ClinVar Miner

List of variants in gene TTN reported by Invitae

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 5476
Download table as spreadsheet
HGVS dbSNP
NC_000002.11:g.(?_179392981)_(179408862_?)del
NC_000002.11:g.(?_179460214)_(179487514_?)dup
NC_000002.11:g.(?_179489172)_(179501546_?)del
NC_000002.11:g.(?_179505958)_(179515008_?)dup
NC_000002.11:g.(?_179516971)_(179518254_?)del
NC_000002.11:g.(?_179557214)_(179600811_?)dup
NC_000002.11:g.(?_179574273)_(179576096_?)del
NC_000002.11:g.(?_179581802)_(179589285_?)dup
NC_000002.11:g.(?_179648427)_(179650888_?)del
NC_000002.11:g.(?_179669259)_(179669389_?)del
NM_001256850.1(TTN):c.13984+9C>T rs544241749
NM_001256850.1(TTN):c.15671-9C>T rs752362183
NM_001256850.1(TTN):c.16232-9T>C rs141687561
NM_001256850.1(TTN):c.16510+1G>T rs747990127
NM_001256850.1(TTN):c.18197-4A>G rs1025136671
NM_001256850.1(TTN):c.19885+5G>A rs1064796629
NM_001256850.1(TTN):c.21578-7C>A rs769076842
NM_001256850.1(TTN):c.22427-10C>A rs72648975
NM_001256850.1(TTN):c.22709-7C>T rs771244164
NM_001256850.1(TTN):c.22709-7_22709-5delCTT rs563250569
NM_001256850.1(TTN):c.28091-2A>C rs6716782
NM_001256850.1(TTN):c.29273-7T>G rs778458915
NM_001256850.1(TTN):c.29560+3G>A rs563582627
NM_001256850.1(TTN):c.30895+1G>A rs794727043
NM_001256850.1(TTN):c.31360+9T>C rs573677447
NM_001256850.1(TTN):c.31604-6T>C rs375742678
NM_001256850.1(TTN):c.32222-4G>A rs727504440
NM_001256850.1(TTN):c.32389+5A>C rs373367032
NM_001256850.1(TTN):c.32876-8C>T rs371318311
NM_001256850.1(TTN):c.33586+8C>A rs762808097
NM_001256850.1(TTN):c.33664+8A>G rs775606653
NM_001256850.1(TTN):c.34106-9T>A rs537626868
NM_001256850.1(TTN):c.34523-784T>C rs200819643
NM_001256850.1(TTN):c.34690+6C>T rs187365142
NM_001256850.1(TTN):c.35188+6C>T rs72650067
NM_001256850.1(TTN):c.35188+9G>C rs765647346
NM_001256850.1(TTN):c.35189-4A>G rs781589169
NM_001256850.1(TTN):c.35711-10T>A rs375097334
NM_001256850.1(TTN):c.36407-7T>A rs373636988
NM_001256850.1(TTN):c.39231+6G>T rs794729234
NM_001256850.1(TTN):c.39359-6G>A rs372166634
NM_001256850.1(TTN):c.39893-1G>A rs749705939
NM_001256850.1(TTN):c.40166_40168delAAG (p.Glu13389del) rs759525338
NM_001256850.1(TTN):c.43537+5G>A rs374413644
NM_001256850.1(TTN):c.44423-1G>A rs869312070
NM_001256850.1(TTN):c.44423-2A>T rs794729263
NM_001256850.1(TTN):c.44725+2delT rs727504851
NM_001256850.1(TTN):c.45935-9A>C rs146208555
NM_001256850.1(TTN):c.48079+10G>A rs370352450
NM_001256850.1(TTN):c.48364+6G>A rs149890360
NM_001256850.1(TTN):c.48958+5G>T rs753527304
NM_001256850.1(TTN):c.52340-4C>T rs373552048
NM_001256850.1(TTN):c.54703+7delA rs766734794
NM_001256850.1(TTN):c.54704-10C>T rs775224600
NM_001256850.1(TTN):c.55004-10_55004-8delCTT rs1338225091
NM_001256850.1(TTN):c.60050-4C>G rs369934310
NM_001256850.1(TTN):c.60353-8T>C rs377484398
NM_001256850.1(TTN):c.60652+10T>C rs72646864
NM_001256850.1(TTN):c.62425+1G>A rs758279518
NM_001256850.1(TTN):c.64489+10G>C rs72646883
NM_001256850.1(TTN):c.81898+2T>A rs397517735
NM_001256850.1(TTN):c.83086+5G>A rs148231754
NM_001256850.1(TTN):c.83383+8T>C rs369690199
NM_001256850.1(TTN):c.91981+4T>C rs373514079
NM_001256850.1(TTN):c.92569+1G>C rs727505319
NM_001256850.1(TTN):c.92873-10T>C rs1553512260
NM_001256850.1(TTN):c.93175+3G>A rs556524594
NM_001256850.1(TTN):c.94943-10C>T rs773128928
NM_001267550.1(TTN):c.45599C>G rs201057307
NM_001267550.1(TTN):c.46387G>A rs200042932
NM_001267550.1(TTN):c.83315A>T rs578191491
NM_001267550.2(TTN):c.100018C>A (p.Gln33340Lys) rs558954116
NM_001267550.2(TTN):c.100047A>C (p.Thr33349=) rs727504698
NM_001267550.2(TTN):c.100049C>T (p.Thr33350Ile) rs370300135
NM_001267550.2(TTN):c.100058T>C (p.Ile33353Thr) rs138234724
NM_001267550.2(TTN):c.100059T>A (p.Ile33353=) rs56026369
NM_001267550.2(TTN):c.100060G>C (p.Val33354Leu) rs879221791
NM_001267550.2(TTN):c.100094G>A (p.Arg33365Gln) rs55742743
NM_001267550.2(TTN):c.100096G>A (p.Val33366Ile) rs55675869
NM_001267550.2(TTN):c.100105C>T (p.Gln33369Ter) rs1553503201
NM_001267550.2(TTN):c.100117G>A (p.Gly33373Ser) rs55880786
NM_001267550.2(TTN):c.100133T>G (p.Leu33378Arg) rs1060500454
NM_001267550.2(TTN):c.100163G>A (p.Ser33388Asn) rs745406517
NM_001267550.2(TTN):c.100172-17dup rs397517782
NM_001267550.2(TTN):c.100172-3T>C
NM_001267550.2(TTN):c.100194A>T (p.Lys33398Asn) rs1060500553
NM_001267550.2(TTN):c.100204A>G (p.Thr33402Ala) rs777018654
NM_001267550.2(TTN):c.100226G>A (p.Cys33409Tyr) rs201112096
NM_001267550.2(TTN):c.100244C>T (p.Pro33415Leu)
NM_001267550.2(TTN):c.100257T>C (p.Asp33419=) rs727505046
NM_001267550.2(TTN):c.100295G>A (p.Arg33432His) rs374876608
NM_001267550.2(TTN):c.1002C>T (p.Thr334=) rs148094198
NM_001267550.2(TTN):c.100384G>A (p.Glu33462Lys) rs748104690
