G>A
NM_001267550.2(TTN):c.30697G>T (p.Val10233Leu) rs1553868860
NM_001267550.2(TTN):c.3069C>T (p.Thr1023=) rs371447978
NM_001267550.2(TTN):c.3070G>A (p.Val1024Ile) rs368770038
NM_001267550.2(TTN):c.30718G>T (p.Val10240Phe) rs111671438
NM_001267550.2(TTN):c.30754+15C>A
NM_001267550.2(TTN):c.30768G>A (p.Lys10256=) rs762404146
NM_001267550.2(TTN):c.3086A>G (p.Tyr1029Cys) rs774126306
NM_001267550.2(TTN):c.30930G>T (p.Lys10310Asn) rs879244158
NM_001267550.2(TTN):c.31034A>G (p.Tyr10345Cys) rs794729236
NM_001267550.2(TTN):c.31070A>G (p.His10357Arg)
NM_001267550.2(TTN):c.31156G>A (p.Glu10386Lys) rs772195716
NM_001267550.2(TTN):c.31208-13G>A rs377135196
NM_001267550.2(TTN):c.31270+12G>T rs564264476
NM_001267550.2(TTN):c.31271-13A>T rs1057523378
NM_001267550.2(TTN):c.31321G>A (p.Glu10441Lys)
NM_001267550.2(TTN):c.3132C>T (p.Ala1044=) rs777315600
NM_001267550.2(TTN):c.3133G>A (p.Val1045Met) rs72647868
NM_001267550.2(TTN):c.31399G>A (p.Val10467Ile) rs72650019
NM_001267550.2(TTN):c.31422G>A (p.Val10474=) rs72650020
NM_001267550.2(TTN):c.31441A>G (p.Thr10481Ala) rs370208651
NM_001267550.2(TTN):c.31456A>T (p.Ile10486Phe) rs772882862
NM_001267550.2(TTN):c.31505C>T (p.Ser10502Leu) rs768632287
NM_001267550.2(TTN):c.31518C>T (p.Pro10506=) rs746912694
NM_001267550.2(TTN):c.3151A>G (p.Thr1051Ala)
NM_001267550.2(TTN):c.31566T>A (p.Ile10522=) rs200239159
NM_001267550.2(TTN):c.31594+16T>C rs552832521
NM_001267550.2(TTN):c.31594+7G>C rs1057524536
NM_001267550.2(TTN):c.31595-18G>A rs1477509887
NM_001267550.2(TTN):c.31595-9C>G
NM_001267550.2(TTN):c.31678+20A>G rs1057508878
NM_001267550.2(TTN):c.31679-12G>A rs372575606
NM_001267550.2(TTN):c.3169G>A (p.Val1057Ile) rs780035225
NM_001267550.2(TTN):c.31737G>A (p.Lys10579=) rs763013094
NM_001267550.2(TTN):c.31757C>A (p.Pro10586Gln) rs200459347
NM_001267550.2(TTN):c.31763-20T>G rs1553853679
NM_001267550.2(TTN):c.31806C>T (p.Pro10602=) rs370080995
NM_001267550.2(TTN):c.31807G>A (p.Val10603Ile) rs139790668
NM_001267550.2(TTN):c.31837C>G (p.Pro10613Ala) rs200213832
NM_001267550.2(TTN):c.31841C>A (p.Ala10614Asp) rs376754004
NM_001267550.2(TTN):c.31846+17C>T rs900359869
NM_001267550.2(TTN):c.31846+5A>G rs760788961
NM_001267550.2(TTN):c.31847-12T>C rs371372951
NM_001267550.2(TTN):c.31875A>C (p.Thr10625=) rs182934463
NM_001267550.2(TTN):c.31970C>T (p.Pro10657Leu)
NM_001267550.2(TTN):c.32035G>A (p.Val10679Ile) rs369932282
NM_001267550.2(TTN):c.32071G>A (p.Ala10691Thr) rs371452173
NM_001267550.2(TTN):c.32095+20T>C rs768705255
NM_001267550.2(TTN):c.32096-37C>A
NM_001267550.2(TTN):c.32152C>G (p.Leu10718Val)
NM_001267550.2(TTN):c.32186C>T (p.Thr10729Met) rs115119858
NM_001267550.2(TTN):c.32189G>A (p.Arg10730Gln) rs771054923
NM_001267550.2(TTN):c.32198-10T>C rs371121439
NM_001267550.2(TTN):c.32218A>T (p.Ser10740Cys) rs758825292
NM_001267550.2(TTN):c.32225C>T (p.Ser10742Leu) rs777586144
NM_001267550.2(TTN):c.32263_32265GAA[2] (p.Glu10757del)
NM_001267550.2(TTN):c.32311+283A>G
NM_001267550.2(TTN):c.32419G>A (p.Val10807Ile) rs1553846469
NM_001267550.2(TTN):c.3241G>A (p.Ala1081Thr) rs55914517
NM_001267550.2(TTN):c.3241G>T (p.Ala1081Ser) rs55914517
NM_001267550.2(TTN):c.32462C>T (p.Pro10821Leu) rs146400809
NM_001267550.2(TTN):c.32477A>C (p.Glu10826Ala)
NM_001267550.2(TTN):c.32480C>T (p.Ala10827Val) rs72650030
NM_001267550.2(TTN):c.32546C>G (p.Pro10849Arg)
NM_001267550.2(TTN):c.32554+5_32554+6del rs771419718
NM_001267550.2(TTN):c.32555-12G>T rs397517540
NM_001267550.2(TTN):c.32557C>T (p.Pro10853Ser) rs201738153
NM_001267550.2(TTN):c.32593G>C (p.Val10865Leu) rs150733188
NM_001267550.2(TTN):c.32659A>G (p.Ile10887Val)
NM_001267550.2(TTN):c.32694T>C (p.Thr10898=) rs1553844266
NM_001267550.2(TTN):c.32701G>C (p.Glu10901Gln)
NM_001267550.2(TTN):c.32731G>A (p.Glu10911Lys) rs199620003
NM_001267550.2(TTN):c.32743G>C (p.Ala10915Pro) rs72650032
NM_001267550.2(TTN):c.32806+5A>G rs755370435
NM_001267550.2(TTN):c.32881A>G (p.Ile10961Val) rs886055284
NM_001267550.2(TTN):c.32888-19G>A rs141514650
NM_001267550.2(TTN):c.32888-7G>A
NM_001267550.2(TTN):c.32953C>T (p.Arg10985Trp) rs201991864
NM_001267550.2(TTN):c.3295G>A (p.Val1099Met) rs368282893
NM_001267550.2(TTN):c.32970_32987del (p.10987_10989EEY[1]) rs766756026
NM_001267550.2(TTN):c.33018A>G (p.Thr11006=) rs765492188
NM_001267550.2(TTN):c.33030C>T (p.Asp11010=)
NM_001267550.2(TTN):c.33053G>A (p.Arg11018Gln) rs72650034
NM_001267550.2(TTN):c.33059A>G (p.Tyr11020Cys) rs72650035
NM_001267550.2(TTN):c.33111C>T (p.Ile11037=) rs374779534
NM_001267550.2(TTN):c.33113C>T (p.Pro11038Leu)
NM_001267550.2(TTN):c.33126C>T (p.Val11042=) rs72650036
NM_001267550.2(TTN):c.33127C>T (p.Pro11043Ser)
NM_001267550.2(TTN):c.33165G>A (p.Pro11055=) rs756152512
NM_001267550.2(TTN):c.33172+4G>A rs756475184
NM_001267550.2(TTN):c.33188T>A (p.Val11063Asp)
NM_001267550.2(TTN):c.33206C>T (p.Pro11069Leu)
NM_001267550.2(TTN):c.33225A>G (p.Lys11075=) rs1553836388
NM_001267550.2(TTN):c.33276G>A (p.Glu11092=) rs1057523198
NM_001267550.2(TTN):c.33286C>T (p.Arg11096Cys)
NM_001267550.2(TTN):c.33416G>C (p.Arg11139Thr) rs72650040
NM_001267550.2(TTN):c.33501_33503AGA[4] (p.Glu11172del) rs368327166
NM_001267550.2(TTN):c.33573A>G (p.Pro11191=) rs1057520961
NM_001267550.2(TTN):c.33594C>T (p.Pro11198=) rs1553829479
NM_001267550.2(TTN):c.33742+8C>T rs375939001
NM_001267550.2(TTN):c.33743-15T>C rs112313732
NM_001267550.2(TTN):c.3380+9A>G rs770149480
NM_001267550.2(TTN):c.3381-275T>A
NM_001267550.2(TTN):c.33826+4C>T rs750851792
NM_001267550.2(TTN):c.33826+7G>A rs752099208
NM_001267550.2(TTN):c.33838C>T (p.Pro11280Ser) rs374449452
NM_001267550.2(TTN):c.33856G>A (p.Glu11286Lys) rs376874956
NM_001267550.2(TTN):c.33976G>C (p.Glu11326Gln)
NM_001267550.2(TTN):c.34051G>A (p.Val11351Ile)
NM_001267550.2(TTN):c.34062A>G (p.Glu11354=) rs886055281
NM_001267550.2(TTN):c.34098_34118GGAAGAGGAAGTTCTACCTGA[1] (p.11363_11369VLPEEEE[3]) rs397517548
NM_001267550.2(TTN):c.34132C>T (p.Leu11378=) rs960128787
NM_001267550.2(TTN):c.34230A>G (p.Glu11410=) rs762363574
NM_001267550.2(TTN):c.34251C>G (p.Val11417=) rs368972294
NM_001267550.2(TTN):c.34379-15A>G rs764544769
NM_001267550.2(TTN):c.34391A>G (p.Lys11464Arg) rs786205396
NM_001267550.2(TTN):c.34412A>T (p.Lys11471Ile)
NM_001267550.2(TTN):c.34453+13C>T rs771926210
NM_001267550.2(TTN):c.34453+14G>A rs397517550
NM_001267550.2(TTN):c.3445G>A (p.Asp1149Asn) rs368967197
NM_001267550.2(TTN):c.34538-110T>C
NM_001267550.2(TTN):c.34571G>A (p.Arg11524Gln) rs201622536
NM_001267550.2(TTN):c.34581C>G (p.Leu11527=) rs781699559
NM_001267550.2(TTN):c.34601T>C (p.Leu11534Pro) rs376836503
NM_001267550.2(TTN):c.34612+250T>C
NM_001267550.2(TTN):c.34613-18A>G rs372828399
NM_001267550.2(TTN):c.34641T>C (p.Ile11547=)
NM_001267550.2(TTN):c.34660_34662GAA[1] (p.Glu11555del) rs763098227
NM_001267550.2(TTN):c.34675A>G (p.Ile11559Val) rs752903377
NM_001267550.2(TTN):c.34708+9G>T rs397517551
NM_001267550.2(TTN):c.34735C>T (p.Pro11579Ser) rs754511830
NM_001267550.2(TTN):c.34841C>A (p.Ala11614Glu) rs1553810486
NM_001267550.2(TTN):c.34845C>T (p.Pro11615=) rs368781863
NM_001267550.2(TTN):c.34931-13G>C rs1057524496
NM_001267550.2(TTN):c.35037G>A (p.Pro11679=) rs369095270
NM_001267550.2(TTN):c.35083G>A (p.Glu11695Lys) rs376117402
NM_001267550.2(TTN):c.35212A>G (p.Lys11738Glu) rs1553808816
NM_001267550.2(TTN):c.3524-3T>C rs762717963
NM_001267550.2(TTN):c.35264A>C (p.Lys11755Thr) rs189966800
NM_001267550.2(TTN):c.35268G>A (p.Pro11756=)
NM_001267550.2(TTN):c.35292A>G (p.Lys11764=) rs750096348
NM_001267550.2(TTN):c.35313G>A (p.Pro11771=) rs369739111
NM_001267550.2(TTN):c.35371G>T (p.Val11791Phe)
NM_001267550.2(TTN):c.3549C>T (p.Ser1183=)
NM_001267550.2(TTN):c.3577G>A (p.Val1193Met) rs727503699
NM_001267550.2(TTN):c.35876-45C>T
NM_001267550.2(TTN):c.3619C>A (p.Pro1207Thr) rs373753003
NM_001267550.2(TTN):c.36701-16A>G rs577899845
NM_001267550.2(TTN):c.36708A>T (p.Glu12236Asp) rs796478043
NM_001267550.2(TTN):c.36750G>A (p.Pro12250=) rs777458053
NM_001267550.2(TTN):c.37369+8C>A rs1489244862
NM_001267550.2(TTN):c.37370-12A>G rs1553782234
NM_001267550.2(TTN):c.37414G>A (p.Glu12472Lys) rs1553782108
NM_001267550.2(TTN):c.37421T>C (p.Ile12474Thr) rs72650057
NM_001267550.2(TTN):c.38161G>T (p.Val12721Leu) rs794729416
NM_001267550.2(TTN):c.38380+29T>A
NM_001267550.2(TTN):c.38545+33G>C
NM_001267550.2(TTN):c.38708-27C>T
NM_001267550.2(TTN):c.39044-14T>C rs1177294449
NM_001267550.2(TTN):c.39044-15C>T rs749495580
NM_001267550.2(TTN):c.39050A>G (p.Glu13017Gly) rs368056479
NM_001267550.2(TTN):c.39090G>A (p.Ala13030=) rs375519815
NM_001267550.2(TTN):c.39099T>C (p.Pro13033=) rs755793186
NM_001267550.2(TTN):c.39128-16A>G rs769738352
NM_001267550.2(TTN):c.39143A>G (p.Lys13048Arg)
NM_001267550.2(TTN):c.39166G>T (p.Val13056Leu) rs727504201
NM_001267550.2(TTN):c.39211+13A>T rs756966122
NM_001267550.2(TTN):c.39211+16G>T rs753691920
NM_001267550.2(TTN):c.39230T>C (p.Val13077Ala) rs398124449
NM_001267550.2(TTN):c.39255T>C (p.Pro13085=) rs573657954
NM_001267550.2(TTN):c.39276G>A (p.Pro13092=) rs369002632
NM_001267550.2(TTN):c.39295+16T>C rs371747911
NM_001267550.2(TTN):c.39296-18G>T rs748134833
NM_001267550.2(TTN):c.39301G>A (p.Glu13101Lys) rs201035457
NM_001267550.2(TTN):c.39368C>T (p.Ala13123Val) rs761828404
NM_001267550.2(TTN):c.39463+11C>T
NM_001267550.2(TTN):c.39463+16A>G rs1553769902
NM_001267550.2(TTN):c.39463+18T>G rs550378650
NM_001267550.2(TTN):c.39464-17A>G
NM_001267550.2(TTN):c.39464-7T>C rs1218973879
NM_001267550.2(TTN):c.39466C>A (p.Pro13156Thr) rs72650064
NM_001267550.2(TTN):c.39469G>A (p.Glu13157Lys) rs761974767
NM_001267550.2(TTN):c.39473T>C (p.Val13158Ala) rs1553769611
NM_001267550.2(TTN):c.39493G>A (p.Glu13165Lys) rs747566528
NM_001267550.2(TTN):c.39547+19T>C rs559113689
NM_001267550.2(TTN):c.39548-8A>G rs369594816
NM_001267550.2(TTN):c.39556G>A (p.Val13186Ile) rs750201663
NM_001267550.2(TTN):c.39578A>G (p.Glu13193Gly) rs190461403
NM_001267550.2(TTN):c.39597C>A (p.Pro13199=) rs776088323
NM_001267550.2(TTN):c.39606A>G (p.Pro13202=) rs372356060
NM_001267550.2(TTN):c.39616C>T (p.Pro13206Ser) rs186404793
NM_001267550.2(TTN):c.39663A>T (p.Lys13221Asn)
NM_001267550.2(TTN):c.39689C>T (p.Ala13230Val) rs148140756
NM_001267550.2(TTN):c.39709+14C>T rs760314415
NM_001267550.2(TTN):c.39710-15C>T rs1057522986
NM_001267550.2(TTN):c.39786A>G (p.Glu13262=) rs398124450