NM_001267550.2(TTN):c.100389C>T (p.Tyr33463=) rs368984050
NM_001267550.2(TTN):c.100390G>A (p.Glu33464Lys) rs374920916
NM_001267550.2(TTN):c.100390G>T (p.Glu33464Ter)
NM_001267550.2(TTN):c.100396C>T (p.Arg33466Cys) rs371908649
NM_001267550.2(TTN):c.100397G>A (p.Arg33466His) rs189626540
NM_001267550.2(TTN):c.1003G>A (p.Val335Met) rs72647846
NM_001267550.2(TTN):c.100400T>G (p.Val33467Gly) rs200166942
NM_001267550.2(TTN):c.100432T>G (p.Trp33478Gly) rs372304158
NM_001267550.2(TTN):c.100436G>A (p.Ser33479Asn) rs1553501815
NM_001267550.2(TTN):c.100446dup (p.Glu33483fs) rs878854281
NM_001267550.2(TTN):c.100447G>C (p.Glu33483Gln) rs368321767
NM_001267550.2(TTN):c.100449A>C (p.Glu33483Asp) rs762690616
NM_001267550.2(TTN):c.10044C>T (p.Ile3348=) rs1553983924
NM_001267550.2(TTN):c.100459C>T (p.Pro33487Ser) rs72629779
NM_001267550.2(TTN):c.10046C>T (p.Thr3349Ile) rs727503678
NM_001267550.2(TTN):c.10049C>T (p.Pro3350Leu) rs139504522
NM_001267550.2(TTN):c.10050G>A (p.Pro3350=) rs759936737
NM_001267550.2(TTN):c.100578C>T (p.Ile33526=) rs764709619
NM_001267550.2(TTN):c.100579G>A (p.Val33527Ile) rs2278196
NM_001267550.2(TTN):c.100587G>A (p.Trp33529Ter) rs1064793560
NM_001267550.2(TTN):c.10062del (p.Val3355fs) rs1553983844
NM_001267550.2(TTN):c.100649G>A (p.Gly33550Asp) rs370253076
NM_001267550.2(TTN):c.10065C>T (p.Val3355=) rs766884321
NM_001267550.2(TTN):c.100696A>G (p.Thr33566Ala) rs878854282
NM_001267550.2(TTN):c.100745C>G (p.Thr33582Ser) rs1289282264
NM_001267550.2(TTN):c.100759G>A (p.Val33587Met) rs1401200720
NM_001267550.2(TTN):c.100766-10_100766-9insTC rs779410830
NM_001267550.2(TTN):c.100766-11_100766-10delinsCC rs1060503962
NM_001267550.2(TTN):c.100766-9C>T rs77483833
NM_001267550.2(TTN):c.100766-9dup rs202238743
NM_001267550.2(TTN):c.100786C>T (p.Pro33596Ser)
NM_001267550.2(TTN):c.100800A>C (p.Glu33600Asp)
NM_001267550.2(TTN):c.100804A>G (p.Met33602Val)
NM_001267550.2(TTN):c.100825C>T (p.Arg33609Ter) rs1057518195
NM_001267550.2(TTN):c.100858A>C (p.Ser33620Arg) rs1553500669
NM_001267550.2(TTN):c.100880T>C (p.Ile33627Thr) rs1553500627
NM_001267550.2(TTN):c.100886G>A (p.Trp33629Ter) rs1260821931
NM_001267550.2(TTN):c.10088G>A (p.Arg3363His) rs148169214
NM_001267550.2(TTN):c.100903C>T (p.Leu33635Phe) rs879048474
NM_001267550.2(TTN):c.100935T>C (p.Ile33645=) rs763249842
NM_001267550.2(TTN):c.100942_100944delinsT (p.Arg33648fs) rs1559050685
NM_001267550.2(TTN):c.100972G>A (p.Gly33658Arg) rs780484535
NM_001267550.2(TTN):c.100982G>A (p.Arg33661Lys) rs201857158
NM_001267550.2(TTN):c.10099C>T (p.Arg3367Trp) rs762791706
NM_001267550.2(TTN):c.101008T>C (p.Cys33670Arg)
NM_001267550.2(TTN):c.10100G>A (p.Arg3367Gln) rs34819099
NM_001267550.2(TTN):c.101012C>A (p.Ala33671Asp)
NM_001267550.2(TTN):c.101016A>G (p.Lys33672=)
NM_001267550.2(TTN):c.101037G>A (p.Gln33679=) rs377190399
NM_001267550.2(TTN):c.101040G>T (p.Lys33680Asn) rs776913696
NM_001267550.2(TTN):c.10104T>G (p.Val3368=) rs142460433
NM_001267550.2(TTN):c.101053G>A (p.Asp33685Asn)
NM_001267550.2(TTN):c.101055T>C (p.Asp33685=) rs372788551
NM_001267550.2(TTN):c.101064T>C (p.Asp33688=) rs368168812
NM_001267550.2(TTN):c.101098_101099insT (p.Asp33700fs) rs869312122
NM_001267550.2(TTN):c.101107C>T (p.Arg33703Ter) rs766265889
NM_001267550.2(TTN):c.101117T>C (p.Val33706Ala)
NM_001267550.2(TTN):c.10112C>T (p.Thr3371Ile) rs1060500429
NM_001267550.2(TTN):c.101136G>A (p.Glu33712=) rs1060503937
NM_001267550.2(TTN):c.101136G>C (p.Glu33712Asp)
NM_001267550.2(TTN):c.1011A>G (p.Thr337=) rs758427242
NM_001267550.2(TTN):c.101212C>T (p.Arg33738Cys) rs56273463
NM_001267550.2(TTN):c.101213G>A (p.Arg33738His) rs192391568
NM_001267550.2(TTN):c.101214T>G (p.Arg33738=) rs876657617
NM_001267550.2(TTN):c.101218G>A (p.Gly33740Arg) rs536705240
NM_001267550.2(TTN):c.101227C>T (p.Arg33743Ter) rs794729305
NM_001267550.2(TTN):c.101230del (p.Glu33744fs)
NM_001267550.2(TTN):c.101236C>T (p.Arg33746Cys) rs199594729
NM_001267550.2(TTN):c.101245G>A (p.Val33749Met) rs201554140
NM_001267550.2(TTN):c.101251A>C (p.Asn33751His) rs753658469
NM_001267550.2(TTN):c.10127C>T (p.Ser3376Leu) rs781368765
NM_001267550.2(TTN):c.101281C>T (p.Arg33761Trp) rs201421156
NM_001267550.2(TTN):c.101284G>A (p.Val33762Ile)
NM_001267550.2(TTN):c.10128G>A (p.Ser3376=) rs755262343
NM_001267550.2(TTN):c.101291C>G (p.Ala33764Gly) rs773542514
NM_001267550.2(TTN):c.101306G>A (p.Gly33769Asp) rs1553499045
NM_001267550.2(TTN):c.101326C>G (p.Pro33776Ala) rs746665837
NM_001267550.2(TTN):c.101345C>T (p.Thr33782Ile)
NM_001267550.2(TTN):c.101376T>C (p.Tyr33792=) rs367732133
NM_001267550.2(TTN):c.101378A>T (p.Asp33793Val) rs200675195
NM_001267550.2(TTN):c.101380G>A (p.Glu33794Lys)
NM_001267550.2(TTN):c.101387T>C (p.Val33796Ala) rs1454018253