NM_001267550.2(TTN):c.39802G>T (p.Val13268Phe) rs759268958
NM_001267550.2(TTN):c.39885G>A (p.Pro13295=) rs756518824
NM_001267550.2(TTN):c.39895+16del rs761838184
NM_001267550.2(TTN):c.39895+8T>C rs990600164
NM_001267550.2(TTN):c.40223-208G>T
NM_001267550.2(TTN):c.40395A>G (p.Ile13465Met) rs766145596
NM_001267550.2(TTN):c.40408+20A>G
NM_001267550.2(TTN):c.40408+8dup rs727504922
NM_001267550.2(TTN):c.40477+7C>G rs1553759307
NM_001267550.2(TTN):c.40478-8C>A rs1553756571
NM_001267550.2(TTN):c.40498G>T (p.Val13500Phe) rs201944202
NM_001267550.2(TTN):c.40515G>A (p.Pro13505=) rs367958537
NM_001267550.2(TTN):c.40557C>T (p.Ser13519=) rs371178429
NM_001267550.2(TTN):c.40558G>A (p.Val13520Ile) rs587780488
NM_001267550.2(TTN):c.40581A>G (p.Glu13527=) rs775954427
NM_001267550.2(TTN):c.40587A>G (p.Glu13529=) rs370597107
NM_001267550.2(TTN):c.40595T>C (p.Val13532Ala) rs756446770
NM_001267550.2(TTN):c.40633+132del
NM_001267550.2(TTN):c.40757C>T (p.Ala13586Val) rs374936958
NM_001267550.2(TTN):c.40773A>G (p.Pro13591=) rs368521608
NM_001267550.2(TTN):c.40788A>G (p.Glu13596=) rs886042511
NM_001267550.2(TTN):c.40903G>A (p.Ala13635Thr) rs191699632
NM_001267550.2(TTN):c.40928-15T>C rs766374526
NM_001267550.2(TTN):c.40935C>T (p.Pro13645=) rs1553748565
NM_001267550.2(TTN):c.40939A>G (p.Lys13647Glu) rs777187629
NM_001267550.2(TTN):c.40973A>G (p.Lys13658Arg) rs184713215
NM_001267550.2(TTN):c.41019G>A (p.Pro13673=) rs762470432
NM_001267550.2(TTN):c.41022C>T (p.Phe13674=) rs1057522146
NM_001267550.2(TTN):c.41193G>A (p.Lys13731=) rs559968058
NM_001267550.2(TTN):c.41310G>A (p.Thr13770=) rs556498170
NM_001267550.2(TTN):c.41330-6C>T rs776172577
NM_001267550.2(TTN):c.41402G>A (p.Ser13801Asn) rs757590541
NM_001267550.2(TTN):c.41419G>C (p.Glu13807Gln)
NM_001267550.2(TTN):c.41487C>T (p.Gly13829=) rs531726095
NM_001267550.2(TTN):c.41488G>A (p.Val13830Ile) rs149059189
NM_001267550.2(TTN):c.41521G>A (p.Asp13841Asn) rs201257644
NM_001267550.2(TTN):c.41568C>T (p.Asn13856=) rs559906667
NM_001267550.2(TTN):c.41596G>A (p.Val13866Ile) rs375474669
NM_001267550.2(TTN):c.415C>A (p.Arg139=)
NM_001267550.2(TTN):c.41609-6A>G rs754210075
NM_001267550.2(TTN):c.41744C>T (p.Ala13915Val) rs371426048
NM_001267550.2(TTN):c.41810C>T (p.Ala13937Val) rs545806408
NM_001267550.2(TTN):c.41812A>G (p.Met13938Val) rs201725483
NM_001267550.2(TTN):c.41920G>A (p.Val13974Ile) rs373881831
NM_001267550.2(TTN):c.42051A>T (p.Gly14017=)
NM_001267550.2(TTN):c.42056G>A (p.Arg14019His) rs374683153
NM_001267550.2(TTN):c.42151+17A>G rs546392087
NM_001267550.2(TTN):c.42270T>C (p.Asp14090=) rs753099769
NM_001267550.2(TTN):c.42292T>C (p.Phe14098Leu)
NM_001267550.2(TTN):c.42365A>G (p.Tyr14122Cys) rs756627487
NM_001267550.2(TTN):c.42468T>C (p.Gly14156=) rs774061049
NM_001267550.2(TTN):c.42483T>C (p.Phe14161=)
NM_001267550.2(TTN):c.42486T>C (p.Val14162=) rs763151045
NM_001267550.2(TTN):c.42561A>C (p.Val14187=) rs1057521315
NM_001267550.2(TTN):c.42672G>T (p.Leu14224=) rs368155350
NM_001267550.2(TTN):c.42688G>A (p.Asp14230Asn) rs371995464
NM_001267550.2(TTN):c.42750G>A (p.Leu14250=) rs1273953637
NM_001267550.2(TTN):c.42795T>C (p.Asp14265=) rs750211026
NM_001267550.2(TTN):c.42840T>G (p.Asp14280Glu) rs760643071
NM_001267550.2(TTN):c.42892G>A (p.Glu14298Lys) rs778634417
NM_001267550.2(TTN):c.42940G>A (p.Val14314Ile) rs376881525
NM_001267550.2(TTN):c.42946+11C>T rs372909189
NM_001267550.2(TTN):c.42978C>T (p.Tyr14326=) rs369959066
NM_001267550.2(TTN):c.43002A>C (p.Glu14334Asp) rs794729237
NM_001267550.2(TTN):c.43044C>T (p.His14348=) rs1060503970
NM_001267550.2(TTN):c.43138T>C (p.Cys14380Arg) rs557125278
NM_001267550.2(TTN):c.43146G>A (p.Leu14382=) rs751236287
NM_001267550.2(TTN):c.43185C>T (p.Ala14395=) rs1057519234
NM_001267550.2(TTN):c.43188A>G (p.Lys14396=) rs1057523718
NM_001267550.2(TTN):c.43213+16C>T rs1057520390
NM_001267550.2(TTN):c.43244G>A (p.Ser14415Asn) rs370342831
NM_001267550.2(TTN):c.43417G>C (p.Asp14473His) rs397517573
NM_001267550.2(TTN):c.43480+19T>C rs1346343042
NM_001267550.2(TTN):c.43481-16dup rs730880350
NM_001267550.2(TTN):c.43502C>G (p.Thr14501Ser) rs115825044
NM_001267550.2(TTN):c.43521T>C (p.Thr14507=) rs762655778
NM_001267550.2(TTN):c.43565A>G (p.His14522Arg) rs374085402
NM_001267550.2(TTN):c.43577G>A (p.Arg14526Gln) rs373491468
NM_001267550.2(TTN):c.43748-7C>T rs771927358
NM_001267550.2(TTN):c.43836A>G (p.Ala14612=) rs755492644
NM_001267550.2(TTN):c.43986T>G (p.Asp14662Glu) rs201390600
NM_001267550.2(TTN):c.44036G>A (p.Arg14679Gln) rs369709751
NM_001267550.2(TTN):c.44077C>T (p.Arg14693Cys) rs200445568
NM_001267550.2(TTN):c.44088C>G (p.Thr14696=) rs749706106
NM_001267550.2(TTN):c.44155-10G>C rs1044877599
NM_001267550.2(TTN):c.44210G>T (p.Arg14737Leu) rs373298007
NM_001267550.2(TTN):c.44281+14A>G rs745533972
NM_001267550.2(TTN):c.44281+170G>A
NM_001267550.2(TTN):c.44281+8T>C rs369121980
NM_001267550.2(TTN):c.44281C>T (p.Pro14761Ser) rs192766485
NM_001267550.2(TTN):c.44282-150G>A
NM_001267550.2(TTN):c.44282-8T>C rs776808322
NM_001267550.2(TTN):c.44319C>A (p.Val14773=) rs1057522804
NM_001267550.2(TTN):c.44323G>C (p.Val14775Leu)
NM_001267550.2(TTN):c.44367C>T (p.Tyr14789=) rs750270873
NM_001267550.2(TTN):c.44497G>A (p.Val14833Ile) rs373168798
NM_001267550.2(TTN):c.44593G>A (p.Glu14865Lys) rs543102139
NM_001267550.2(TTN):c.44645A>C (p.Lys14882Thr)
NM_001267550.2(TTN):c.44775T>C (p.Asp14925=) rs879210476
NM_001267550.2(TTN):c.44813T>C (p.Val14938Ala) rs571522834
NM_001267550.2(TTN):c.44815+175A>T
NM_001267550.2(TTN):c.44815+176A>C
NM_001267550.2(TTN):c.44816-11T>C rs1553721449
NM_001267550.2(TTN):c.44833T>C (p.Leu14945=) rs746441554
NM_001267550.2(TTN):c.44890G>A (p.Glu14964Lys)
NM_001267550.2(TTN):c.44900G>A (p.Arg14967Gln) rs752671402
NM_001267550.2(TTN):c.44937T>G (p.Ala14979=) rs370413913
NM_001267550.2(TTN):c.45053C>A (p.Ala15018Glu) rs72677221
NM_001267550.2(TTN):c.45053C>T (p.Ala15018Val) rs72677221
NM_001267550.2(TTN):c.45310C>T (p.Leu15104Phe) rs370782950
NM_001267550.2(TTN):c.45350-11T>C rs940979956
NM_001267550.2(TTN):c.45499G>A (p.Val15167Ile) rs183245562
NM_001267550.2(TTN):c.45591A>G (p.Arg15197=) rs777451653
NM_001267550.2(TTN):c.45598G>A (p.Ala15200Thr) rs752318420
NM_001267550.2(TTN):c.45615T>A (p.Ile15205=) rs570314896
NM_001267550.2(TTN):c.45630C>T (p.Ile15210=)
NM_001267550.2(TTN):c.45631G>A (p.Val15211Ile) rs1387120198
NM_001267550.2(TTN):c.45673G>A (p.Val15225Ile)
NM_001267550.2(TTN):c.45760A>T (p.Ile15254Phe) rs72677226
NM_001267550.2(TTN):c.45779T>C (p.Leu15260Pro) rs552053581
NM_001267550.2(TTN):c.45994C>T (p.Leu15332=) rs765663809
NM_001267550.2(TTN):c.46035C>T (p.Asn15345=)
NM_001267550.2(TTN):c.46147G>C (p.Glu15383Gln) rs773073914
NM_001267550.2(TTN):c.46222G>A (p.Ala15408Thr) rs730880239
NM_001267550.2(TTN):c.46351G>T (p.Asp15451Tyr)
NM_001267550.2(TTN):c.46353T>C (p.Asp15451=) rs373160538
NM_001267550.2(TTN):c.46429+12G>A rs1057524124
NM_001267550.2(TTN):c.46429+8T>C rs1392048853
NM_001267550.2(TTN):c.46451G>A (p.Arg15484Lys) rs72677229
NM_001267550.2(TTN):c.46569T>C (p.Asp15523=) rs1553713980
NM_001267550.2(TTN):c.46580T>A (p.Met15527Lys) rs77496539
NM_001267550.2(TTN):c.46677A>G (p.Arg15559=) rs1057522659
NM_001267550.2(TTN):c.46693G>T (p.Ala15565Ser) rs145520397
NM_001267550.2(TTN):c.46697-14A>C rs371310030
NM_001267550.2(TTN):c.46697-19_46697-18del rs530484268
NM_001267550.2(TTN):c.46823T>C (p.Leu15608Ser) rs397517588
NM_001267550.2(TTN):c.46880C>T (p.Ala15627Val) rs115813214
NM_001267550.2(TTN):c.46884G>A (p.Lys15628=) rs760251812
NM_001267550.2(TTN):c.46928A>G (p.His15643Arg) rs368502650
NM_001267550.2(TTN):c.47077G>A (p.Val15693Ile) rs201717871
NM_001267550.2(TTN):c.47128C>T (p.Arg15710Cys) rs370669650
NM_001267550.2(TTN):c.47129G>A (p.Arg15710His)
NM_001267550.2(TTN):c.47133A>G (p.Ala15711=) rs573218266
NM_001267550.2(TTN):c.47191C>T (p.Arg15731Cys) rs72677231
NM_001267550.2(TTN):c.47196G>C (p.Val15732=) rs369979598
NM_001267550.2(TTN):c.47248G>A (p.Val15750Ile) rs72677232
NM_001267550.2(TTN):c.47316A>G (p.Arg15772=) rs367818218
NM_001267550.2(TTN):c.47458G>C (p.Val15820Leu) rs1553710237
NM_001267550.2(TTN):c.47481G>A (p.Gln15827=)
NM_001267550.2(TTN):c.47513G>A (p.Arg15838Gln) rs199640194
NM_001267550.2(TTN):c.47573-62C>T
NM_001267550.2(TTN):c.47598A>G (p.Leu15866=) rs879099244
NM_001267550.2(TTN):c.47712T>C (p.Asp15904=) rs1397706325
NM_001267550.2(TTN):c.47767G>A (p.Gly15923Arg) rs371943746
NM_001267550.2(TTN):c.47859C>T (p.Thr15953=) rs769989672
NM_001267550.2(TTN):c.47936C>T (p.Pro15979Leu) rs184815126
NM_001267550.2(TTN):c.47998G>C (p.Asp16000His) rs201388509
NM_001267550.2(TTN):c.48021C>T (p.Asp16007=) rs368404578
NM_001267550.2(TTN):c.48054C>T (p.Ala16018=) rs779940754
NM_001267550.2(TTN):c.48143T>C (p.Ile16048Thr) rs749678590
NM_001267550.2(TTN):c.48161-4del rs730880371
NM_001267550.2(TTN):c.48268T>A (p.Tyr16090Asn) rs1553706860
NM_001267550.2(TTN):c.48270C>T (p.Tyr16090=) rs397517592
NM_001267550.2(TTN):c.48271G>A (p.Val16091Ile) rs369143612
NM_001267550.2(TTN):c.48312+173A>G
NM_001267550.2(TTN):c.48394C>T (p.Arg16132Cys) rs2303830
NM_001267550.2(TTN):c.48451A>G (p.Thr16151Ala) rs186497293
NM_001267550.2(TTN):c.48462G>A (p.Thr16154=) rs202141158
NM_001267550.2(TTN):c.48478G>A (p.Glu16160Lys)
NM_001267550.2(TTN):c.48509A>G (p.Asn16170Ser) rs370809363
NM_001267550.2(TTN):c.48589C>T (p.Arg16197Cys) rs748917057
NM_001267550.2(TTN):c.48683G>A (p.Arg16228His) rs368806005
NM_001267550.2(TTN):c.48760+11T>C rs759878678
NM_001267550.2(TTN):c.48768A>G (p.Pro16256=)
NM_001267550.2(TTN):c.48781G>A (p.Asp16261Asn) rs764203042
NM_001267550.2(TTN):c.48783T>C (p.Asp16261=) rs574915586
NM_001267550.2(TTN):c.48843C>T (p.Thr16281=) rs547682223
NM_001267550.2(TTN):c.48849C>T (p.Thr16283=) rs768147224
NM_001267550.2(TTN):c.48915T>A (p.Ile16305=) rs752761527
NM_001267550.2(TTN):c.48952A>G (p.Ile16318Val) rs962564634
NM_001267550.2(TTN):c.48960T>C (p.Asp16320=) rs1057523898
NM_001267550.2(TTN):c.49015C>T (p.Arg16339Trp) rs201793958
NM_001267550.2(TTN):c.49049-6A>T rs1012199109
NM_001267550.2(TTN):c.49152A>C (p.Thr16384=)
NM_001267550.2(TTN):c.49213G>A (p.Val16405Ile)
NM_001267550.2(TTN):c.49287C>T (p.Asn16429=) rs763809932
NM_001267550.2(TTN):c.49357C>A (p.Pro16453Thr) rs200121902
NM_001267550.2(TTN):c.49366C>T (p.Arg16456Cys) rs727504986
NM_001267550.2(TTN):c.49367G>A (p.Arg16456His) rs768914789
NM_001267550.2(TTN):c.49406T>A (p.Leu16469His) rs72677245
NM_001267550.2(TTN):c.49449A>G (p.Thr16483=) rs769061694
NM_001267550.2(TTN):c.49533-7A>G rs747701799
NM_001267550.2(TTN):c.49648+13T>A rs368996176
NM_001267550.2(TTN):c.49649-11T>C rs727504474
NM_001267550.2(TTN):c.49758T>C (p.Tyr16586=) rs72677247
NM_001267550.2(TTN):c.49795G>A (p.Val16599Ile) rs1553699620
NM_001267550.2(TTN):c.49806G>A (p.Ala16602=)
NM_001267550.2(TTN):c.49812G>T (p.Gly16604=) rs760032120
NM_001267550.2(TTN):c.50059A>G (p.Ile16687Val) rs727504194
NM_001267550.2(TTN):c.50083C>A (p.Arg16695=) rs751502842
NM_001267550.2(TTN):c.50121C>T (p.Asp16707=)
NM_001267550.2(TTN):c.50157T>C (p.Ser16719=) rs566449160
NM_001267550.2(TTN):c.50185A>G (p.Asn16729Asp) rs794729238
NM_001267550.2(TTN):c.50212G>A (p.Glu16738Lys) rs148018042
NM_001267550.2(TTN):c.5022C>G (p.Ala1674=) rs753444772
NM_001267550.2(TTN):c.50248+6C>G rs1057524622
NM_001267550.2(TTN):c.50254C>G (p.Pro16752Ala) rs938347047
NM_001267550.2(TTN):c.50268C>T (p.Tyr16756=) rs748836778
NM_001267550.2(TTN):c.50337T>G (p.Gly16779=) rs983630096
NM_001267550.2(TTN):c.50351A>G (p.Gln16784Arg) rs765976576
NM_001267550.2(TTN):c.50354+10G>T rs772647911
NM_001267550.2(TTN):c.50355-15T>C rs757425897
NM_001267550.2(TTN):c.50363T>C (p.Ile16788Thr) rs397517599
NM_001267550.2(TTN):c.50390G>A (p.Arg16797His) rs200835354
NM_001267550.2(TTN):c.50400A>T (p.Lys16800Asn) rs794729239
NM_001267550.2(TTN):c.50452G>A (p.Glu16818Lys) rs397517600
NM_001267550.2(TTN):c.50480G>A (p.Arg16827Gln) rs138896856
NM_001267550.2(TTN):c.50551+11C>G rs1169808515
NM_001267550.2(TTN):c.50551+9T>C rs370798229
NM_001267550.2(TTN):c.50551A>G (p.Ser16851Gly) rs1405972121
NM_001267550.2(TTN):c.50714G>A (p.Arg16905His) rs191539637
NM_001267550.2(TTN):c.50758C>G (p.Pro16920Ala) rs377289817
NM_001267550.2(TTN):c.50858-3C>T rs587782987
NM_001267550.2(TTN):c.50870T>C (p.Ile16957Thr)
NM_001267550.2(TTN):c.50891T>C (p.Ile16964Thr) rs794729453
NM_001267550.2(TTN):c.50954C>T (p.Thr16985Ile) rs116765281
NM_001267550.2(TTN):c.51015T>C (p.Asn17005=) rs752077995
NM_001267550.2(TTN):c.51066C>T (p.Ala17022=) rs762091746
NM_001267550.2(TTN):c.5109A>G (p.Pro1703=) rs781287476
NM_001267550.2(TTN):c.51256C>T (p.Arg17086Cys)
NM_001267550.2(TTN):c.51270_51272GAG[1] (p.Arg17092del)
NM_001267550.2(TTN):c.51273G>A (p.Arg17091=) rs532589236
NM_001267550.2(TTN):c.51483G>A (p.Ala17161=) rs397517604
NM_001267550.2(TTN):c.51527G>C (p.Gly17176Ala) rs768961892
NM_001267550.2(TTN):c.51606A>G (p.Val17202=) rs375685343
NM_001267550.2(TTN):c.51681C>T (p.Ala17227=) rs367779216
NM_001267550.2(TTN):c.516G>A (p.Gly172=) rs747789397
NM_001267550.2(TTN):c.51739+20G>A rs571361599
NM_001267550.2(TTN):c.51740-17G>T rs1271846679
NM_001267550.2(TTN):c.51809G>T (p.Ser17270Ile) rs200650668
NM_001267550.2(TTN):c.51887G>A (p.Arg17296His) rs200456782
NM_001267550.2(TTN):c.52004G>A (p.Arg17335His) rs367603302
NM_001267550.2(TTN):c.52022G>A (p.Arg17341Gln) rs370390570
NM_001267550.2(TTN):c.52086T>C (p.Cys17362=) rs1057523625
NM_001267550.2(TTN):c.52144A>G (p.Arg17382Gly) rs397517607
NM_001267550.2(TTN):c.52199A>C (p.Glu17400Ala) rs773027240
NM_001267550.2(TTN):c.52290T>C (p.Tyr17430=) rs990974705
NM_001267550.2(TTN):c.52317A>G (p.Lys17439=) rs370450339
NM_001267550.2(TTN):c.52331G>A (p.Arg17444His) rs376080116
NM_001267550.2(TTN):c.52374T>C (p.Val17458=) rs752571545
NM_001267550.2(TTN):c.52405+19C>G rs1553689081
NM_001267550.2(TTN):c.52449C>T (p.Thr17483=)
NM_001267550.2(TTN):c.52542A>G (p.Thr17514=)
NM_001267550.2(TTN):c.5255G>A (p.Arg1752His) rs150737838
NM_001267550.2(TTN):c.52596T>C (p.Asp17532=) rs761084280
NM_001267550.2(TTN):c.52705+10T>C rs1553687969
NM_001267550.2(TTN):c.52852C>T (p.Arg17618Cys) rs201213901
NM_001267550.2(TTN):c.52890C>T (p.Thr17630=) rs374228930
NM_001267550.2(TTN):c.52920C>T (p.Tyr17640=) rs1553687219
NM_001267550.2(TTN):c.52927C>T (p.Arg17643Trp) rs375944265
NM_001267550.2(TTN):c.5295C>T (p.Gly1765=) rs145999395
NM_001267550.2(TTN):c.5296G>A (p.Val1766Ile) rs149494502
NM_001267550.2(TTN):c.53012C>T (p.Ala17671Val) rs549478203
NM_001267550.2(TTN):c.53055G>A (p.Met17685Ile) rs200387466
NM_001267550.2(TTN):c.53096G>A (p.Arg17699His) rs72646808
NM_001267550.2(TTN):c.53122_53123delinsGT (p.Lys17708Val) rs886042743
NM_001267550.2(TTN):c.53142T>C (p.Asp17714=) rs373316165
NM_001267550.2(TTN):c.53150G>A (p.Arg17717His)
NM_001267550.2(TTN):c.53154T>C (p.Val17718=) rs990097785
NM_001267550.2(TTN):c.53229G>A (p.Val17743=) rs376469717
NM_001267550.2(TTN):c.53260T>C (p.Phe17754Leu) rs397517612
NM_001267550.2(TTN):c.53295T>C (p.Pro17765=) rs771792080
NM_001267550.2(TTN):c.53300C>T (p.Pro17767Leu)
NM_001267550.2(TTN):c.53443A>G (p.Ile17815Val) rs368065637
NM_001267550.2(TTN):c.53592A>G (p.Thr17864=) rs397517613
NM_001267550.2(TTN):c.53625A>G (p.Thr17875=) rs373277508
NM_001267550.2(TTN):c.53678C>G (p.Pro17893Arg)
NM_001267550.2(TTN):c.53717A>G (p.Lys17906Arg) rs727503606
NM_001267550.2(TTN):c.53730A>G (p.Glu17910=) rs1057523995
NM_001267550.2(TTN):c.53732G>T (p.Arg17911Ile)
NM_001267550.2(TTN):c.53780T>C (p.Leu17927Pro) rs369678018
NM_001267550.2(TTN):c.53881+15T>A
NM_001267550.2(TTN):c.53976C>G (p.Gly17992=) rs1553682339
NM_001267550.2(TTN):c.54068G>A (p.Arg18023Gln) rs727503603
NM_001267550.2(TTN):c.54109C>T (p.Arg18037Trp) rs201623791
NM_001267550.2(TTN):c.54140C>T (p.Ala18047Val) rs373815064
NM_001267550.2(TTN):c.54148C>T (p.Arg18050Cys) rs55734111
NM_001267550.2(TTN):c.54160G>C (p.Val18054Leu) rs200968679
NM_001267550.2(TTN):c.54190+17C>G rs759925759
NM_001267550.2(TTN):c.54194G>A (p.Arg18065His) rs375895183
NM_001267550.2(TTN):c.54378T>C (p.Tyr18126=)
NM_001267550.2(TTN):c.54383T>G (p.Ile18128Ser)
NM_001267550.2(TTN):c.54477C>G (p.Val18159=) rs374335905
NM_001267550.2(TTN):c.54489T>G (p.Pro18163=) rs1010205941
NM_001267550.2(TTN):c.5464A>C (p.Met1822Leu) rs201581947
NM_001267550.2(TTN):c.54710T>C (p.Leu18237Pro) rs201412693
NM_001267550.2(TTN):c.54771C>T (p.Pro18257=) rs190716158
NM_001267550.2(TTN):c.5479G>T (p.Ala1827Ser) rs141213991
NM_001267550.2(TTN):c.54811+10C>T rs796651993
NM_001267550.2(TTN):c.54811+15G>A rs201450276
NM_001267550.2(TTN):c.54811+298T>G
NM_001267550.2(TTN):c.54811+8T>C rs747409403
NM_001267550.2(TTN):c.54812-13C>T rs754778370
NM_001267550.2(TTN):c.54818C>T (p.Pro18273Leu) rs201035511
NM_001267550.2(TTN):c.54855G>A (p.Thr18285=) rs200410212
NM_001267550.2(TTN):c.54874G>C (p.Gly18292Arg) rs377512675
NM_001267550.2(TTN):c.54947C>G (p.Thr18316Ser) rs758527900
NM_001267550.2(TTN):c.55005G>A (p.Val18335=) rs1057522129
NM_001267550.2(TTN):c.5503C>A (p.Gln1835Lys) rs537070177
NM_001267550.2(TTN):c.55079C>T (p.Pro18360Leu) rs192788942
NM_001267550.2(TTN):c.55143C>T (p.Asp18381=) rs1057522461
NM_001267550.2(TTN):c.55145T>G (p.Ile18382Ser) rs1553675010
NM_001267550.2(TTN):c.55206C>A (p.Ile18402=) rs368272978
NM_001267550.2(TTN):c.55270-38G>A
NM_001267550.2(TTN):c.55290C>T (p.Pro18430=) rs777904054
NM_001267550.2(TTN):c.55354T>C (p.Ser18452Pro) rs372541479
NM_001267550.2(TTN):c.55374C>G (p.Ser18458Arg) rs200550947
NM_001267550.2(TTN):c.55380A>G (p.Thr18460=) rs1553673472
NM_001267550.2(TTN):c.55417A>G (p.Arg18473Gly) rs72646822
NM_001267550.2(TTN):c.55420G>A (p.Val18474Ile) rs779583004
NM_001267550.2(TTN):c.55432+19G>A rs1213547538
NM_001267550.2(TTN):c.55433A>C (p.Asp18478Ala) rs794729240
NM_001267550.2(TTN):c.55449C>T (p.Pro18483=) rs187366691
NM_001267550.2(TTN):c.55503G>A (p.Lys18501=) rs879239475
NM_001267550.2(TTN):c.55555A>C (p.Arg18519=) rs879182051
NM_001267550.2(TTN):c.55673G>A (p.Arg18558His) rs115867512
NM_001267550.2(TTN):c.55709G>A (p.Arg18570Lys)
NM_001267550.2(TTN):c.55738C>T (p.Pro18580Ser)
NM_001267550.2(TTN):c.55750A>G (p.Ile18584Val) rs760979964
NM_001267550.2(TTN):c.55758C>G (p.Leu18586=) rs1553671369
NM_001267550.2(TTN):c.55925T>A (p.Leu18642Gln) rs140714512
NM_001267550.2(TTN):c.55929A>G (p.Gln18643=) rs151335428
NM_001267550.2(TTN):c.56050+20C>T rs372268675
NM_001267550.2(TTN):c.56100C>T (p.Thr18700=) rs774106489
NM_001267550.2(TTN):c.56106T>G (p.Val18702=) rs371043153
NM_001267550.2(TTN):c.56142G>A (p.Pro18714=) rs758771859
NM_001267550.2(TTN):c.56178T>A (p.Pro18726=) rs767060880
NM_001267550.2(TTN):c.561G>A (p.Ser187=) rs141444282
NM_001267550.2(TTN):c.56256G>A (p.Pro18752=) rs111262307
NM_001267550.2(TTN):c.56264G>A (p.Arg18755His) rs772767570
NM_001267550.2(TTN):c.56314A>G (p.Thr18772Ala) rs964263107
NM_001267550.2(TTN):c.56351G>A (p.Arg18784His) rs771284532
NM_001267550.2(TTN):c.56376A>G (p.Ile18792Met) rs794729241
NM_001267550.2(TTN):c.56454A>C (p.Thr18818=) rs374058011
NM_001267550.2(TTN):c.56456A>G (p.Asn18819Ser)
NM_001267550.2(TTN):c.56461G>A (p.Val18821Ile)
NM_001267550.2(TTN):c.56497G>A (p.Val18833Ile) rs1553665072
NM_001267550.2(TTN):c.56532C>T (p.Tyr18844=) rs1345899259
NM_001267550.2(TTN):c.56535G>A (p.Thr18845=) rs529480368
NM_001267550.2(TTN):c.56686G>A (p.Val18896Met) rs370629962
NM_001267550.2(TTN):c.5668C>T (p.Arg1890Cys) rs146496197
NM_001267550.2(TTN):c.56754G>T (p.Gly18918=) rs1057523877
NM_001267550.2(TTN):c.56800G>C (p.Val18934Leu)
NM_001267550.2(TTN):c.56807G>A (p.Arg18936Gln) rs745914315
NM_001267550.2(TTN):c.56963-18T>C rs187501574
NM_001267550.2(TTN):c.56963-19G>T rs369216122
NM_001267550.2(TTN):c.56963-3C>T rs375979145
NM_001267550.2(TTN):c.57015A>G (p.Ala19005=) rs372661513
NM_001267550.2(TTN):c.57073G>A (p.Val19025Ile) rs181957743
NM_001267550.2(TTN):c.57112-14T>C rs777473081
NM_001267550.2(TTN):c.57112-4C>T rs117072049
NM_001267550.2(TTN):c.57262+15T>G rs370875441
NM_001267550.2(TTN):c.57300T>C (p.Asp19100=) rs876658069
NM_001267550.2(TTN):c.57369C>T (p.Thr19123=) rs199742163
NM_001267550.2(TTN):c.57370G>A (p.Val19124Ile) rs142841000
NM_001267550.2(TTN):c.5740G>A (p.Ala1914Thr) rs118161093
NM_001267550.2(TTN):c.5741C>T (p.Ala1914Val) rs374203813
NM_001267550.2(TTN):c.5742G>A (p.Ala1914=) rs368719553
NM_001267550.2(TTN):c.57449T>C (p.Ile19150Thr) rs1553659483
NM_001267550.2(TTN):c.57501T>C (p.Asn19167=) rs780536141
NM_001267550.2(TTN):c.57585C>T (p.Asn19195=) rs1057523577
NM_001267550.2(TTN):c.57586C>G (p.Leu19196Val) rs397517630
NM_001267550.2(TTN):c.57594T>A (p.Asn19198Lys) rs367606284
NM_001267550.2(TTN):c.57646A>G (p.Ile19216Val) rs374058726