NM_001267550.2(TTN):c.101406C>G (p.Val33802=) rs55802460
NM_001267550.2(TTN):c.101439G>A (p.Lys33813=) rs72629781
NM_001267550.2(TTN):c.101472T>A (p.Asp33824Glu)
NM_001267550.2(TTN):c.101506T>A (p.Cys33836Ser) rs766439271
NM_001267550.2(TTN):c.101557A>G (p.Lys33853Glu) rs727505163
NM_001267550.2(TTN):c.101572G>C (p.Val33858Leu) rs1060500584
NM_001267550.2(TTN):c.101580A>G (p.Val33860=) rs1060503929
NM_001267550.2(TTN):c.101599C>G (p.Leu33867Val) rs76194811
NM_001267550.2(TTN):c.10163G>A (p.Arg3388Gln) rs187703540
NM_001267550.2(TTN):c.101665G>A (p.Val33889Ile) rs34924609
NM_001267550.2(TTN):c.101675T>C (p.Phe33892Ser)
NM_001267550.2(TTN):c.101693T>C (p.Leu33898Pro)
NM_001267550.2(TTN):c.101697C>T (p.Asp33899=) rs114267234
NM_001267550.2(TTN):c.101728G>T (p.Glu33910Ter)
NM_001267550.2(TTN):c.101766G>C (p.Gln33922His) rs55886356
NM_001267550.2(TTN):c.101803A>G (p.Ile33935Val) rs56376197
NM_001267550.2(TTN):c.10186_10192delinsATCATT (p.Glu3396fs) rs1553972275
NM_001267550.2(TTN):c.101875G>A (p.Glu33959Lys) rs886055224
NM_001267550.2(TTN):c.10188A>G (p.Glu3396=) rs183336802
NM_001267550.2(TTN):c.101891G>A (p.Arg33964His) rs55669553
NM_001267550.2(TTN):c.101912A>T (p.Asn33971Ile) rs1553497184
NM_001267550.2(TTN):c.101925A>G (p.Leu33975=) rs201246720
NM_001267550.2(TTN):c.101936C>G (p.Pro33979Arg) rs200238877
NM_001267550.2(TTN):c.101948C>T (p.Ala33983Val) rs1553497101
NM_001267550.2(TTN):c.101993T>C (p.Met33998Thr) rs1559039438
NM_001267550.2(TTN):c.101997G>C (p.Trp33999Cys) rs764821435
NM_001267550.2(TTN):c.102011T>A (p.Leu34004Gln) rs727504897
NM_001267550.2(TTN):c.102030T>G (p.Ser34010Arg) rs1296387134
NM_001267550.2(TTN):c.102038A>C (p.Asn34013Thr) rs1559038960
NM_001267550.2(TTN):c.102061C>T (p.Gln34021Ter) rs1060500471
NM_001267550.2(TTN):c.102102C>T (p.Phe34034=) rs377354934
NM_001267550.2(TTN):c.102103G>A (p.Asp34035Asn) rs144963736
NM_001267550.2(TTN):c.102105T>A (p.Asp34035Glu) rs370647845
NM_001267550.2(TTN):c.102116T>C (p.Phe34039Ser) rs1553496582
NM_001267550.2(TTN):c.102121G>A (p.Glu34041Lys) rs377600383
NM_001267550.2(TTN):c.102139A>G (p.Met34047Val) rs755244797
NM_001267550.2(TTN):c.102148G>A (p.Val34050Ile)
NM_001267550.2(TTN):c.102155G>A (p.Arg34052Gln) rs369245991
NM_001267550.2(TTN):c.102173G>A (p.Arg34058Lys) rs886039007
NM_001267550.2(TTN):c.102182G>A (p.Arg34061His) rs774174825
NM_001267550.2(TTN):c.102190G>A (p.Ala34064Thr) rs200237973
NM_001267550.2(TTN):c.102191C>T (p.Ala34064Val)
NM_001267550.2(TTN):c.102202C>T (p.Leu34068Phe)
NM_001267550.2(TTN):c.102214T>C (p.Trp34072Arg) rs375159973
NM_001267550.2(TTN):c.102230T>C (p.Ile34077Thr) rs1290306844
NM_001267550.2(TTN):c.102232G>C (p.Glu34078Gln) rs1454101167
NM_001267550.2(TTN):c.102271C>T (p.Arg34091Trp) rs140319117
NM_001267550.2(TTN):c.102272G>A (p.Arg34091Gln) rs763708375
NM_001267550.2(TTN):c.102275G>A (p.Arg34092His) rs757918924
NM_001267550.2(TTN):c.102329G>C (p.Arg34110Pro) rs565347600
NM_001267550.2(TTN):c.102368T>G (p.Val34123Gly) rs1060500587
NM_001267550.2(TTN):c.102377C>T (p.Ala34126Val)
NM_001267550.2(TTN):c.102397A>C (p.Ile34133Leu)
NM_001267550.2(TTN):c.102399T>C (p.Ile34133=) rs1271132251
NM_001267550.2(TTN):c.1023G>T (p.Val341=) rs1060503956
NM_001267550.2(TTN):c.102423G>T (p.Gln34141His) rs1553495068
NM_001267550.2(TTN):c.102428T>C (p.Met34143Thr) rs397517786
NM_001267550.2(TTN):c.10242C>T (p.Tyr3414=) rs45447891
NM_001267550.2(TTN):c.102431A>G (p.His34144Arg) rs1553495003
NM_001267550.2(TTN):c.102451G>C (p.Gly34151Arg) rs191522469
NM_001267550.2(TTN):c.102510G>C (p.Trp34170Cys) rs1559033550
NM_001267550.2(TTN):c.102520G>A (p.Val34174Ile) rs200430493
NM_001267550.2(TTN):c.102523C>T (p.Arg34175Ter) rs752697861
NM_001267550.2(TTN):c.102524G>A (p.Arg34175Gln) rs201954720
NM_001267550.2(TTN):c.102541G>A (p.Glu34181Lys) rs1559033148
NM_001267550.2(TTN):c.102549C>T (p.Tyr34183=) rs761394437
NM_001267550.2(TTN):c.102573G>A (p.Val34191=) rs151209395
NM_001267550.2(TTN):c.102586G>A (p.Val34196Ile) rs1185169765
NM_001267550.2(TTN):c.102592G>A (p.Asp34198Asn) rs948836784
NM_001267550.2(TTN):c.102595A>G (p.Ile34199Val) rs56347248
NM_001267550.2(TTN):c.102607_102615del (p.Asp34203_Gly34205del) rs1559032218
NM_001267550.2(TTN):c.102621C>T (p.Tyr34207=) rs1553494225
NM_001267550.2(TTN):c.102638A>G (p.Asn34213Ser) rs375332499
NM_001267550.2(TTN):c.102657T>A (p.Ser34219Arg) rs370077023
NM_001267550.2(TTN):c.102682G>C (p.Gly34228Arg) rs555664963
NM_001267550.2(TTN):c.102688A>C (p.Arg34230=) rs745836095
NM_001267550.2(TTN):c.102696C>T (p.Val34232=) rs202180775
NM_001267550.2(TTN):c.102718_102719del (p.Thr34240fs) rs1559031280
NM_001267550.2(TTN):c.102725A>G (p.Lys34242Arg) rs1553493858