NM_001267550.2(TTN):c.57682C>T (p.Arg19228Cys)
NM_001267550.2(TTN):c.57808G>C (p.Val19270Leu) rs369440319
NM_001267550.2(TTN):c.57816A>G (p.Thr19272=) rs928567222
NM_001267550.2(TTN):c.57849T>C (p.Thr19283=) rs989489157
NM_001267550.2(TTN):c.57860G>A (p.Arg19287His) rs371422299
NM_001267550.2(TTN):c.57933T>C (p.Asp19311=) rs554555894
NM_001267550.2(TTN):c.57956A>G (p.Tyr19319Cys)
NM_001267550.2(TTN):c.57971G>A (p.Arg19324Gln) rs186809500
NM_001267550.2(TTN):c.57990G>A (p.Lys19330=) rs773467310
NM_001267550.2(TTN):c.58072C>T (p.Arg19358Cys) rs371973579
NM_001267550.2(TTN):c.58122C>G (p.Thr19374=) rs189818369
NM_001267550.2(TTN):c.58137C>T (p.Cys19379=) rs376310289
NM_001267550.2(TTN):c.58150+10T>C rs397517635
NM_001267550.2(TTN):c.58150+17A>G rs779666540
NM_001267550.2(TTN):c.58182T>C (p.Asp19394=)
NM_001267550.2(TTN):c.58190C>T (p.Thr19397Met) rs373527448
NM_001267550.2(TTN):c.58205A>G (p.Glu19402Gly) rs886042539
NM_001267550.2(TTN):c.58226G>A (p.Arg19409His) rs201505306
NM_001267550.2(TTN):c.58299T>G (p.Thr19433=) rs778334134
NM_001267550.2(TTN):c.58329T>C (p.Ala19443=) rs766693145
NM_001267550.2(TTN):c.58362C>T (p.Ser19454=) rs374998127
NM_001267550.2(TTN):c.584-4A>G rs868433615
NM_001267550.2(TTN):c.5847T>C (p.Phe1949=) rs879049862
NM_001267550.2(TTN):c.5850C>T (p.His1950=) rs1057523471
NM_001267550.2(TTN):c.58612A>G (p.Thr19538Ala) rs200017524
NM_001267550.2(TTN):c.58616G>T (p.Cys19539Phe) rs539868284
NM_001267550.2(TTN):c.58841T>C (p.Ile19614Thr) rs199933004
NM_001267550.2(TTN):c.58857A>C (p.Glu19619Asp) rs368026488
NM_001267550.2(TTN):c.58867A>G (p.Lys19623Glu) rs794729242
NM_001267550.2(TTN):c.5896A>G (p.Arg1966Gly) rs1554006161
NM_001267550.2(TTN):c.58971A>C (p.Glu19657Asp) rs200728232
NM_001267550.2(TTN):c.59074A>G (p.Thr19692Ala) rs771977738
NM_001267550.2(TTN):c.59092G>C (p.Asp19698His) rs397517642
NM_001267550.2(TTN):c.59172T>C (p.Asp19724=) rs1373178934
NM_001267550.2(TTN):c.59282A>G (p.Asn19761Ser) rs563969986
NM_001267550.2(TTN):c.59315C>T (p.Pro19772Leu) rs72646840
NM_001267550.2(TTN):c.59316G>A (p.Pro19772=) rs377180286
NM_001267550.2(TTN):c.59318A>G (p.Glu19773Gly) rs371719028
NM_001267550.2(TTN):c.59442A>G (p.Pro19814=)
NM_001267550.2(TTN):c.59534G>A (p.Arg19845His) rs201457934
NM_001267550.2(TTN):c.595G>A (p.Val199Ile) rs794729254
NM_001267550.2(TTN):c.59626+10T>G
NM_001267550.2(TTN):c.59729C>T (p.Thr19910Ile) rs369476725
NM_001267550.2(TTN):c.59736T>C (p.Tyr19912=)
NM_001267550.2(TTN):c.5973T>A (p.Pro1991=) rs1554005997
NM_001267550.2(TTN):c.597A>G (p.Val199=) rs144214844
NM_001267550.2(TTN):c.59812G>A (p.Ala19938Thr)
NM_001267550.2(TTN):c.5982G>A (p.Ser1994=) rs573823772
NM_001267550.2(TTN):c.59927-19T>A rs772730956
NM_001267550.2(TTN):c.59927-20A>G rs762347403
NM_001267550.2(TTN):c.59965G>A (p.Val19989Ile)
NM_001267550.2(TTN):c.60008G>A (p.Arg20003His) rs756091180
NM_001267550.2(TTN):c.60025A>G (p.Ile20009Val) rs371988490
NM_001267550.2(TTN):c.60120A>G (p.Leu20040=) rs878854323
NM_001267550.2(TTN):c.60138T>C (p.Tyr20046=) rs1215527173
NM_001267550.2(TTN):c.60381T>A (p.Val20127=) rs570215155
NM_001267550.2(TTN):c.60471C>T (p.Ala20157=) rs397517645
NM_001267550.2(TTN):c.60654G>A (p.Thr20218=) rs776141268
NM_001267550.2(TTN):c.60721G>C (p.Glu20241Gln) rs200212521
NM_001267550.2(TTN):c.6075A>C (p.Glu2025Asp) rs778940741
NM_001267550.2(TTN):c.60782C>T (p.Thr20261Ile)
NM_001267550.2(TTN):c.60963C>T (p.Asn20321=) rs776977331
NM_001267550.2(TTN):c.60976G>A (p.Ala20326Thr) rs370995867
NM_001267550.2(TTN):c.61073C>T (p.Pro20358Leu) rs751194376
NM_001267550.2(TTN):c.61098C>T (p.Cys20366=) rs755233818
NM_001267550.2(TTN):c.61121C>T (p.Pro20374Leu)
NM_001267550.2(TTN):c.61322A>G (p.Asn20441Ser) rs147580753
NM_001267550.2(TTN):c.61332A>G (p.Arg20444=) rs758056865
NM_001267550.2(TTN):c.61355T>A (p.Ile20452Asn) rs375946418
NM_001267550.2(TTN):c.61483C>G (p.Arg20495Gly)
NM_001267550.2(TTN):c.61500C>A (p.Val20500=) rs1057522407
NM_001267550.2(TTN):c.61588C>A (p.Pro20530Thr) rs755700079
NM_001267550.2(TTN):c.61674C>T (p.Ala20558=) rs892095487
NM_001267550.2(TTN):c.61690G>A (p.Val20564Ile)
NM_001267550.2(TTN):c.61825C>T (p.Arg20609Cys) rs786205389
NM_001267550.2(TTN):c.61922G>A (p.Arg20641Gln) rs199895260
NM_001267550.2(TTN):c.61943T>G (p.Val20648Gly)
NM_001267550.2(TTN):c.61963G>A (p.Glu20655Lys)
NM_001267550.2(TTN):c.61991A>T (p.Asn20664Ile) rs1214786970
NM_001267550.2(TTN):c.62098A>G (p.Asn20700Asp) rs151193056
NM_001267550.2(TTN):c.62137G>A (p.Asp20713Asn) rs1177521349
NM_001267550.2(TTN):c.62147A>T (p.Glu20716Val) rs794729243
NM_001267550.2(TTN):c.62149A>G (p.Arg20717Gly) rs75458912
NM_001267550.2(TTN):c.62280T>C (p.Val20760=) rs372065796
NM_001267550.2(TTN):c.62298A>G (p.Leu20766=) rs368503103
NM_001267550.2(TTN):c.62317C>A (p.Leu20773Met) rs375173874
NM_001267550.2(TTN):c.62424C>T (p.Asp20808=) rs374472044
NM_001267550.2(TTN):c.62432A>G (p.Asp20811Gly) rs72646849
NM_001267550.2(TTN):c.62468G>A (p.Arg20823His) rs758019778
NM_001267550.2(TTN):c.62507G>A (p.Arg20836Gln) rs201693851
NM_001267550.2(TTN):c.62510G>C (p.Ser20837Thr)
NM_001267550.2(TTN):c.62511T>C (p.Ser20837=) rs369467841
NM_001267550.2(TTN):c.62572A>G (p.Thr20858Ala) rs200689750
NM_001267550.2(TTN):c.62673T>C (p.Asp20891=) rs374354363
NM_001267550.2(TTN):c.6267G>C (p.Val2089=)
NM_001267550.2(TTN):c.62703A>G (p.Leu20901=) rs749180542
NM_001267550.2(TTN):c.62891C>A (p.Pro20964His) rs548460016
NM_001267550.2(TTN):c.62918C>T (p.Thr20973Ile) rs1553639678
NM_001267550.2(TTN):c.62939T>A (p.Met20980Lys) rs757789191
NM_001267550.2(TTN):c.62970T>C (p.Asp20990=)
NM_001267550.2(TTN):c.62994C>T (p.Tyr20998=) rs375006117
NM_001267550.2(TTN):c.63065G>A (p.Arg21022His) rs727503585
NM_001267550.2(TTN):c.63109C>T (p.Arg21037Cys) rs191549948
NM_001267550.2(TTN):c.63180C>T (p.Asp21060=) rs778030754
NM_001267550.2(TTN):c.63187+20T>C rs1057523652
NM_001267550.2(TTN):c.63210T>C (p.Asn21070=) rs200578829
NM_001267550.2(TTN):c.63273T>C (p.Asp21091=) rs374168580
NM_001267550.2(TTN):c.63287T>A (p.Ile21096Asn) rs558727238
NM_001267550.2(TTN):c.63329C>T (p.Ala21110Val) rs370687831
NM_001267550.2(TTN):c.63352C>T (p.Arg21118Trp) rs200726948
NM_001267550.2(TTN):c.63432G>A (p.Arg21144=) rs776520284
NM_001267550.2(TTN):c.63439G>A (p.Ala21147Thr) rs72646853
NM_001267550.2(TTN):c.63463C>T (p.Arg21155Cys) rs374727686
NM_001267550.2(TTN):c.63483A>G (p.Glu21161=) rs747885095
NM_001267550.2(TTN):c.63589A>G (p.Ile21197Val) rs72646855
NM_001267550.2(TTN):c.6359G>T (p.Arg2120Leu) rs141142920
NM_001267550.2(TTN):c.63743T>C (p.Leu21248Pro) rs745323281
NM_001267550.2(TTN):c.63775G>A (p.Val21259Ile) rs371286595
NM_001267550.2(TTN):c.63793+9del rs771033923
NM_001267550.2(TTN):c.63819A>G (p.Leu21273=) rs944964747
NM_001267550.2(TTN):c.63834C>T (p.Val21278=) rs911870330
NM_001267550.2(TTN):c.63960T>A (p.Val21320=) rs397517655
NM_001267550.2(TTN):c.63981A>G (p.Val21327=) rs397517656
NM_001267550.2(TTN):c.64059T>C (p.Asp21353=) rs377184630
NM_001267550.2(TTN):c.64171C>T (p.Leu21391=) rs371009616
NM_001267550.2(TTN):c.64174C>T (p.Arg21392Cys) rs72646859
NM_001267550.2(TTN):c.64206C>T (p.Ile21402=) rs752270069
NM_001267550.2(TTN):c.64283T>C (p.Val21428Ala)
NM_001267550.2(TTN):c.64338T>C (p.Ala21446=) rs371514555
NM_001267550.2(TTN):c.6438T>G (p.Ser2146=) rs375425113
NM_001267550.2(TTN):c.64443G>A (p.Gly21481=) rs747850027
NM_001267550.2(TTN):c.64455A>G (p.Arg21485=) rs1553633947
NM_001267550.2(TTN):c.64642G>T (p.Asp21548Tyr) rs749070255
NM_001267550.2(TTN):c.64654A>G (p.Ile21552Val) rs201247592
NM_001267550.2(TTN):c.64672+11T>A rs752070307
NM_001267550.2(TTN):c.64673-9T>C rs1370943867
NM_001267550.2(TTN):c.64683C>G (p.Gly21561=) rs542156552
NM_001267550.2(TTN):c.64720G>A (p.Ala21574Thr) rs578085621
NM_001267550.2(TTN):c.64761C>T (p.Asp21587=) rs748386416
NM_001267550.2(TTN):c.64811G>A (p.Arg21604Gln) rs188996850
NM_001267550.2(TTN):c.64860G>A (p.Arg21620=) rs373713828
NM_001267550.2(TTN):c.6489C>T (p.His2163=)
NM_001267550.2(TTN):c.64903C>T (p.Arg21635Cys) rs201614524
NM_001267550.2(TTN):c.6490G>A (p.Ala2164Thr) rs56285559
NM_001267550.2(TTN):c.64959G>A (p.Ala21653=) rs776272431
NM_001267550.2(TTN):c.64973-20T>G
NM_001267550.2(TTN):c.6509-15A>G rs1554004514
NM_001267550.2(TTN):c.65275+14T>G rs1291102348
NM_001267550.2(TTN):c.65276-16C>T rs370634364
NM_001267550.2(TTN):c.65379C>T (p.Phe21793=) rs377017745
NM_001267550.2(TTN):c.65380G>A (p.Val21794Ile)
NM_001267550.2(TTN):c.65388T>G (p.Ala21796=) rs369091096
NM_001267550.2(TTN):c.65459C>T (p.Thr21820Ile) rs56130023
NM_001267550.2(TTN):c.65514C>T (p.Thr21838=) rs372543748
NM_001267550.2(TTN):c.65534C>T (p.Pro21845Leu) rs201662134
NM_001267550.2(TTN):c.65574T>C (p.Asn21858=) rs374858668
NM_001267550.2(TTN):c.65575+18A>G rs1296782954
NM_001267550.2(TTN):c.65633G>C (p.Gly21878Ala) rs767001973
NM_001267550.2(TTN):c.6567C>T (p.Asp2189=) rs879111475
NM_001267550.2(TTN):c.65697A>G (p.Lys21899=) rs879177323
NM_001267550.2(TTN):c.65700T>C (p.Asp21900=) rs772440358
NM_001267550.2(TTN):c.65747G>A (p.Arg21916Gln) rs148849567
NM_001267550.2(TTN):c.65776G>A (p.Val21926Met) rs145527033
NM_001267550.2(TTN):c.6578C>A (p.Thr2193Asn)
NM_001267550.2(TTN):c.65799C>T (p.Asp21933=) rs370123011
NM_001267550.2(TTN):c.65864-13C>A rs368507077
NM_001267550.2(TTN):c.65871G>A (p.Pro21957=) rs771651842
NM_001267550.2(TTN):c.6587G>A (p.Cys2196Tyr) rs878854326
NM_001267550.2(TTN):c.66048C>T (p.Ser22016=) rs997612485
NM_001267550.2(TTN):c.66160+15C>T rs377288086
NM_001267550.2(TTN):c.66161-12_66161-9delCAAT rs758125069
NM_001267550.2(TTN):c.66172C>T (p.Arg22058Cys) rs199643269
NM_001267550.2(TTN):c.66288A>G (p.Glu22096=) rs368297582
NM_001267550.2(TTN):c.66372C>A (p.Thr22124=) rs756981729
NM_001267550.2(TTN):c.66385C>T (p.Arg22129Cys) rs763729258
NM_001267550.2(TTN):c.66430G>A (p.Ala22144Thr) rs183276016
NM_001267550.2(TTN):c.66463+13G>T rs749690571
NM_001267550.2(TTN):c.66463+17G>A rs202244470
NM_001267550.2(TTN):c.66528T>G (p.Ser22176=) rs1553626322
NM_001267550.2(TTN):c.66576C>A (p.Leu22192=) rs187378247
NM_001267550.2(TTN):c.66590G>A (p.Arg22197Gln) rs374656017
NM_001267550.2(TTN):c.66600C>T (p.Ser22200=)
NM_001267550.2(TTN):c.66673G>A (p.Asp22225Asn) rs72646870
NM_001267550.2(TTN):c.66687A>G (p.Gln22229=) rs879004400
NM_001267550.2(TTN):c.66703G>A (p.Val22235Ile) rs751354601