NM_001267550.2(TTN):c.102737G>A (p.Arg34246His) rs372716177
NM_001267550.2(TTN):c.102745G>C (p.Asp34249His)
NM_001267550.2(TTN):c.102749C>A (p.Thr34250Lys)
NM_001267550.2(TTN):c.102751A>G (p.Met34251Val) rs56173891
NM_001267550.2(TTN):c.102752T>A (p.Met34251Lys) rs750864230
NM_001267550.2(TTN):c.102752T>C (p.Met34251Thr)
NM_001267550.2(TTN):c.102761T>C (p.Leu34254Pro) rs556155561
NM_001267550.2(TTN):c.102772C>T (p.Pro34258Ser)
NM_001267550.2(TTN):c.102794A>G (p.Tyr34265Cys) rs1559030437
NM_001267550.2(TTN):c.102795_102797TAA[1] (p.Asn34266del) rs886044414
NM_001267550.2(TTN):c.102796_102798delinsTATA (p.Asn34266fs) rs1060500589
NM_001267550.2(TTN):c.102811G>A (p.Val34271Ile) rs794727542
NM_001267550.2(TTN):c.102811G>T (p.Val34271Leu)
NM_001267550.2(TTN):c.102823G>A (p.Val34275Ile) rs879063086
NM_001267550.2(TTN):c.102833G>T (p.Gly34278Val) rs3731752
NM_001267550.2(TTN):c.102877A>G (p.Lys34293Glu) rs72629783
NM_001267550.2(TTN):c.10288A>C (p.Asn3430His) rs376029089
NM_001267550.2(TTN):c.102890A>C (p.Lys34297Thr) rs1559029083
NM_001267550.2(TTN):c.102916A>T (p.Lys34306Ter)
NM_001267550.2(TTN):c.102963C>T (p.Asn34321=) rs528502993
NM_001267550.2(TTN):c.102966T>C (p.Ser34322=) rs200172231
NM_001267550.2(TTN):c.102992A>G (p.Tyr34331Cys) rs765213170
NM_001267550.2(TTN):c.103053C>T (p.Thr34351=) rs3731753
NM_001267550.2(TTN):c.103096_103097insSVA (p.Lys34366_Arg34367insXaa)
NM_001267550.2(TTN):c.103104A>G (p.Leu34368=) rs371535721
NM_001267550.2(TTN):c.103121G>T (p.Cys34374Phe) rs368493317
NM_001267550.2(TTN):c.103147G>C (p.Glu34383Gln) rs148525155
NM_001267550.2(TTN):c.103153_103154AG[1] (p.Arg34385fs)
NM_001267550.2(TTN):c.103207C>T (p.Leu34403=) rs773892755
NM_001267550.2(TTN):c.103215C>T (p.Leu34405=) rs748516187
NM_001267550.2(TTN):c.103216G>A (p.Gly34406Arg)
NM_001267550.2(TTN):c.103226T>C (p.Ile34409Thr) rs879013405
NM_001267550.2(TTN):c.10328C>T (p.Thr3443Ile) rs746052197
NM_001267550.2(TTN):c.103292C>T (p.Thr34431Met) rs192001910
NM_001267550.2(TTN):c.103336del (p.Ser34446fs) rs1553491793
NM_001267550.2(TTN):c.103340G>A (p.Cys34447Tyr) rs770558110
NM_001267550.2(TTN):c.103351C>G (p.Leu34451Val) rs1559023612
NM_001267550.2(TTN):c.103360del (p.Glu34454fs) rs760768093
NM_001267550.2(TTN):c.103363C>T (p.Arg34455Cys) rs72629785
NM_001267550.2(TTN):c.103364G>A (p.Arg34455His) rs756023873
NM_001267550.2(TTN):c.103374C>A (p.Tyr34458Ter) rs1060500505
NM_001267550.2(TTN):c.103391A>C (p.Lys34464Thr)
NM_001267550.2(TTN):c.103409A>T (p.Glu34470Val) rs1553491559
NM_001267550.2(TTN):c.103412G>A (p.Arg34471Gln) rs149391616
NM_001267550.2(TTN):c.103417G>A (p.Val34473Ile) rs188917199
NM_001267550.2(TTN):c.103430T>C (p.Ile34477Thr) rs751914956
NM_001267550.2(TTN):c.103434C>A (p.Asp34478Glu) rs376371272
NM_001267550.2(TTN):c.103453G>T (p.Glu34485Ter)
NM_001267550.2(TTN):c.103464T>G (p.Ser34488=) rs960287076
NM_001267550.2(TTN):c.103476T>A (p.Ser34492Arg) rs878854283
NM_001267550.2(TTN):c.103478T>C (p.Val34493Ala) rs1553491321
NM_001267550.2(TTN):c.1034G>A (p.Trp345Ter)
NM_001267550.2(TTN):c.103518del (p.Ala34507fs) rs1553491220
NM_001267550.2(TTN):c.103524C>T (p.Val34508=) rs587780985
NM_001267550.2(TTN):c.103536G>A (p.Pro34512=)
NM_001267550.2(TTN):c.103540G>T (p.Val34514Leu) rs769311670
NM_001267550.2(TTN):c.103576G>C (p.Glu34526Gln) rs770742837
NM_001267550.2(TTN):c.103578G>A (p.Glu34526=) rs1478505603
NM_001267550.2(TTN):c.103580T>C (p.Ile34527Thr) rs370618537
NM_001267550.2(TTN):c.103583A>G (p.Glu34528Gly) rs745616639
NM_001267550.2(TTN):c.103598A>G (p.Glu34533Gly) rs1484143627
NM_001267550.2(TTN):c.103623T>G (p.Asp34541Glu) rs1559020199
NM_001267550.2(TTN):c.103636C>T (p.Arg34546Cys) rs777626473
NM_001267550.2(TTN):c.103659_103661AGA[2] (p.Glu34555del) rs759860918
NM_001267550.2(TTN):c.103679A>G (p.Lys34560Arg) rs544590023
NM_001267550.2(TTN):c.103687G>A (p.Val34563Met) rs369429739
NM_001267550.2(TTN):c.103688T>C (p.Val34563Ala) rs55945684
NM_001267550.2(TTN):c.103693A>G (p.Met34565Val)
NM_001267550.2(TTN):c.103750C>T (p.Leu34584Phe) rs1559018367
NM_001267550.2(TTN):c.103756A>C (p.Arg34586=) rs1012679574
NM_001267550.2(TTN):c.103759G>A (p.Val34587Ile)
NM_001267550.2(TTN):c.103772G>A (p.Arg34591Gln) rs778021095
NM_001267550.2(TTN):c.103774C>T (p.Pro34592Ser) rs748291093
NM_001267550.2(TTN):c.10378C>G (p.Pro3460Ala) rs201735487
NM_001267550.2(TTN):c.103796G>C (p.Arg34599Thr) rs1362778188
NM_001267550.2(TTN):c.103828C>T (p.Arg34610Cys) rs376443365
NM_001267550.2(TTN):c.103882G>T (p.Asp34628Tyr) rs1553490035
NM_001267550.2(TTN):c.103906C>T (p.Arg34636Cys) rs768575577
NM_001267550.2(TTN):c.103909C>T (p.Arg34637Trp) rs200716930
NM_001267550.2(TTN):c.10391A>C (p.Lys3464Thr) rs1553970272
NM_001267550.2(TTN):c.103945C>T (p.Arg34649Ter)