NM_001267550.2(TTN):c.66762C>T (p.Asp22254=) rs1178308561
NM_001267550.2(TTN):c.66778G>C (p.Glu22260Gln) rs553988103
NM_001267550.2(TTN):c.66795G>A (p.Ala22265=)
NM_001267550.2(TTN):c.66844T>C (p.Tyr22282His) rs745992545
NM_001267550.2(TTN):c.66870T>C (p.Pro22290=) rs1024438218
NM_001267550.2(TTN):c.66876G>T (p.Lys22292Asn)
NM_001267550.2(TTN):c.66898G>A (p.Val22300Ile) rs200343420
NM_001267550.2(TTN):c.66917T>C (p.Ile22306Thr) rs397517667
NM_001267550.2(TTN):c.66954C>A (p.Phe22318Leu) rs1282369228
NM_001267550.2(TTN):c.66977A>G (p.Lys22326Arg) rs202125813
NM_001267550.2(TTN):c.66996T>C (p.Tyr22332=) rs397517668
NM_001267550.2(TTN):c.66C>T (p.Thr22=) rs143623862
NM_001267550.2(TTN):c.67058-29C>G
NM_001267550.2(TTN):c.67099T>C (p.Ser22367Pro) rs72646873
NM_001267550.2(TTN):c.67118T>A (p.Val22373Asp) rs774568339
NM_001267550.2(TTN):c.6713C>T (p.Thr2238Met) rs201284459
NM_001267550.2(TTN):c.6714G>A (p.Thr2238=) rs774836314
NM_001267550.2(TTN):c.67322A>G (p.Glu22441Gly) rs201223583
NM_001267550.2(TTN):c.67444C>T (p.Arg22482Trp) rs563233842
NM_001267550.2(TTN):c.67587T>C (p.Asn22529=) rs1057523544
NM_001267550.2(TTN):c.67636+11A>G rs185898410
NM_001267550.2(TTN):c.67636G>A (p.Val22546Met) rs794729244
NM_001267550.2(TTN):c.67716C>G (p.Ile22572Met)
NM_001267550.2(TTN):c.67809G>A (p.Ala22603=) rs548223512
NM_001267550.2(TTN):c.67834G>A (p.Asp22612Asn)
NM_001267550.2(TTN):c.67845A>G (p.Lys22615=)
NM_001267550.2(TTN):c.6791-11A>G rs368202177
NM_001267550.2(TTN):c.6791-202T>C
NM_001267550.2(TTN):c.67984A>T (p.Thr22662Ser)
NM_001267550.2(TTN):c.68082C>T (p.Cys22694=) rs79406408
NM_001267550.2(TTN):c.68140T>C (p.Tyr22714His)
NM_001267550.2(TTN):c.68161G>A (p.Glu22721Lys) rs374492812
NM_001267550.2(TTN):c.68195C>T (p.Ser22732Leu) rs727505352
NM_001267550.2(TTN):c.68199G>A (p.Glu22733=) rs375672522
NM_001267550.2(TTN):c.68208T>A (p.Val22736=) rs727503575
NM_001267550.2(TTN):c.6820C>G (p.Gln2274Glu) rs145649088
NM_001267550.2(TTN):c.68218C>T (p.Pro22740Ser) rs886039082
NM_001267550.2(TTN):c.68271C>T (p.His22757=) rs750271244
NM_001267550.2(TTN):c.68338C>G (p.Leu22780Val) rs878857012
NM_001267550.2(TTN):c.68365T>C (p.Leu22789=) rs933098534
NM_001267550.2(TTN):c.68375G>A (p.Arg22792Lys) rs749459226
NM_001267550.2(TTN):c.68391G>A (p.Pro22797=) rs368985748
NM_001267550.2(TTN):c.68437G>A (p.Glu22813Lys) rs200797552
NM_001267550.2(TTN):c.68449C>A (p.Arg22817=) rs371678190
NM_001267550.2(TTN):c.68458G>C (p.Ala22820Pro) rs72646880
NM_001267550.2(TTN):c.68604C>T (p.Asp22868=) rs750368181
NM_001267550.2(TTN):c.6870A>G (p.Val2290=) rs143578117
NM_001267550.2(TTN):c.68712T>C (p.Thr22904=) rs397517678
NM_001267550.2(TTN):c.68728G>A (p.Gly22910Arg) rs794729245
NM_001267550.2(TTN):c.68792G>A (p.Ser22931Asn) rs201567815
NM_001267550.2(TTN):c.68823C>T (p.Tyr22941=) rs200717463
NM_001267550.2(TTN):c.68825-8C>G
NM_001267550.2(TTN):c.68825-9T>C rs373981349
NM_001267550.2(TTN):c.68981C>T (p.Thr22994Ile) rs183056142
NM_001267550.2(TTN):c.68996C>T (p.Thr22999Ile) rs755306597
NM_001267550.2(TTN):c.69041A>T (p.Asp23014Val)
NM_001267550.2(TTN):c.69044C>T (p.Ala23015Val) rs771710562
NM_001267550.2(TTN):c.69140T>C (p.Val23047Ala)
NM_001267550.2(TTN):c.69231T>C (p.Leu23077=) rs12615797
NM_001267550.2(TTN):c.6927T>C (p.Asn2309=)
NM_001267550.2(TTN):c.69338G>A (p.Arg23113Gln) rs370890454
NM_001267550.2(TTN):c.69383C>A (p.Ser23128Tyr) rs72646882
NM_001267550.2(TTN):c.69393C>T (p.Val23131=) rs727504692
NM_001267550.2(TTN):c.69412+4T>G rs761388922
NM_001267550.2(TTN):c.69508G>A (p.Glu23170Lys)
NM_001267550.2(TTN):c.69575C>T (p.Thr23192Ile) rs1319888327
NM_001267550.2(TTN):c.69630C>T (p.Tyr23210=) rs777602537
NM_001267550.2(TTN):c.69639T>C (p.Arg23213=) rs1487392148
NM_001267550.2(TTN):c.69660A>G (p.Ala23220=) rs371996901
NM_001267550.2(TTN):c.69694G>C (p.Val23232Leu)
NM_001267550.2(TTN):c.6972G>A (p.Thr2324=) rs772147880
NM_001267550.2(TTN):c.69741G>A (p.Pro23247=) rs566393354
NM_001267550.2(TTN):c.69821G>A (p.Gly23274Asp) rs201043950
NM_001267550.2(TTN):c.69822C>T (p.Gly23274=) rs757102551
NM_001267550.2(TTN):c.69828C>T (p.Val23276=) rs55659506
NM_001267550.2(TTN):c.69864A>G (p.Ile23288Met) rs368867993
NM_001267550.2(TTN):c.69876A>C (p.Thr23292=) rs1267766480
NM_001267550.2(TTN):c.69882C>T (p.Thr23294=) rs376056197
NM_001267550.2(TTN):c.69903C>A (p.Phe23301Leu) rs372799151
NM_001267550.2(TTN):c.69904G>A (p.Val23302Ile) rs190421400
NM_001267550.2(TTN):c.69984G>A (p.Ala23328=) rs56052239
NM_001267550.2(TTN):c.70005C>T (p.Ile23335=) rs541680047
NM_001267550.2(TTN):c.70042G>A (p.Ala23348Thr) rs775146212
NM_001267550.2(TTN):c.70056A>G (p.Arg23352=) rs75948012
NM_001267550.2(TTN):c.70086T>C (p.Ile23362=) rs1553614606
NM_001267550.2(TTN):c.70097T>C (p.Val23366Ala) rs372782502
NM_001267550.2(TTN):c.70102A>G (p.Ile23368Val) rs367914610
NM_001267550.2(TTN):c.70131A>G (p.Thr23377=) rs369503828
NM_001267550.2(TTN):c.70250T>C (p.Ile23417Thr) rs201836227
NM_001267550.2(TTN):c.70259C>T (p.Pro23420Leu)
NM_001267550.2(TTN):c.70260G>A (p.Pro23420=) rs72646887
NM_001267550.2(TTN):c.70287C>T (p.Asn23429=) rs757831376
NM_001267550.2(TTN):c.70305G>A (p.Thr23435=) rs397517684
NM_001267550.2(TTN):c.70380G>A (p.Leu23460=) rs185660043
NM_001267550.2(TTN):c.70536G>A (p.Glu23512=) rs1057523375
NM_001267550.2(TTN):c.70538A>G (p.Asn23513Ser) rs1553613561
NM_001267550.2(TTN):c.7058-17C>T
NM_001267550.2(TTN):c.70640G>C (p.Ser23547Thr) rs1553613338
NM_001267550.2(TTN):c.70644C>T (p.Thr23548=) rs148210834
NM_001267550.2(TTN):c.70656A>G (p.Ala23552=) rs372399881
NM_001267550.2(TTN):c.70698C>T (p.Gly23566=) rs1553613149
NM_001267550.2(TTN):c.70785A>G (p.Leu23595=) rs918782056
NM_001267550.2(TTN):c.70824G>T (p.Val23608=) rs1248176732
NM_001267550.2(TTN):c.70833G>A (p.Ala23611=) rs377220635
NM_001267550.2(TTN):c.70851A>G (p.Arg23617=) rs753207751
NM_001267550.2(TTN):c.70864G>A (p.Val23622Ile) rs72646892
NM_001267550.2(TTN):c.70906C>T (p.Arg23636Cys) rs189208539
NM_001267550.2(TTN):c.70952T>G (p.Ile23651Ser) rs149075285
NM_001267550.2(TTN):c.71031A>G (p.Thr23677=) rs749141184
NM_001267550.2(TTN):c.71036G>A (p.Arg23679Lys) rs200144345
NM_001267550.2(TTN):c.71058G>A (p.Ala23686=) rs375183437
NM_001267550.2(TTN):c.71133T>G (p.Ile23711Met) rs1311167365
NM_001267550.2(TTN):c.71149G>T (p.Asp23717Tyr) rs371818894
NM_001267550.2(TTN):c.71241T>C (p.Ser23747=) rs1553611892
NM_001267550.2(TTN):c.71259C>T (p.Asn23753=) rs367685557
NM_001267550.2(TTN):c.71300G>A (p.Arg23767Gln) rs370516890
NM_001267550.2(TTN):c.71305A>G (p.Thr23769Ala)
NM_001267550.2(TTN):c.71305A>T (p.Thr23769Ser) rs776889753
NM_001267550.2(TTN):c.71373T>G (p.Leu23791=) rs56245285
NM_001267550.2(TTN):c.7138T>A (p.Ser2380Thr)
NM_001267550.2(TTN):c.71438T>C (p.Ile23813Thr) rs1304761942
NM_001267550.2(TTN):c.7147A>C (p.Ser2383Arg)
NM_001267550.2(TTN):c.71581T>C (p.Tyr23861His)
NM_001267550.2(TTN):c.71667T>C (p.Ser23889=) rs756824434
NM_001267550.2(TTN):c.7173C>T (p.Asp2391=) rs374509926
NM_001267550.2(TTN):c.71832A>C (p.Lys23944Asn) rs1449315408
NM_001267550.2(TTN):c.71841G>C (p.Lys23947Asn) rs56019808
NM_001267550.2(TTN):c.71844T>C (p.Pro23948=) rs750583121
NM_001267550.2(TTN):c.71879T>C (p.Ile23960Thr) rs568223521
NM_001267550.2(TTN):c.71895C>A (p.Asp23965Glu) rs772655984
NM_001267550.2(TTN):c.71903A>C (p.Asn23968Thr) rs769320596
NM_001267550.2(TTN):c.71922C>T (p.Ala23974=)
NM_001267550.2(TTN):c.71941G>A (p.Glu23981Lys) rs794729246
NM_001267550.2(TTN):c.72001G>A (p.Ala24001Thr) rs180828370
NM_001267550.2(TTN):c.7203T>C (p.Val2401=) rs1345996453
NM_001267550.2(TTN):c.72064G>A (p.Asp24022Asn) rs767886519
NM_001267550.2(TTN):c.72114G>A (p.Thr24038=) rs768064912
NM_001267550.2(TTN):c.72137C>T (p.Ala24046Val) rs146767076
NM_001267550.2(TTN):c.72146T>C (p.Leu24049Pro) rs56399205
NM_001267550.2(TTN):c.72181A>G (p.Met24061Val) rs201482015
NM_001267550.2(TTN):c.72222A>T (p.Ala24074=)
NM_001267550.2(TTN):c.7223A>G (p.Gln2408Arg) rs777244038
NM_001267550.2(TTN):c.7234C>T (p.Leu2412=) rs138749618
NM_001267550.2(TTN):c.72358C>T (p.Leu24120Phe) rs372309164
NM_001267550.2(TTN):c.72379G>A (p.Glu24127Lys) rs149763294
NM_001267550.2(TTN):c.72426A>G (p.Leu24142=)
NM_001267550.2(TTN):c.72475A>G (p.Ile24159Val) rs371764714
NM_001267550.2(TTN):c.72587G>A (p.Arg24196His) rs200317412
NM_001267550.2(TTN):c.72645T>G (p.Leu24215=) rs1218286270
NM_001267550.2(TTN):c.72660T>C (p.Tyr24220=) rs761708999
NM_001267550.2(TTN):c.72723C>G (p.Val24241=) rs372701206
NM_001267550.2(TTN):c.72766A>G (p.Asn24256Asp) rs187868672
NM_001267550.2(TTN):c.72779A>C (p.Glu24260Ala)
NM_001267550.2(TTN):c.72782G>A (p.Arg24261Gln) rs142874389
NM_001267550.2(TTN):c.72803G>A (p.Arg24268His) rs140018785
NM_001267550.2(TTN):c.72819C>T (p.Asn24273=) rs575014550
NM_001267550.2(TTN):c.72826A>T (p.Thr24276Ser) rs373204984
NM_001267550.2(TTN):c.72864A>G (p.Thr24288=) rs879070035
NM_001267550.2(TTN):c.72906T>A (p.Ala24302=) rs773886758
NM_001267550.2(TTN):c.73075A>G (p.Met24359Val) rs1469212493
NM_001267550.2(TTN):c.73168A>G (p.Thr24390Ala) rs182491843
NM_001267550.2(TTN):c.7316G>A (p.Arg2439His) rs142129359
NM_001267550.2(TTN):c.73200T>C (p.Tyr24400=) rs1250752630
NM_001267550.2(TTN):c.73229C>T (p.Pro24410Leu)
NM_001267550.2(TTN):c.73305C>T (p.Arg24435=)
NM_001267550.2(TTN):c.7331-16G>T rs372580840
NM_001267550.2(TTN):c.7331-3C>T rs772008843
NM_001267550.2(TTN):c.73334C>T (p.Thr24445Ile) rs377334665
NM_001267550.2(TTN):c.7339G>A (p.Val2447Met) rs779064962
NM_001267550.2(TTN):c.73449G>T (p.Leu24483=) rs1359097374
NM_001267550.2(TTN):c.73604C>A (p.Ser24535Tyr) rs201804005
NM_001267550.2(TTN):c.73695A>G (p.Ala24565=)
NM_001267550.2(TTN):c.73705G>C (p.Val24569Leu) rs755676676
NM_001267550.2(TTN):c.73710A>C (p.Ala24570=) rs1057523794
NM_001267550.2(TTN):c.73770T>C (p.Tyr24590=) rs201380749
NM_001267550.2(TTN):c.73905C>T (p.Leu24635=) rs754045020
NM_001267550.2(TTN):c.74042A>G (p.Gln24681Arg) rs537071956
NM_001267550.2(TTN):c.7416T>C (p.Asp2472=) rs763423885
NM_001267550.2(TTN):c.74256T>C (p.Asp24752=) rs1553605579
NM_001267550.2(TTN):c.74513G>C (p.Gly24838Ala) rs200723435
NM_001267550.2(TTN):c.74516G>A (p.Ser24839Asn)
NM_001267550.2(TTN):c.7458G>A (p.Lys2486=) rs1554000842
NM_001267550.2(TTN):c.74596A>G (p.Thr24866Ala) rs199784966
NM_001267550.2(TTN):c.74602A>G (p.Ile24868Val) rs72646898
NM_001267550.2(TTN):c.74640G>C (p.Gln24880His) rs755733728
NM_001267550.2(TTN):c.7468C>A (p.Arg2490Ser)
NM_001267550.2(TTN):c.74763C>T (p.Ser24921=) rs371563258
NM_001267550.2(TTN):c.74766G>C (p.Arg24922Ser) rs372814940
NM_001267550.2(TTN):c.747G>A (p.Leu249=) rs1554041576
NM_001267550.2(TTN):c.74860C>T (p.Leu24954Phe) rs202191466
NM_001267550.2(TTN):c.74891C>T (p.Pro24964Leu) rs72646899
NM_001267550.2(TTN):c.74895A>C (p.Gln24965His) rs201512527
NM_001267550.2(TTN):c.74895A>G (p.Gln24965=) rs201512527
NM_001267550.2(TTN):c.7492A>G (p.Thr2498Ala)
NM_001267550.2(TTN):c.74965G>A (p.Val24989Met) rs567800207
NM_001267550.2(TTN):c.74969G>T (p.Gly24990Val) rs794729247
NM_001267550.2(TTN):c.74982G>A (p.Pro24994=) rs375232524
NM_001267550.2(TTN):c.75037C>G (p.Pro25013Ala)
NM_001267550.2(TTN):c.75075T>C (p.Leu25025=) rs1057523530
NM_001267550.2(TTN):c.75192T>C (p.Thr25064=) rs370480927
NM_001267550.2(TTN):c.7524T>C (p.His2508=) rs2291307
NM_001267550.2(TTN):c.75361A>G (p.Ile25121Val) rs199508062
NM_001267550.2(TTN):c.75470G>A (p.Arg25157Gln)
NM_001267550.2(TTN):c.75504T>G (p.Ser25168Arg) rs375204371
NM_001267550.2(TTN):c.75668C>T (p.Thr25223Ile) rs370070176
NM_001267550.2(TTN):c.75682C>T (p.Pro25228Ser) rs377226540
NM_001267550.2(TTN):c.75696T>C (p.Asp25232=) rs199935312
NM_001267550.2(TTN):c.75745C>T (p.Arg25249Cys) rs397517702
NM_001267550.2(TTN):c.75914C>T (p.Pro25305Leu) rs142453163
NM_001267550.2(TTN):c.7594+17C>G rs141299222
NM_001267550.2(TTN):c.7595-7T>C rs754250448
NM_001267550.2(TTN):c.75954G>T (p.Lys25318Asn)
NM_001267550.2(TTN):c.75958T>G (p.Ser25320Ala)
NM_001267550.2(TTN):c.75969T>C (p.Val25323=) rs368759398
NM_001267550.2(TTN):c.75997G>A (p.Gly25333Ser) rs757343393
NM_001267550.2(TTN):c.76017T>C (p.Tyr25339=) rs1057523937
NM_001267550.2(TTN):c.76019T>A (p.Val25340Asp) rs200287703
NM_001267550.2(TTN):c.76122T>C (p.Asp25374=) rs1553602290
NM_001267550.2(TTN):c.7619G>A (p.Arg2540His) rs397517725
NM_001267550.2(TTN):c.7628C>G (p.Thr2543Ser) rs765136135
NM_001267550.2(TTN):c.76341G>A (p.Val25447=) rs1367546444
NM_001267550.2(TTN):c.76374A>T (p.Pro25458=) rs891629905
NM_001267550.2(TTN):c.76482C>T (p.Asp25494=) rs370908118
NM_001267550.2(TTN):c.76527C>T (p.Asp25509=) rs780539951
NM_001267550.2(TTN):c.76531G>A (p.Asp25511Asn)
NM_001267550.2(TTN):c.76645G>A (p.Gly25549Ser) rs181166140
NM_001267550.2(TTN):c.76816G>A (p.Val25606Ile) rs794729501
NM_001267550.2(TTN):c.76952T>C (p.Val25651Ala) rs370768049
NM_001267550.2(TTN):c.76987G>A (p.Asp25663Asn) rs143186270
NM_001267550.2(TTN):c.77073T>C (p.Asp25691=) rs375398118
NM_001267550.2(TTN):c.77166T>C (p.Pro25722=) rs757252494
NM_001267550.2(TTN):c.77216C>G (p.Ala25739Gly) rs56391938
NM_001267550.2(TTN):c.7738A>G (p.Ile2580Val) rs753963679
NM_001267550.2(TTN):c.77403A>C (p.Lys25801Asn)
NM_001267550.2(TTN):c.77460A>C (p.Pro25820=) rs576663532
NM_001267550.2(TTN):c.77471G>A (p.Arg25824His)
NM_001267550.2(TTN):c.77515A>C (p.Lys25839Gln)
NM_001267550.2(TTN):c.77541C>T (p.Thr25847=) rs556181023
NM_001267550.2(TTN):c.7758A>G (p.Ile2586Met) rs556000493
NM_001267550.2(TTN):c.77601A>G (p.Gln25867=) rs777276284
NM_001267550.2(TTN):c.77697A>G (p.Lys25899=)
NM_001267550.2(TTN):c.77706C>T (p.Asp25902=) rs375764395
NM_001267550.2(TTN):c.77716G>A (p.Glu25906Lys) rs56341835
NM_001267550.2(TTN):c.77799A>T (p.Thr25933=) rs727505210
NM_001267550.2(TTN):c.7779T>C (p.Asn2593=) rs776560501
NM_001267550.2(TTN):c.77812T>A (p.Trp25938Arg) rs1052501136
NM_001267550.2(TTN):c.77813G>C (p.Trp25938Ser) rs186681106
NM_001267550.2(TTN):c.77878G>A (p.Glu25960Lys) rs367624488
NM_001267550.2(TTN):c.77901C>T (p.Ala25967=) rs531679006
NM_001267550.2(TTN):c.77907C>T (p.Asn25969=) rs375903820
NM_001267550.2(TTN):c.77913T>C (p.Tyr25971=) rs72648203
NM_001267550.2(TTN):c.77942C>G (p.Pro25981Arg) rs794729505
NM_001267550.2(TTN):c.78027A>G (p.Ile26009Met)
NM_001267550.2(TTN):c.78063C>T (p.Pro26021=) rs72648204
NM_001267550.2(TTN):c.78064G>A (p.Val26022Ile) rs374764110
NM_001267550.2(TTN):c.78130A>G (p.Ile26044Val) rs755172743
NM_001267550.2(TTN):c.78147A>G (p.Gln26049=) rs149127072
NM_001267550.2(TTN):c.7818G>A (p.Ala2606=) rs935809232
NM_001267550.2(TTN):c.78191G>C (p.Arg26064Thr) rs1553596652
NM_001267550.2(TTN):c.78431T>C (p.Ile26144Thr) rs183015944
NM_001267550.2(TTN):c.7845T>G (p.Leu2615=) rs1315019167
NM_001267550.2(TTN):c.78477T>C (p.Tyr26159=) rs371799242
NM_001267550.2(TTN):c.78508G>A (p.Gly26170Ser)
NM_001267550.2(TTN):c.7856-75A>G
NM_001267550.2(TTN):c.78748T>C (p.Leu26250=) rs758482142
NM_001267550.2(TTN):c.7876C>T (p.Leu2626Phe)
NM_001267550.2(TTN):c.78774A>G (p.Arg26258=) rs368270588
NM_001267550.2(TTN):c.78837A>G (p.Val26279=) rs777343548
NM_001267550.2(TTN):c.78892G>A (p.Gly26298Arg) rs72648205
NM_001267550.2(TTN):c.78896T>A (p.Val26299Asp) rs73036377
NM_001267550.2(TTN):c.78906A>C (p.Glu26302Asp) rs534003014
NM_001267550.2(TTN):c.78942T>C (p.Asp26314=) rs560223850
NM_001267550.2(TTN):c.78991C>A (p.Arg26331=) rs779996703
NM_001267550.2(TTN):c.79085T>C (p.Met26362Thr) rs529839486
NM_001267550.2(TTN):c.79101T>C (p.Tyr26367=) rs1057522307
NM_001267550.2(TTN):c.79155G>A (p.Val26385=) rs377618488
NM_001267550.2(TTN):c.79212C>T (p.Thr26404=) rs778020953
NM_001267550.2(TTN):c.79226G>A (p.Arg26409His) rs72648206
NM_001267550.2(TTN):c.79334G>A (p.Arg26445His) rs764254441
NM_001267550.2(TTN):c.79344G>T (p.Val26448=) rs369875680
NM_001267550.2(TTN):c.79443C>T (p.Ala26481=) rs1280023882
NM_001267550.2(TTN):c.79482A>G (p.Ala26494=) rs1350090724
NM_001267550.2(TTN):c.79546G>A (p.Gly26516Ser) rs776256093
NM_001267550.2(TTN):c.7957T>C (p.Leu2653=) rs201837864
NM_001267550.2(TTN):c.79591G>A (p.Glu26531Lys) rs772211147
NM_001267550.2(TTN):c.79612A>G (p.Thr26538Ala) rs150682764
NM_001267550.2(TTN):c.7961G>A (p.Arg2654Lys) rs147207100
NM_001267550.2(TTN):c.79678A>G (p.Lys26560Glu)
NM_001267550.2(TTN):c.79681A>T (p.Ile26561Leu) rs777951468
NM_001267550.2(TTN):c.79685G>A (p.Arg26562Gln)
NM_001267550.2(TTN):c.79698C>T (p.Leu26566=) rs1553588235
NM_001267550.2(TTN):c.79728A>C (p.Ser26576=) rs760955443
NM_001267550.2(TTN):c.79780C>A (p.Leu26594Ile)
NM_001267550.2(TTN):c.79788C>T (p.Ser26596=) rs777989882
NM_001267550.2(TTN):c.79862C>A (p.Thr26621Lys) rs3731746
NM_001267550.2(TTN):c.79863G>A (p.Thr26621=) rs186402008
NM_001267550.2(TTN):c.79883G>A (p.Arg26628Gln) rs201091376
NM_001267550.2(TTN):c.79883G>C (p.Arg26628Pro) rs201091376
NM_001267550.2(TTN):c.79976G>C (p.Gly26659Ala)
NM_001267550.2(TTN):c.80019T>G (p.Ser26673=) rs1347649738
NM_001267550.2(TTN):c.80083G>T (p.Val26695Leu)
NM_001267550.2(TTN):c.80115G>T (p.Glu26705Asp) rs558830502
NM_001267550.2(TTN):c.80209T>A (p.Cys26737Ser) rs566764105
NM_001267550.2(TTN):c.80221A>G (p.Ser26741Gly) rs750048032
NM_001267550.2(TTN):c.80334T>C (p.Ala26778=) rs768739882
NM_001267550.2(TTN):c.80382G>T (p.Gln26794His)
NM_001267550.2(TTN):c.80462C>T (p.Pro26821Leu) rs200489046
NM_001267550.2(TTN):c.80527T>C (p.Leu26843=) rs142004835
NM_001267550.2(TTN):c.80535T>C (p.Ser26845=)
NM_001267550.2(TTN):c.80553C>T (p.Phe26851=) rs189790119
NM_001267550.2(TTN):c.80553_80554delinsTT (p.Arg26852Cys) rs397517716
NM_001267550.2(TTN):c.80554C>T (p.Arg26852Cys) rs185887755
NM_001267550.2(TTN):c.80694A>C (p.Lys26898Asn)
NM_001267550.2(TTN):c.8069C>T (p.Thr2690Ile) rs374620001
NM_001267550.2(TTN):c.80712A>G (p.Ile26904Met) rs773395582
NM_001267550.2(TTN):c.8073C>T (p.Tyr2691=) rs1204725250
NM_001267550.2(TTN):c.80881_80882delinsAA (p.Ala26961Lys)
NM_001267550.2(TTN):c.80905G>A (p.Val26969Ile) rs377667066
NM_001267550.2(TTN):c.80944T>C (p.Phe26982Leu) rs200406978
NM_001267550.2(TTN):c.80967T>C (p.Phe26989=) rs1227731674
NM_001267550.2(TTN):c.80983G>A (p.Glu26995Lys) rs397517719
NM_001267550.2(TTN):c.80997T>C (p.Tyr26999=) rs753036492
NM_001267550.2(TTN):c.8116+19G>T rs13011633
NM_001267550.2(TTN):c.81168T>C (p.Ser27056=)
NM_001267550.2(TTN):c.8117-15T>C rs1553995846
NM_001267550.2(TTN):c.81249A>G (p.Ser27083=) rs1553578905
NM_001267550.2(TTN):c.81299G>A (p.Gly27100Glu)
NM_001267550.2(TTN):c.81472C>G (p.Pro27158Ala) rs200771189
NM_001267550.2(TTN):c.81527G>T (p.Arg27176Leu) rs199726308
NM_001267550.2(TTN):c.81539T>C (p.Ile27180Thr) rs182126530
NM_001267550.2(TTN):c.81565C>T (p.Leu27189=) rs142391957
NM_001267550.2(TTN):c.81762T>C (p.Phe27254=) rs958378883
NM_001267550.2(TTN):c.81816A>C (p.Ala27272=)
NM_001267550.2(TTN):c.8184C>T (p.Val2728=) rs753356474
NM_001267550.2(TTN):c.81856G>A (p.Val27286Ile) rs372784067
NM_001267550.2(TTN):c.81892G>A (p.Asp27298Asn) rs200697681
NM_001267550.2(TTN):c.81899G>A (p.Arg27300His) rs55850344
NM_001267550.2(TTN):c.81938G>A (p.Gly27313Glu) rs199670463
NM_001267550.2(TTN):c.81948T>C (p.Leu27316=) rs886039026
NM_001267550.2(TTN):c.82065T>G (p.Gly27355=) rs1457152868
NM_001267550.2(TTN):c.82077T>G (p.Ser27359=) rs1422013634
NM_001267550.2(TTN):c.82103A>G (p.Asp27368Gly) rs145373396
NM_001267550.2(TTN):c.82235C>A (p.Thr27412Lys) rs201489661
NM_001267550.2(TTN):c.8231G>C (p.Gly2744Ala) rs556908341
NM_001267550.2(TTN):c.82402A>C (p.Lys27468Gln) rs201958805
NM_001267550.2(TTN):c.82448A>G (p.Lys27483Arg) rs937111656
NM_001267550.2(TTN):c.82486G>A (p.Asp27496Asn) rs554231442
NM_001267550.2(TTN):c.82641A>G (p.Glu27547=) rs372153745
NM_001267550.2(TTN):c.82684T>C (p.Tyr27562His) rs376616067
NM_001267550.2(TTN):c.82688G>A (p.Arg27563His) rs118079537
NM_001267550.2(TTN):c.82691C>T (p.Ala27564Val) rs55634791
NM_001267550.2(TTN):c.82692G>A (p.Ala27564=) rs557628408
NM_001267550.2(TTN):c.82754C>A (p.Ser27585Tyr) rs72648215
NM_001267550.2(TTN):c.82776T>C (p.Ser27592=) rs1553571817
NM_001267550.2(TTN):c.82810G>A (p.Gly27604Ser) rs199929362
NM_001267550.2(TTN):c.82933C>T (p.Arg27645Cys) rs751318609
NM_001267550.2(TTN):c.82934G>A (p.Arg27645His) rs766522109
NM_001267550.2(TTN):c.82947C>T (p.Ile27649=)
NM_001267550.2(TTN):c.82964G>A (p.Gly27655Asp) rs373745130
NM_001267550.2(TTN):c.83017C>A (p.Pro27673Thr) rs769343491
NM_001267550.2(TTN):c.83049G>A (p.Lys27683=) rs373522006
NM_001267550.2(TTN):c.83059C>T (p.Leu27687=) rs200992636
NM_001267550.2(TTN):c.83081G>A (p.Arg27694His) rs775499341
NM_001267550.2(TTN):c.83082C>T (p.Arg27694=) rs1250189831
NM_001267550.2(TTN):c.8314G>A (p.Val2772Met) rs143035953
NM_001267550.2(TTN):c.83198T>C (p.Ile27733Thr)
NM_001267550.2(TTN):c.83277T>C (p.Val27759=) rs1341739001