NM_001267550.2(TTN):c.103946G>A (p.Arg34649Gln) rs397517788
NM_001267550.2(TTN):c.103958G>T (p.Arg34653Leu) rs72629786
NM_001267550.2(TTN):c.103974C>T (p.Ile34658=) rs199714102
NM_001267550.2(TTN):c.103999A>G (p.Ile34667Val) rs749651526
NM_001267550.2(TTN):c.1039C>T (p.Gln347Ter) rs1561470471
NM_001267550.2(TTN):c.104000T>C (p.Ile34667Thr) rs727504476
NM_001267550.2(TTN):c.104005G>A (p.Asp34669Asn)
NM_001267550.2(TTN):c.104015C>T (p.Ala34672Val) rs79666048
NM_001267550.2(TTN):c.104024G>A (p.Arg34675Lys) rs765125364
NM_001267550.2(TTN):c.104027C>G (p.Thr34676Arg) rs761644963
NM_001267550.2(TTN):c.104059C>A (p.Leu34687Ile)
NM_001267550.2(TTN):c.104069G>T (p.Gly34690Val) rs964554853
NM_001267550.2(TTN):c.104089A>G (p.Ser34697Gly) rs1177374613
NM_001267550.2(TTN):c.104098C>T (p.Pro34700Ser) rs778877604
NM_001267550.2(TTN):c.104125C>T (p.Arg34709Cys) rs530959653
NM_001267550.2(TTN):c.104194C>G (p.His34732Asp) rs753769495
NM_001267550.2(TTN):c.104195A>G (p.His34732Arg) rs1250361204
NM_001267550.2(TTN):c.104205G>A (p.Thr34735=) rs752424146
NM_001267550.2(TTN):c.104222C>T (p.Thr34741Ile) rs727505306
NM_001267550.2(TTN):c.104229T>C (p.Tyr34743=) rs762295035
NM_001267550.2(TTN):c.104251G>C (p.Ala34751Pro) rs185683410
NM_001267550.2(TTN):c.104261C>T (p.Ala34754Val) rs727505020
NM_001267550.2(TTN):c.104263T>A (p.Tyr34755Asn) rs1553488819
NM_001267550.2(TTN):c.104277G>A (p.Lys34759=) rs377391143
NM_001267550.2(TTN):c.104281C>T (p.Arg34761Trp)
NM_001267550.2(TTN):c.104282G>A (p.Arg34761Gln) rs200773170
NM_001267550.2(TTN):c.104333C>T (p.Thr34778Met) rs762158917
NM_001267550.2(TTN):c.104347C>T (p.Leu34783Phe) rs539735520
NM_001267550.2(TTN):c.10434C>T (p.Asn3478=) rs749590376
NM_001267550.2(TTN):c.104359A>G (p.Lys34787Glu) rs769788281
NM_001267550.2(TTN):c.10435G>A (p.Gly3479Arg) rs746691102
NM_001267550.2(TTN):c.104364C>T (p.Ser34788=) rs181679744
NM_001267550.2(TTN):c.104365G>A (p.Glu34789Lys) rs190565627
NM_001267550.2(TTN):c.104365G>C (p.Glu34789Gln) rs190565627
NM_001267550.2(TTN):c.104368C>T (p.Leu34790Phe) rs551824963
NM_001267550.2(TTN):c.104377A>C (p.Met34793Leu) rs72629787
NM_001267550.2(TTN):c.104413C>T (p.Arg34805Ter) rs750519430
NM_001267550.2(TTN):c.104414G>A (p.Arg34805Gln) rs115150240
NM_001267550.2(TTN):c.104444T>C (p.Ile34815Thr)
NM_001267550.2(TTN):c.10444G>A (p.Val3482Ile) rs1553970119
NM_001267550.2(TTN):c.104458G>A (p.Glu34820Lys) rs766062367
NM_001267550.2(TTN):c.104483A>G (p.Glu34828Gly)
NM_001267550.2(TTN):c.104515C>T (p.Arg34839Ter) rs1553488049
NM_001267550.2(TTN):c.104519G>A (p.Arg34840Gln) rs199710082
NM_001267550.2(TTN):c.104560G>C (p.Val34854Leu) rs55866005
NM_001267550.2(TTN):c.104561T>G (p.Val34854Gly) rs768717312
NM_001267550.2(TTN):c.104575C>T (p.Arg34859Trp) rs879243057
NM_001267550.2(TTN):c.104576G>A (p.Arg34859Gln) rs68080670
NM_001267550.2(TTN):c.104582G>A (p.Arg34861His) rs777774818
NM_001267550.2(TTN):c.10458G>A (p.Ala3486=) rs759465333
NM_001267550.2(TTN):c.104592G>A (p.Pro34864=) rs144094650
NM_001267550.2(TTN):c.104592G>T (p.Pro34864=) rs144094650
NM_001267550.2(TTN):c.104605G>A (p.Glu34869Lys) rs563430855
NM_001267550.2(TTN):c.104627C>T (p.Ser34876Leu)
NM_001267550.2(TTN):c.104660C>T (p.Pro34887Leu) rs774131659
NM_001267550.2(TTN):c.104690C>T (p.Ser34897Leu) rs373446383
NM_001267550.2(TTN):c.104691G>A (p.Ser34897=) rs369619711
NM_001267550.2(TTN):c.104711G>T (p.Arg34904Ile) rs780506196
NM_001267550.2(TTN):c.104769A>C (p.Thr34923=) rs56375087
NM_001267550.2(TTN):c.104771C>A (p.Ser34924Ter) rs1559003939
NM_001267550.2(TTN):c.104774A>C (p.Glu34925Ala) rs201218828
NM_001267550.2(TTN):c.104822C>A (p.Ala34941Asp) rs1445357252
NM_001267550.2(TTN):c.104867G>A (p.Gly34956Asp) rs145748940
NM_001267550.2(TTN):c.104883T>G (p.Phe34961Leu)
NM_001267550.2(TTN):c.104901T>G (p.Ser34967=) rs367610925
NM_001267550.2(TTN):c.104904G>C (p.Lys34968Asn) rs1274496471
NM_001267550.2(TTN):c.104914G>A (p.Glu34972Lys) rs727504918
NM_001267550.2(TTN):c.104936G>C (p.Gly34979Ala) rs376634193
NM_001267550.2(TTN):c.104943A>G (p.Glu34981=) rs372312805
NM_001267550.2(TTN):c.104952A>C (p.Glu34984Asp) rs1434654451
NM_001267550.2(TTN):c.104953A>G (p.Ser34985Gly) rs765030518
NM_001267550.2(TTN):c.104986G>T (p.Val34996Phe)
NM_001267550.2(TTN):c.10504C>T (p.Gln3502Ter)
NM_001267550.2(TTN):c.105085T>C (p.Leu35029=) rs374678473
NM_001267550.2(TTN):c.105090C>T (p.Asp35030=) rs72629789
NM_001267550.2(TTN):c.105091G>A (p.Val35031Met) rs552058608
NM_001267550.2(TTN):c.1050C>T (p.Tyr350=) rs375448572
NM_001267550.2(TTN):c.105127C>T (p.Arg35043Cys) rs200378865
NM_001267550.2(TTN):c.105128G>A (p.Arg35043His) rs370137295
NM_001267550.2(TTN):c.105134A>T (p.Asp35045Val) rs1001393566