NM_001267550.2(TTN):c.83299C>A (p.Pro27767Thr) rs184643087
NM_001267550.2(TTN):c.83448T>C (p.Ile27816=) rs200867516
NM_001267550.2(TTN):c.83516G>A (p.Arg27839Gln) rs376820301
NM_001267550.2(TTN):c.83580G>A (p.Val27860=) rs200096597
NM_001267550.2(TTN):c.83618T>C (p.Val27873Ala) rs200775919
NM_001267550.2(TTN):c.83630G>T (p.Arg27877Leu)
NM_001267550.2(TTN):c.83660C>A (p.Pro27887Gln)
NM_001267550.2(TTN):c.83742A>G (p.Thr27914=) rs778220693
NM_001267550.2(TTN):c.8381-9T>C rs1026517147
NM_001267550.2(TTN):c.83820C>T (p.Asn27940=) rs727503555
NM_001267550.2(TTN):c.83925G>A (p.Lys27975=) rs1031543708
NM_001267550.2(TTN):c.84148A>G (p.Ile28050Val) rs201348580
NM_001267550.2(TTN):c.84157C>T (p.Leu28053Phe) rs1194981313
NM_001267550.2(TTN):c.84166C>T (p.Pro28056Ser)
NM_001267550.2(TTN):c.8418C>T (p.Ala2806=) rs766197743
NM_001267550.2(TTN):c.84263G>A (p.Ser28088Asn) rs200450022
NM_001267550.2(TTN):c.8434G>C (p.Val2812Leu) rs146636599
NM_001267550.2(TTN):c.84400C>T (p.Arg28134Cys)
NM_001267550.2(TTN):c.84405T>C (p.Tyr28135=) rs756176112
NM_001267550.2(TTN):c.84414C>T (p.Ser28138=) rs965406205
NM_001267550.2(TTN):c.84461C>T (p.Pro28154Leu) rs200350579
NM_001267550.2(TTN):c.84492G>A (p.Val28164=) rs767513604
NM_001267550.2(TTN):c.84591C>T (p.Ser28197=) rs781670887
NM_001267550.2(TTN):c.84640A>G (p.Met28214Val) rs72648221
NM_001267550.2(TTN):c.84650C>T (p.Ser28217Phe) rs888839405
NM_001267550.2(TTN):c.84651C>T (p.Ser28217=) rs377667809
NM_001267550.2(TTN):c.84871C>T (p.Arg28291Cys) rs192152102
NM_001267550.2(TTN):c.84946G>C (p.Glu28316Gln)
NM_001267550.2(TTN):c.84977G>A (p.Arg28326Gln) rs200843338
NM_001267550.2(TTN):c.85029T>A (p.Thr28343=)
NM_001267550.2(TTN):c.85039A>G (p.Ile28347Val) rs1553563774
NM_001267550.2(TTN):c.85068A>G (p.Arg28356=) rs759660682
NM_001267550.2(TTN):c.85072A>T (p.Met28358Leu) rs368069666
NM_001267550.2(TTN):c.85238C>A (p.Thr28413Asn) rs794729248
NM_001267550.2(TTN):c.85367G>C (p.Gly28456Ala) rs1553563240
NM_001267550.2(TTN):c.85389C>T (p.Leu28463=) rs144731702
NM_001267550.2(TTN):c.85435G>A (p.Gly28479Ser)
NM_001267550.2(TTN):c.85443A>G (p.Ala28481=)
NM_001267550.2(TTN):c.85449C>A (p.Ile28483=) rs758811159
NM_001267550.2(TTN):c.85472G>A (p.Arg28491His) rs373129706
NM_001267550.2(TTN):c.85516C>A (p.Gln28506Lys) rs201272728
NM_001267550.2(TTN):c.85541A>T (p.Lys28514Met) rs886055234
NM_001267550.2(TTN):c.8562G>A (p.Gln2854=) rs375056408
NM_001267550.2(TTN):c.85651C>A (p.Pro28551Thr) rs142478636
NM_001267550.2(TTN):c.85723G>A (p.Glu28575Lys) rs760762822
NM_001267550.2(TTN):c.85769G>A (p.Arg28590Gln) rs375667028
NM_001267550.2(TTN):c.85827A>G (p.Arg28609=) rs371952669
NM_001267550.2(TTN):c.85871G>A (p.Arg28624His) rs538641703
NM_001267550.2(TTN):c.85951C>T (p.Leu28651=) rs190729405
NM_001267550.2(TTN):c.85953A>G (p.Leu28651=) rs546573613
NM_001267550.2(TTN):c.86002A>G (p.Ile28668Val) rs72648225
NM_001267550.2(TTN):c.86025G>A (p.Pro28675=) rs369528150
NM_001267550.2(TTN):c.86045C>T (p.Pro28682Leu) rs760467197
NM_001267550.2(TTN):c.86139C>T (p.Ser28713=) rs750163793
NM_001267550.2(TTN):c.86354A>G (p.Asn28785Ser) rs775051962
NM_001267550.2(TTN):c.86355T>C (p.Asn28785=) rs745857020
NM_001267550.2(TTN):c.8641A>C (p.Thr2881Pro) rs546667760
NM_001267550.2(TTN):c.86434A>G (p.Ile28812Val) rs201918596
NM_001267550.2(TTN):c.86463A>G (p.Gly28821=) rs368268066
NM_001267550.2(TTN):c.864C>T (p.His288=)
NM_001267550.2(TTN):c.86511C>T (p.Thr28837=) rs1455136677
NM_001267550.2(TTN):c.86526T>G (p.Val28842=) rs72648226
NM_001267550.2(TTN):c.86535C>T (p.Thr28845=) rs767091592
NM_001267550.2(TTN):c.86700C>T (p.Asn28900=) rs727504793
NM_001267550.2(TTN):c.86704C>T (p.Leu28902Phe)
NM_001267550.2(TTN):c.86723A>G (p.Asn28908Ser) rs377612718
NM_001267550.2(TTN):c.86729_86731AAG[1] (p.Glu28911del) rs727504797
NM_001267550.2(TTN):c.86821+3A>G rs1010541689
NM_001267550.2(TTN):c.86857A>G (p.Ser28953Gly) rs748750008
NM_001267550.2(TTN):c.86883G>A (p.Leu28961=) rs1484822645
NM_001267550.2(TTN):c.86909G>A (p.Gly28970Asp)
NM_001267550.2(TTN):c.86921T>C (p.Ile28974Thr)
NM_001267550.2(TTN):c.86935G>A (p.Val28979Ile) rs201687390
NM_001267550.2(TTN):c.86949A>G (p.Glu28983=) rs375565646
NM_001267550.2(TTN):c.87006T>A (p.Val29002=) rs761762773
NM_001267550.2(TTN):c.87137T>G (p.Met29046Arg) rs143975327
NM_001267550.2(TTN):c.87286A>G (p.Thr29096Ala)
NM_001267550.2(TTN):c.87341G>A (p.Arg29114Lys) rs1253866874
NM_001267550.2(TTN):c.87412C>A (p.Pro29138Thr) rs72648227
NM_001267550.2(TTN):c.8742G>T (p.Trp2914Cys) rs1553994187
NM_001267550.2(TTN):c.87495C>T (p.Asp29165=) rs371763584
NM_001267550.2(TTN):c.87600G>C (p.Met29200Ile) rs750362675
NM_001267550.2(TTN):c.87611C>G (p.Thr29204Arg) rs72648228
NM_001267550.2(TTN):c.87616G>A (p.Glu29206Lys) rs1364550008
NM_001267550.2(TTN):c.87623A>T (p.Tyr29208Phe) rs201831707
NM_001267550.2(TTN):c.87632G>A (p.Arg29211His) rs370948914
NM_001267550.2(TTN):c.87663T>C (p.Ser29221=) rs397517737
NM_001267550.2(TTN):c.8770A>C (p.Ser2924Arg) rs1057523066
NM_001267550.2(TTN):c.87805G>A (p.Val29269Ile) rs727503551
NM_001267550.2(TTN):c.87813C>T (p.Gly29271=) rs751701021
NM_001267550.2(TTN):c.8788G>A (p.Val2930Ile) rs56373393
NM_001267550.2(TTN):c.87908G>T (p.Ser29303Ile)
NM_001267550.2(TTN):c.88009+13C>T rs397517739
NM_001267550.2(TTN):c.88028G>A (p.Arg29343His) rs73036368
NM_001267550.2(TTN):c.88090G>A (p.Gly29364Ser) rs183013408
NM_001267550.2(TTN):c.88112T>C (p.Ile29371Thr) rs767890385
NM_001267550.2(TTN):c.88124G>A (p.Arg29375His)
NM_001267550.2(TTN):c.88186A>C (p.Ile29396Leu) rs1553551617
NM_001267550.2(TTN):c.88246G>T (p.Val29416Phe) rs755325663
NM_001267550.2(TTN):c.88285A>G (p.Ile29429Val) rs373738818
NM_001267550.2(TTN):c.88297G>A (p.Asp29433Asn) rs189202799
NM_001267550.2(TTN):c.88307-15C>T rs727505307
NM_001267550.2(TTN):c.88307-18C>T rs547409426
NM_001267550.2(TTN):c.88340C>G (p.Thr29447Arg) rs140201636
NM_001267550.2(TTN):c.88394C>T (p.Ser29465Phe) rs146181116
NM_001267550.2(TTN):c.8844G>A (p.Ser2948=) rs531976829
NM_001267550.2(TTN):c.88459G>A (p.Val29487Met) rs200899806
NM_001267550.2(TTN):c.88523G>A (p.Ser29508Asn)
NM_001267550.2(TTN):c.88704C>T (p.His29568=) rs370093328
NM_001267550.2(TTN):c.88720C>T (p.Arg29574Cys) rs200513274
NM_001267550.2(TTN):c.88721G>A (p.Arg29574His) rs111727915
NM_001267550.2(TTN):c.88735G>A (p.Val29579Ile) rs879204059
NM_001267550.2(TTN):c.88740G>T (p.Val29580=)
NM_001267550.2(TTN):c.88770G>C (p.Glu29590Asp) rs879152203
NM_001267550.2(TTN):c.88912G>A (p.Gly29638Ser) rs1328502977
NM_001267550.2(TTN):c.88972A>G (p.Ile29658Val) rs200193877
NM_001267550.2(TTN):c.88983C>T (p.Gly29661=) rs371678936
NM_001267550.2(TTN):c.88984G>A (p.Gly29662Ser) rs187460377
NM_001267550.2(TTN):c.8902+12A>T
NM_001267550.2(TTN):c.8902+18T>A rs1057520411
NM_001267550.2(TTN):c.89136C>T (p.Asn29712=) rs376289479
NM_001267550.2(TTN):c.89295T>C (p.Ala29765=) rs375374658
NM_001267550.2(TTN):c.89314G>A (p.Glu29772Lys) rs200503016
NM_001267550.2(TTN):c.89386G>A (p.Val29796Met) rs72648237
NM_001267550.2(TTN):c.8938G>A (p.Ala2980Thr) rs72647885
NM_001267550.2(TTN):c.89426G>A (p.Arg29809Gln) rs72648238
NM_001267550.2(TTN):c.89454A>G (p.Gln29818=) rs1553542694
NM_001267550.2(TTN):c.89457A>G (p.Gly29819=) rs1553542686
NM_001267550.2(TTN):c.8955T>G (p.Thr2985=) rs774980824
NM_001267550.2(TTN):c.89639T>G (p.Leu29880Arg)
NM_001267550.2(TTN):c.89645G>A (p.Ser29882Asn) rs755022770
NM_001267550.2(TTN):c.89721A>C (p.Thr29907=) rs773008865
NM_001267550.2(TTN):c.89760A>C (p.Glu29920Asp) rs747181293
NM_001267550.2(TTN):c.8976G>A (p.Val2992=) rs544348559
NM_001267550.2(TTN):c.89775T>C (p.Thr29925=) rs1057523600
NM_001267550.2(TTN):c.89892A>T (p.Pro29964=) rs1057523342
NM_001267550.2(TTN):c.89906T>C (p.Val29969Ala) rs201220828
NM_001267550.2(TTN):c.89907C>A (p.Val29969=) rs72648241
NM_001267550.2(TTN):c.89946C>T (p.Val29982=) rs373311459
NM_001267550.2(TTN):c.89964T>C (p.Ser29988=) rs1553540821
NM_001267550.2(TTN):c.89984T>C (p.Ile29995Thr) rs754676727
NM_001267550.2(TTN):c.90051A>T (p.Glu30017Asp) rs558277631
NM_001267550.2(TTN):c.90090A>G (p.Val30030=) rs1057522830
NM_001267550.2(TTN):c.90159A>C (p.Lys30053Asn) rs886039117
NM_001267550.2(TTN):c.90186_90188del (p.Thr30063del)
NM_001267550.2(TTN):c.90332T>C (p.Leu30111Pro) rs368516973
NM_001267550.2(TTN):c.90536G>C (p.Arg30179Pro)
NM_001267550.2(TTN):c.90624T>C (p.Asn30208=) rs370479059
NM_001267550.2(TTN):c.90691C>T (p.Pro30231Ser) rs373722546
NM_001267550.2(TTN):c.90711C>T (p.Ile30237=) rs1553539359
NM_001267550.2(TTN):c.90720T>C (p.Asp30240=) rs1553539339
NM_001267550.2(TTN):c.90727A>T (p.Ile30243Phe)
NM_001267550.2(TTN):c.90758_90760GAG[2] (p.Gly30255del) rs748912340
NM_001267550.2(TTN):c.9077A>T (p.Asn3026Ile) rs11900987
NM_001267550.2(TTN):c.90793C>T (p.Arg30265Trp) rs200022152
NM_001267550.2(TTN):c.90882G>A (p.Glu30294=) rs760292453
NM_001267550.2(TTN):c.9093C>T (p.His3031=) rs1057521950
NM_001267550.2(TTN):c.90984A>T (p.Pro30328=) rs1057522917
NM_001267550.2(TTN):c.90991C>T (p.Pro30331Ser) rs75022916
NM_001267550.2(TTN):c.91+14T>C rs397517777
NM_001267550.2(TTN):c.91065A>G (p.Glu30355=) rs1057520905
NM_001267550.2(TTN):c.91173A>C (p.Glu30391Asp) rs199505541
NM_001267550.2(TTN):c.91224C>T (p.Ser30408=) rs1057522835
NM_001267550.2(TTN):c.91257T>C (p.Ala30419=) rs1057523889
NM_001267550.2(TTN):c.91260T>C (p.Val30420=)
NM_001267550.2(TTN):c.91311A>G (p.Glu30437=) rs374094732
NM_001267550.2(TTN):c.9139T>A (p.Ser3047Thr) rs946142615
NM_001267550.2(TTN):c.91422T>C (p.Thr30474=) rs1403627000
NM_001267550.2(TTN):c.91425C>T (p.Asp30475=) rs145133144
NM_001267550.2(TTN):c.91426G>A (p.Val30476Ile)
NM_001267550.2(TTN):c.915-200A>G
NM_001267550.2(TTN):c.91533T>G (p.Ser30511=) rs772824909
NM_001267550.2(TTN):c.91565-167A>G
NM_001267550.2(TTN):c.91589C>T (p.Pro30530Leu) rs200875379
NM_001267550.2(TTN):c.91601A>T (p.Asp30534Val) rs182549226
NM_001267550.2(TTN):c.91611T>G (p.Ile30537Met) rs1553536409
NM_001267550.2(TTN):c.9163+3A>G rs760597240
NM_001267550.2(TTN):c.91632T>G (p.Leu30544=) rs909346656
NM_001267550.2(TTN):c.9164-9del rs752677873
NM_001267550.2(TTN):c.91695G>A (p.Val30565=) rs1553536237
NM_001267550.2(TTN):c.91884A>G (p.Arg30628=) rs144922355
NM_001267550.2(TTN):c.918C>T (p.Ser306=) rs773898647
NM_001267550.2(TTN):c.91901G>A (p.Gly30634Glu) rs376628842
NM_001267550.2(TTN):c.91937A>G (p.Asn30646Ser) rs72648245
NM_001267550.2(TTN):c.92-93C>T
NM_001267550.2(TTN):c.92009T>C (p.Ile30670Thr) rs369342933
NM_001267550.2(TTN):c.9213G>A (p.Glu3071=) rs779657872
NM_001267550.2(TTN):c.92151T>C (p.Tyr30717=) rs182422055
NM_001267550.2(TTN):c.92152+10C>T rs376007682
NM_001267550.2(TTN):c.92176C>T (p.Pro30726Ser) rs72648247
NM_001267550.2(TTN):c.92217A>G (p.Thr30739=) rs1553534899
NM_001267550.2(TTN):c.92262T>C (p.Tyr30754=) rs1212338157
NM_001267550.2(TTN):c.9226A>G (p.Met3076Val)
NM_001267550.2(TTN):c.92294G>C (p.Arg30765Thr) rs373099440
NM_001267550.2(TTN):c.92362G>A (p.Gly30788Ser) rs199891245
NM_001267550.2(TTN):c.92451G>T (p.Glu30817Asp) rs397517755
NM_001267550.2(TTN):c.92537T>C (p.Val30846Ala) rs77968867
NM_001267550.2(TTN):c.92696T>C (p.Ile30899Thr) rs373727636
NM_001267550.2(TTN):c.92699A>G (p.Asn30900Ser) rs186234393
NM_001267550.2(TTN):c.92710A>G (p.Lys30904Glu) rs370265204
NM_001267550.2(TTN):c.92750T>C (p.Val30917Ala)
NM_001267550.2(TTN):c.92754C>G (p.Asp30918Glu)
NM_001267550.2(TTN):c.92765C>T (p.Ala30922Val) rs756786292
NM_001267550.2(TTN):c.92780T>A (p.Ile30927Lys) rs531432790
NM_001267550.2(TTN):c.92782G>C (p.Asp30928His) rs397517756
NM_001267550.2(TTN):c.92806G>A (p.Val30936Ile) rs200476500
NM_001267550.2(TTN):c.92868A>T (p.Thr30956=) rs1000250632
NM_001267550.2(TTN):c.92934C>T (p.Phe30978=) rs769177976
NM_001267550.2(TTN):c.93005G>T (p.Ser31002Ile) rs180975448
NM_001267550.2(TTN):c.93031G>A (p.Val31011Met)
NM_001267550.2(TTN):c.9305+15C>A rs1057523738
NM_001267550.2(TTN):c.9305+17T>C rs1553990405
NM_001267550.2(TTN):c.93131G>A (p.Gly31044Asp)
NM_001267550.2(TTN):c.93214C>T (p.Arg31072Cys) rs368932767
NM_001267550.2(TTN):c.93223T>A (p.Phe31075Ile) rs956327300
NM_001267550.2(TTN):c.93232A>G (p.Asn31078Asp) rs1553530373
NM_001267550.2(TTN):c.9326A>G (p.Lys3109Arg) rs753036867
NM_001267550.2(TTN):c.93367G>C (p.Val31123Leu) rs202096200
NM_001267550.2(TTN):c.93399T>A (p.Ala31133=) rs1553529493
NM_001267550.2(TTN):c.93509C>G (p.Thr31170Ser)
NM_001267550.2(TTN):c.93524G>A (p.Arg31175His) rs72648251
NM_001267550.2(TTN):c.93543A>G (p.Glu31181=) rs1358160212
NM_001267550.2(TTN):c.93573T>C (p.Asp31191=) rs965506398
NM_001267550.2(TTN):c.93585T>C (p.Ser31195=) rs754614591
NM_001267550.2(TTN):c.93725G>A (p.Arg31242His) rs369899675
NM_001267550.2(TTN):c.93782G>A (p.Arg31261Gln)
NM_001267550.2(TTN):c.93868C>T (p.Leu31290=) rs557737090
NM_001267550.2(TTN):c.93919G>A (p.Gly31307Arg)
NM_001267550.2(TTN):c.93939C>T (p.Thr31313=)
NM_001267550.2(TTN):c.93981C>G (p.Val31327=) rs370894846
NM_001267550.2(TTN):c.94016C>T (p.Thr31339Ile) rs184078016
NM_001267550.2(TTN):c.94046G>A (p.Arg31349His) rs181104321
NM_001267550.2(TTN):c.94183C>G (p.Leu31395Val)
NM_001267550.2(TTN):c.94219+11T>C rs1184310421
NM_001267550.2(TTN):c.94282C>G (p.Arg31428Gly) rs190282707
NM_001267550.2(TTN):c.94283G>A (p.Arg31428His) rs149375775
NM_001267550.2(TTN):c.9434G>A (p.Arg3145Lys) rs727503682
NM_001267550.2(TTN):c.94452T>C (p.Tyr31484=) rs763668385
NM_001267550.2(TTN):c.94464T>C (p.Ala31488=) rs138888307
NM_001267550.2(TTN):c.94522+16T>G rs1553524180
NM_001267550.2(TTN):c.94561T>C (p.Ser31521Pro) rs1553523604
NM_001267550.2(TTN):c.94590A>G (p.Pro31530=) rs558347312
NM_001267550.2(TTN):c.94593G>A (p.Ala31531=) rs373301015
NM_001267550.2(TTN):c.94593G>C (p.Ala31531=) rs373301015
NM_001267550.2(TTN):c.94700A>G (p.Asn31567Ser) rs886042885
NM_001267550.2(TTN):c.9471+13T>C rs1553989643
NM_001267550.2(TTN):c.94720C>G (p.Leu31574Val)
NM_001267550.2(TTN):c.94828+17A>G rs1057523850
NM_001267550.2(TTN):c.94828+6A>C rs1553522625
NM_001267550.2(TTN):c.94829-3C>T rs762081355
NM_001267550.2(TTN):c.9485A>G (p.Gln3162Arg) rs727503681
NM_001267550.2(TTN):c.9486G>A (p.Gln3162=) rs768927616
NM_001267550.2(TTN):c.9487C>T (p.Arg3163Cys) rs140664731
NM_001267550.2(TTN):c.95068G>A (p.Val31690Met) rs727503543
NM_001267550.2(TTN):c.95078C>A (p.Ala31693Asp) rs2288326
NM_001267550.2(TTN):c.95196G>A (p.Pro31732=) rs752309744
NM_001267550.2(TTN):c.9519C>T (p.Asp3173=) rs151129843
NM_001267550.2(TTN):c.9523G>A (p.Val3175Ile) rs762667276
NM_001267550.2(TTN):c.95304C>T (p.Val31768=) rs367755163
NM_001267550.2(TTN):c.95395A>G (p.Ile31799Val)
NM_001267550.2(TTN):c.95406A>G (p.Arg31802=) rs199652273
NM_001267550.2(TTN):c.95582A>G (p.Tyr31861Cys) rs59148238
NM_001267550.2(TTN):c.95653G>A (p.Ala31885Thr) rs72648263
NM_001267550.2(TTN):c.95709C>T (p.Cys31903=) rs878961342
NM_001267550.2(TTN):c.95722T>C (p.Tyr31908His) rs199781261
NM_001267550.2(TTN):c.95743G>T (p.Ala31915Ser) rs1490243211
NM_001267550.2(TTN):c.95884A>G (p.Asn31962Asp) rs369087584
NM_001267550.2(TTN):c.95892A>G (p.Thr31964=) rs879183167
NM_001267550.2(TTN):c.95961C>T (p.Ala31987=) rs369405564
NM_001267550.2(TTN):c.96008T>C (p.Ile32003Thr) rs745962752
NM_001267550.2(TTN):c.96016G>A (p.Val32006Met) rs191786700
NM_001267550.2(TTN):c.96026T>G (p.Ile32009Arg) rs375368824
NM_001267550.2(TTN):c.96051A>G (p.Ala32017=) rs367805587
NM_001267550.2(TTN):c.96098G>A (p.Arg32033His) rs200648462
NM_001267550.2(TTN):c.96173G>A (p.Arg32058Gln) rs374063064
NM_001267550.2(TTN):c.96225T>A (p.Val32075=) rs752745266
NM_001267550.2(TTN):c.96234C>T (p.Tyr32078=) rs376532382
NM_001267550.2(TTN):c.96252A>G (p.Thr32084=) rs369626133
NM_001267550.2(TTN):c.96310+11T>C rs397517764
NM_001267550.2(TTN):c.96389C>T (p.Thr32130Met)
NM_001267550.2(TTN):c.96421A>G (p.Ile32141Val) rs794729249
NM_001267550.2(TTN):c.96525C>T (p.Tyr32175=) rs778126823
NM_001267550.2(TTN):c.96549T>C (p.Asn32183=) rs1057522601
NM_001267550.2(TTN):c.9674A>G (p.Asn3225Ser) rs202011992
NM_001267550.2(TTN):c.96824T>C (p.Phe32275Ser)
NM_001267550.2(TTN):c.96883G>A (p.Val32295Met) rs199532781
NM_001267550.2(TTN):c.96892C>G (p.Gln32298Glu)
NM_001267550.2(TTN):c.96949C>G (p.His32317Asp) rs779019939
NM_001267550.2(TTN):c.96978G>A (p.Leu32326=) rs397517765
NM_001267550.2(TTN):c.96998G>A (p.Arg32333His) rs138846756
NM_001267550.2(TTN):c.97054C>T (p.Arg32352Cys)
NM_001267550.2(TTN):c.97099C>T (p.Arg32367Cys) rs202064385
NM_001267550.2(TTN):c.970C>T (p.Pro324Ser) rs72647845
NM_001267550.2(TTN):c.97152T>C (p.Val32384=) rs368018568
NM_001267550.2(TTN):c.97192+6G>A rs367760700
NM_001267550.2(TTN):c.97242T>C (p.Ala32414=) rs776580922
NM_001267550.2(TTN):c.9726G>A (p.Leu3242=) rs755986577
NM_001267550.2(TTN):c.97275A>G (p.Glu32425=)
NM_001267550.2(TTN):c.97294C>T (p.Leu32432=) rs72648267
NM_001267550.2(TTN):c.97331G>C (p.Arg32444Pro) rs184922462
NM_001267550.2(TTN):c.97395C>T (p.Thr32465=) rs755328785
NM_001267550.2(TTN):c.97435C>A (p.Arg32479Ser) rs200148139
NM_001267550.2(TTN):c.97464T>C (p.Ser32488=) rs571147766
NM_001267550.2(TTN):c.97492+14C>T rs755615084
NM_001267550.2(TTN):c.97492+154_97492+176del
NM_001267550.2(TTN):c.9749T>G (p.Val3250Gly) rs55634230
NM_001267550.2(TTN):c.97538G>A (p.Arg32513His) rs201080904
NM_001267550.2(TTN):c.97605T>G (p.Ile32535Met) rs760676361
NM_001267550.2(TTN):c.97612C>T (p.Arg32538Cys) rs761050391
NM_001267550.2(TTN):c.97623G>C (p.Val32541=) rs1060503961
NM_001267550.2(TTN):c.9762G>A (p.Lys3254=) rs1057524449
NM_001267550.2(TTN):c.97642C>T (p.Arg32548Cys) rs377599569
NM_001267550.2(TTN):c.97707A>G (p.Glu32569=) rs1553513879
NM_001267550.2(TTN):c.97760G>A (p.Arg32587His) rs55704830
NM_001267550.2(TTN):c.97760G>C (p.Arg32587Pro) rs55704830
NM_001267550.2(TTN):c.97795+12T>C rs759477837
NM_001267550.2(TTN):c.97795+166G>A
NM_001267550.2(TTN):c.97926A>T (p.Val32642=) rs766450778
NM_001267550.2(TTN):c.97947G>C (p.Lys32649Asn) rs773776767
NM_001267550.2(TTN):c.97992C>T (p.His32664=) rs794729549
NM_001267550.2(TTN):c.98022C>T (p.Arg32674=) rs372825562
NM_001267550.2(TTN):c.98023G>A (p.Val32675Ile)
NM_001267550.2(TTN):c.9802C>T (p.Pro3268Ser)
NM_001267550.2(TTN):c.98118T>C (p.Leu32706=) rs72648269
NM_001267550.2(TTN):c.98205A>C (p.Ile32735=) rs745468223
NM_001267550.2(TTN):c.98252T>C (p.Ile32751Thr) rs746586029
NM_001267550.2(TTN):c.98267C>T (p.Thr32756Ile) rs199805060
NM_001267550.2(TTN):c.9827A>G (p.Glu3276Gly) rs377049518
NM_001267550.2(TTN):c.98294C>G (p.Ala32765Gly) rs72648273
NM_001267550.2(TTN):c.98299A>C (p.Arg32767=)
NM_001267550.2(TTN):c.98431C>T (p.Arg32811Cys) rs371807358
NM_001267550.2(TTN):c.98544C>G (p.Ser32848=) rs756591209
NM_001267550.2(TTN):c.98589T>C (p.Asn32863=) rs1553509474
NM_001267550.2(TTN):c.98606G>A (p.Arg32869His) rs587780495
NM_001267550.2(TTN):c.98680T>C (p.Leu32894=) rs776366085
NM_001267550.2(TTN):c.98683+14C>T
NM_001267550.2(TTN):c.98684-12T>C rs752771741
NM_001267550.2(TTN):c.98716G>A (p.Val32906Ile) rs182683829
NM_001267550.2(TTN):c.98750C>T (p.Ser32917Phe)
NM_001267550.2(TTN):c.9884C>T (p.Thr3295Met) rs191708454
NM_001267550.2(TTN):c.98893G>C (p.Asp32965His) rs186405108
NM_001267550.2(TTN):c.98937C>T (p.Gly32979=) rs1033038689
NM_001267550.2(TTN):c.98989+12A>C rs72648275
NM_001267550.2(TTN):c.98990-8T>C rs1553507751
NM_001267550.2(TTN):c.99045C>T (p.Val33015=) rs199642780
NM_001267550.2(TTN):c.9918G>A (p.Ala3306=) rs533798702
NM_001267550.2(TTN):c.99254G>A (p.Arg33085His) rs777035261
NM_001267550.2(TTN):c.99289+19T>C rs370055296
NM_001267550.2(TTN):c.99289+70C>G
NM_001267550.2(TTN):c.99289+89G>C
NM_001267550.2(TTN):c.99340T>C (p.Leu33114=) rs371656672
NM_001267550.2(TTN):c.99415A>G (p.Lys33139Glu) rs779723670
NM_001267550.2(TTN):c.99552C>A (p.Thr33184=) rs775848810
NM_001267550.2(TTN):c.9955G>A (p.Val3319Ile) rs375533809
NM_001267550.2(TTN):c.99567C>T (p.Leu33189=) rs745708104
NM_001267550.2(TTN):c.99621T>C (p.Tyr33207=) rs753176107
NM_001267550.2(TTN):c.99668G>A (p.Arg33223His) rs369081242
NM_001267550.2(TTN):c.996A>C (p.Ala332=) rs750838855
NM_001267550.2(TTN):c.996A>G (p.Ala332=) rs750838855
NM_001267550.2(TTN):c.99810C>T (p.Val33270=) rs564536939
NM_001267550.2(TTN):c.99840T>C (p.Asp33280=)
NM_001267550.2(TTN):c.99946G>A (p.Ala33316Thr) rs374295768
NM_001267550.2(TTN):c.99991T>C (p.Cys33331Arg) rs56061641
NM_003319.4(TTN):c.19502-5A>G rs182706301
NM_133378.4(TTN):c.32930-9A>G rs373511249
NM_133379.5(TTN):c.10115-4G>A rs367648529
NM_133379.5(TTN):c.1398+5G>A rs542965530
NM_133379.5(TTN):c.1398+9G>A rs368350210
NM_133379.5(TTN):c.1399-3C>T rs397517486
NM_133379.5(TTN):c.2494-7C>A rs758664336
NM_133379.5(TTN):c.583+5G>A rs397517663
NM_133379.5(TTN):c.9306-4A>G rs757164431

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.