NM_001267550.2(TTN):c.105180G>C (p.Glu35060Asp) rs56308529
NM_001267550.2(TTN):c.105182C>A (p.Ala35061Glu)
NM_001267550.2(TTN):c.105183G>A (p.Ala35061=) rs371075036
NM_001267550.2(TTN):c.1051G>A (p.Val351Met) rs772889673
NM_001267550.2(TTN):c.105225T>G (p.Ala35075=) rs769757318
NM_001267550.2(TTN):c.105228G>A (p.Ser35076=) rs55938627
NM_001267550.2(TTN):c.105260C>T (p.Thr35087Met) rs397517795
NM_001267550.2(TTN):c.105301T>C (p.Ser35101Pro) rs759062212
NM_001267550.2(TTN):c.105317G>A (p.Ser35106Asn)
NM_001267550.2(TTN):c.105336G>A (p.Lys35112=) rs546048021
NM_001267550.2(TTN):c.10535T>C (p.Val3512Ala) rs200918396
NM_001267550.2(TTN):c.105374C>T (p.Thr35125Met) rs747161494
NM_001267550.2(TTN):c.105375G>A (p.Thr35125=) rs780294413
NM_001267550.2(TTN):c.10537T>C (p.Phe3513Leu) rs771751290
NM_001267550.2(TTN):c.105413T>C (p.Met35138Thr) rs771741670
NM_001267550.2(TTN):c.105424G>C (p.Glu35142Gln)
NM_001267550.2(TTN):c.105429C>T (p.Gly35143=) rs368591364
NM_001267550.2(TTN):c.105468G>A (p.Pro35156=) rs55806007
NM_001267550.2(TTN):c.105482C>A (p.Thr35161Asn) rs372263729
NM_001267550.2(TTN):c.105490C>T (p.Arg35164Cys) rs200123047
NM_001267550.2(TTN):c.105491G>A (p.Arg35164His) rs768358201
NM_001267550.2(TTN):c.105493A>G (p.Lys35165Glu)
NM_001267550.2(TTN):c.105497G>T (p.Gly35166Val) rs1060500538
NM_001267550.2(TTN):c.105499C>G (p.Gln35167Glu) rs1558994144
NM_001267550.2(TTN):c.105512C>T (p.Thr35171Ile) rs774524898
NM_001267550.2(TTN):c.105514_105516del (p.Ser35172del) rs573843615
NM_001267550.2(TTN):c.105515C>A (p.Ser35172Tyr)
NM_001267550.2(TTN):c.105521G>A (p.Arg35174His) rs756575734
NM_001267550.2(TTN):c.105529G>A (p.Val35177Met) rs55865284
NM_001267550.2(TTN):c.105539C>A (p.Thr35180Lys)
NM_001267550.2(TTN):c.105571G>A (p.Val35191Ile) rs1290162863
NM_001267550.2(TTN):c.105582C>T (p.Ser35194=) rs3829749
NM_001267550.2(TTN):c.105600C>G (p.Ser35200Arg) rs1553485050
NM_001267550.2(TTN):c.105608T>C (p.Val35203Ala) rs771136390
NM_001267550.2(TTN):c.105642C>A (p.Phe35214Leu) rs560557634
NM_001267550.2(TTN):c.105653T>C (p.Ile35218Thr) rs143499441
NM_001267550.2(TTN):c.105662C>A (p.Ala35221Asp) rs1558992011
NM_001267550.2(TTN):c.105718C>T (p.Arg35240Trp) rs752729073
NM_001267550.2(TTN):c.105719G>A (p.Arg35240Gln) rs530537991
NM_001267550.2(TTN):c.105737C>G (p.Ala35246Gly) rs370476812
NM_001267550.2(TTN):c.105757G>A (p.Val35253Met) rs373655492
NM_001267550.2(TTN):c.105769G>A (p.Glu35257Lys) rs56324595
NM_001267550.2(TTN):c.105782C>T (p.Pro35261Leu) rs16866380
NM_001267550.2(TTN):c.105787_105788delinsTT (p.Ala35263Phe) rs794729250
NM_001267550.2(TTN):c.105790G>C (p.Val35264Leu) rs770730954
NM_001267550.2(TTN):c.105821C>T (p.Thr35274Ile) rs2857271
NM_001267550.2(TTN):c.105851C>G (p.Ala35284Gly) rs1553484434
NM_001267550.2(TTN):c.105873C>A (p.Phe35291Leu)
NM_001267550.2(TTN):c.105876G>A (p.Leu35292=) rs372521529
NM_001267550.2(TTN):c.10589A>T (p.Tyr3530Phe) rs755931621
NM_001267550.2(TTN):c.105916G>A (p.Val35306Met) rs1434315858
NM_001267550.2(TTN):c.105920T>C (p.Val35307Ala) rs780629996
NM_001267550.2(TTN):c.105929G>C (p.Ser35310Thr) rs1553484229
NM_001267550.2(TTN):c.10592C>G (p.Ser3531Ter) rs767420661
NM_001267550.2(TTN):c.105940G>A (p.Ala35314Thr) rs377171054
NM_001267550.2(TTN):c.105953C>G (p.Thr35318Ser) rs1391706140
NM_001267550.2(TTN):c.106018G>A (p.Gly35340Ser) rs373610666
NM_001267550.2(TTN):c.106020T>C (p.Gly35340=) rs148865574
NM_001267550.2(TTN):c.106025A>G (p.Tyr35342Cys) rs1060500560
NM_001267550.2(TTN):c.106044C>A (p.Asn35348Lys) rs145560044
NM_001267550.2(TTN):c.106057G>A (p.Asp35353Asn)
NM_001267550.2(TTN):c.106061A>G (p.Gln35354Arg) rs546343124
NM_001267550.2(TTN):c.106073T>A (p.Val35358Asp) rs1172243981
NM_001267550.2(TTN):c.10608G>A (p.Gln3536=) rs371651343
NM_001267550.2(TTN):c.106094G>A (p.Gly35365Asp) rs778524334
NM_001267550.2(TTN):c.10609T>C (p.Tyr3537His) rs1553969617
NM_001267550.2(TTN):c.106114_106115dup (p.Leu35372fs)
NM_001267550.2(TTN):c.106121T>A (p.Phe35374Tyr) rs727504609
NM_001267550.2(TTN):c.106133C>G (p.Ala35378Gly) rs555476312
NM_001267550.2(TTN):c.106137dup (p.Lys35380Ter) rs886044460
NM_001267550.2(TTN):c.106188T>A (p.Asp35396Glu) rs770681247
NM_001267550.2(TTN):c.106188T>C (p.Asp35396=) rs770681247
NM_001267550.2(TTN):c.106229C>G (p.Pro35410Arg) rs1553483445
NM_001267550.2(TTN):c.106240G>C (p.Glu35414Gln) rs1558984927
NM_001267550.2(TTN):c.106286C>A (p.Thr35429Lys) rs1241466221
NM_001267550.2(TTN):c.106379T>C (p.Ile35460Thr) rs1398739704
NM_001267550.2(TTN):c.106423T>A (p.Phe35475Ile) rs377463445
NM_001267550.2(TTN):c.106439A>G (p.His35480Arg) rs766337455
NM_001267550.2(TTN):c.106442A>G (p.Lys35481Arg) rs200716018
NM_001267550.2(TTN):c.106451C>A (p.Thr35484Asn) rs754163825
NM_001267550.2(TTN):c.106468T>C (p.Tyr35490His) rs199663911
NM_001267550.2(TTN):c.106476T>C (p.Cys35492=) rs6725673
NM_001267550.2(TTN):c.106482A>G (p.Val35494=) rs766024055
NM_001267550.2(TTN):c.106511G>C (p.Ser35504Thr) rs575070622
NM_001267550.2(TTN):c.106525A>G (p.Ile35509Val) rs1553482514
NM_001267550.2(TTN):c.106531+6T>C rs772189154
NM_001267550.2(TTN):c.106531G>A (p.Ala35511Thr)
NM_001267550.2(TTN):c.106537A>G (p.Lys35513Glu)
NM_001267550.2(TTN):c.10654G>C (p.Ala3552Pro) rs774004409
NM_001267550.2(TTN):c.106556A>G (p.Lys35519Arg) rs1422047351
NM_001267550.2(TTN):c.106573A>G (p.Thr35525Ala)
NM_001267550.2(TTN):c.106578T>A (p.Ser35526=) rs55838839
NM_001267550.2(TTN):c.10657A>G (p.Thr3553Ala) rs1553969472
NM_001267550.2(TTN):c.106580A>T (p.Glu35527Val) rs55725279
NM_001267550.2(TTN):c.10659A>G (p.Thr3553=) rs748958021
NM_001267550.2(TTN):c.106601C>T (p.Ala35534Val) rs878854284
NM_001267550.2(TTN):c.106603G>A (p.Val35535Ile) rs1553481274
NM_001267550.2(TTN):c.106604T>C (p.Val35535Ala) rs368179478
NM_001267550.2(TTN):c.106619T>C (p.Ile35540Thr) rs55880440
NM_001267550.2(TTN):c.106638G>A (p.Arg35546=) rs56324602
NM_001267550.2(TTN):c.106648A>G (p.Ile35550Val)
NM_001267550.2(TTN):c.106675G>C (p.Glu35559Gln) rs199632397
NM_001267550.2(TTN):c.1066G>C (p.Glu356Gln) rs144531477
NM_001267550.2(TTN):c.106723G>A (p.Glu35575Lys) rs886055217
NM_001267550.2(TTN):c.106727T>G (p.Val35576Gly)
NM_001267550.2(TTN):c.106787C>T (p.Thr35596Ile) rs55842557
NM_001267550.2(TTN):c.106788A>T (p.Thr35596=) rs369896045
NM_001267550.2(TTN):c.106801G>A (p.Glu35601Lys) rs1558972236
NM_001267550.2(TTN):c.106820C>T (p.Ala35607Val) rs377337528
NM_001267550.2(TTN):c.106827T>G (p.Ile35609Met) rs727504540
NM_001267550.2(TTN):c.106853T>C (p.Ile35618Thr)
NM_001267550.2(TTN):c.106857C>A (p.Asn35619Lys)
NM_001267550.2(TTN):c.106857C>T (p.Asn35619=) rs116604145
NM_001267550.2(TTN):c.106895G>T (p.Gly35632Val) rs1210557316
NM_001267550.2(TTN):c.1068G>A (p.Glu356=) rs144716589
NM_001267550.2(TTN):c.106911A>G (p.Lys35637=) rs767045071
NM_001267550.2(TTN):c.106920G>A (p.Leu35640=) rs183923129
NM_001267550.2(TTN):c.106955G>A (p.Arg35652Gln) rs200497615
NM_001267550.2(TTN):c.106957T>G (p.Tyr35653Asp) rs886042500
NM_001267550.2(TTN):c.106974C>T (p.Ser35658=) rs761795663
NM_001267550.2(TTN):c.106991T>G (p.Ile35664Ser) rs1060500501
NM_001267550.2(TTN):c.10700G>A (p.Ser3567Asn) rs72955213
NM_001267550.2(TTN):c.107049A>G (p.Glu35683=) rs1390069717
NM_001267550.2(TTN):c.107058C>T (p.Val35686=) rs767818722
NM_001267550.2(TTN):c.107066A>G (p.Gln35689Arg) rs1451601178
NM_001267550.2(TTN):c.107080C>G (p.Leu35694Val) rs769369764
NM_001267550.2(TTN):c.107082G>A (p.Leu35694=) rs727505278
NM_001267550.2(TTN):c.107098G>A (p.Asp35700Asn)
NM_001267550.2(TTN):c.107099A>G (p.Asp35700Gly) rs1060500391
NM_001267550.2(TTN):c.107104C>G (p.Pro35702Ala) rs551126367
NM_001267550.2(TTN):c.107105C>T (p.Pro35702Leu) rs772957495
NM_001267550.2(TTN):c.107123C>T (p.Pro35708Leu) rs71423567
NM_001267550.2(TTN):c.107157T>C (p.Val35719=) rs1553479771
NM_001267550.2(TTN):c.107181C>T (p.Gly35727=) rs762859509
NM_001267550.2(TTN):c.107223+1G>A rs876658102
NM_001267550.2(TTN):c.107225T>C (p.Ile35742Thr) rs1553479315
NM_001267550.2(TTN):c.107230A>G (p.Ile35744Val) rs142336788
NM_001267550.2(TTN):c.107255G>A (p.Arg35752His) rs760107623
NM_001267550.2(TTN):c.107267T>C (p.Val35756Ala) rs16866378
NM_001267550.2(TTN):c.10726A>G (p.Thr3576Ala) rs6433728
NM_001267550.2(TTN):c.107284C>A (p.Arg35762=) rs1477669354
NM_001267550.2(TTN):c.107284C>T (p.Arg35762Ter)
NM_001267550.2(TTN):c.107290G>T (p.Ala35764Ser) rs879048717
NM_001267550.2(TTN):c.107292A>G (p.Ala35764=) rs1553479171
NM_001267550.2(TTN):c.107320A>G (p.Ile35774Val) rs774401824
NM_001267550.2(TTN):c.107339G>A (p.Arg35780His) rs770904787
NM_001267550.2(TTN):c.107377+1G>A rs112188483
NM_001267550.2(TTN):c.107387A>C (p.Glu35796Ala) rs1553478042
NM_001267550.2(TTN):c.107397C>T (p.Ser35799=) rs371480338
NM_001267550.2(TTN):c.107456_107459AGTC[3] (p.Gln35822fs) rs886042246
NM_001267550.2(TTN):c.107517T>G (p.Ser35839Arg) rs776981475
NM_001267550.2(TTN):c.107540A>G (p.Lys35847Arg)
NM_001267550.2(TTN):c.107557G>A (p.Ala35853Thr) rs1553477669
NM_001267550.2(TTN):c.107559C>G (p.Ala35853=) rs1060503952
NM_001267550.2(TTN):c.107564G>T (p.Ser35855Ile) rs1053387515
NM_001267550.2(TTN):c.107576T>C (p.Met35859Thr) rs72629793
NM_001267550.2(TTN):c.107590G>C (p.Val35864Leu) rs746430344
NM_001267550.2(TTN):c.107591T>C (p.Val35864Ala) rs374859388
NM_001267550.2(TTN):c.10759A>C (p.Thr3587Pro) rs370496599
NM_001267550.2(TTN):c.107605A>G (p.Ser35869Gly) rs201835888
NM_001267550.2(TTN):c.107630T>C (p.Met35877Thr) rs375824821
NM_001267550.2(TTN):c.107634A>G (p.Thr35878=) rs878854285
NM_001267550.2(TTN):c.107671G>A (p.Gly35891Ser) rs201298767
NM_001267550.2(TTN):c.107688G>A (p.Pro35896=) rs542575761
NM_001267550.2(TTN):c.107700A>G (p.Glu35900=) rs55832587
NM_001267550.2(TTN):c.10770G>A (p.Glu3590=) rs377401997
NM_001267550.2(TTN):c.10770G>C (p.Glu3590Asp) rs377401997
NM_001267550.2(TTN):c.107724T>C (p.Ile35908=) rs748517132
NM_001267550.2(TTN):c.107753G>A (p.Cys35918Tyr) rs193212275
NM_001267550.2(TTN):c.107766T>C (p.Gly35922=) rs147293964
NM_001267550.2(TTN):c.107774C>A (p.Thr35925Asn) rs755111765
NM_001267550.2(TTN):c.107774C>T (p.Thr35925Ile) rs755111765
NM_001267550.2(TTN):c.107780_107790delinsTGAAAGAAAAA (p.Glu35927_Trp35930delinsValLysGluLys) rs281864927
NM_001267550.2(TTN):c.107833T>A (p.Phe35945Ile)
NM_001267550.2(TTN):c.107839A>G (p.Ile35947Val) rs1553476576
NM_001267550.2(TTN):c.107840T>G (p.Ile35947Ser) rs281864928
NM_001267550.2(TTN):c.107864C>T (p.Thr35955Ile) rs370267738
NM_001267550.2(TTN):c.107881G>A (p.Val35961Ile) rs780886524
NM_001267550.2(TTN):c.107900G>A (p.Gly35967Glu) rs780316966
NM_001267550.2(TTN):c.107957T>C (p.Ile35986Thr) rs1060500541
NM_001267550.2(TTN):c.107961T>C (p.His35987=) rs377439315
NM_001267550.2(TTN):c.107965C>T (p.Arg35989Ter) rs770506970
NM_001267550.2(TTN):c.1079G>C (p.Arg360Thr) rs56128843
NM_001267550.2(TTN):c.10825G>A (p.Glu3609Lys) rs1016683077
NM_001267550.2(TTN):c.10834G>C (p.Val3612Leu) rs1352067592
NM_001267550.2(TTN):c.10840G>T (p.Glu3614Ter) rs540059730
NM_001267550.2(TTN):c.10850C>T (p.Ser3617Phe) rs57389274
NM_001267550.2(TTN):c.10854A>C (p.Gln3618His) rs79466278
NM_001267550.2(TTN):c.10922T>C (p.Ile3641Thr) rs141027782
NM_001267550.2(TTN):c.10931G>A (p.Ser3644Asn) rs78535378
NM_001267550.2(TTN):c.10990C>T (p.Leu3664=) rs1445421739
NM_001267550.2(TTN):c.11019C>T (p.Cys3673=) rs72955212
NM_001267550.2(TTN):c.11066T>C (p.Ile3689Thr) rs527924868
NM_001267550.2(TTN):c.11103G>A (p.Glu3701=) rs762913656
NM_001267550.2(TTN):c.11109C>T (p.Ser3703=) rs879160199
NM_001267550.2(TTN):c.11209G>A (p.Asp3737Asn) rs1243794346
NM_001267550.2(TTN):c.11252_11253delinsAA (p.Gly3751Glu) rs1553967105
NM_001267550.2(TTN):c.11288_11289del (p.Gln3763fs)
NM_001267550.2(TTN):c.11324C>T (p.Ser3775Phe) rs892763465
NM_001267550.2(TTN):c.11359G>A (p.Ala3787Thr) rs779416521
NM_001267550.2(TTN):c.11361C>T (p.Ala3787=) rs747366406
NM_001267550.2(TTN):c.11362G>A (p.Glu3788Lys) rs540469851
NM_001267550.2(TTN):c.11370A>G (p.Gln3790=) rs72648918
NM_001267550.2(TTN):c.1137A>G (p.Arg379=) rs55972547
NM_001267550.2(TTN):c.11415A>G (p.Pro3805=) rs561157636
NM_001267550.2(TTN):c.11444del (p.Lys3815fs)
NM_001267550.2(TTN):c.11461A>G (p.Ile3821Val) rs867402675
NM_001267550.2(TTN):c.11506G>A (p.Val3836Met) rs397517825
NM_001267550.2(TTN):c.11613C>T (p.Asp3871=) rs781329648
NM_001267550.2(TTN):c.11637del (p.Leu3880fs) rs1560926034
NM_001267550.2(TTN):c.1165A>G (p.Ser389Gly) rs1255499093
NM_001267550.2(TTN):c.11667G>T (p.Glu3889Asp) rs377423256
NM_001267550.2(TTN):c.11672C>T (p.Thr3891Ile) rs148164929
NM_001267550.2(TTN):c.11676T>C (p.Cys3892=) rs879119259
NM_001267550.2(TTN):c.11678T>C (p.Met3893Thr) rs1553941782
NM_001267550.2(TTN):c.11684G>A (p.Ser3895Asn) rs769466475
NM_001267550.2(TTN):c.11687A>G (p.Asn3896Ser) rs1207560844
NM_001267550.2(TTN):c.11706A>G (p.Ile3902Met) rs368845723
NM_001267550.2(TTN):c.11712T>C (p.Ser3904=) rs553478382
NM_001267550.2(TTN):c.11719C>G (p.Leu3907Val) rs55853696
NM_001267550.2(TTN):c.11811T>C (p.Pro3937=) rs571602215
NM_001267550.2(TTN):c.11825A>C (p.Lys3942Thr) rs1060500569
NM_001267550.2(TTN):c.11843G>A (p.Arg3948His) rs775618077
NM_001267550.2(TTN):c.11843G>T (p.Arg3948Leu) rs775618077
NM_001267550.2(TTN):c.11855G>A (p.Gly3952Glu) rs779033634
NM_001267550.2(TTN):c.1185C>A (p.Ala395=) rs372346898
NM_001267550.2(TTN):c.1185C>T (p.Ala395=) rs372346898
NM_001267550.2(TTN):c.1186G>A (p.Ala396Thr) rs200052202
NM_001267550.2(TTN):c.11881G>A (p.Val3961Met) rs1017307763
NM_001267550.2(TTN):c.118T>C (p.Phe40Leu) rs1554045595
NM_001267550.2(TTN):c.11903C>T (p.Thr3968Ile) rs1416083040
NM_001267550.2(TTN):c.11912G>A (p.Trp3971Ter) rs869312102
NM_001267550.2(TTN):c.11959A>G (p.Ile3987Val) rs551387805
NM_001267550.2(TTN):c.11969C>T (p.Pro3990Leu) rs33971253
NM_001267550.2(TTN):c.12011A>G (p.Glu4004Gly) rs376000381
NM_001267550.2(TTN):c.12016_12019dup (p.Gly4007fs) rs1553940935
NM_001267550.2(TTN):c.12024C>T (p.Leu4008=) rs371694842
NM_001267550.2(TTN):c.12052G>A (p.Gly4018Ser) rs759214389
NM_001267550.2(TTN):c.12066T>G (p.Cys4022Trp) rs931245340
NM_001267550.2(TTN):c.1208G>C (p.Ser403Thr) rs727505091
NM_001267550.2(TTN):c.12113C>A (p.Thr4038Asn) rs758968807
NM_001267550.2(TTN):c.12113C>G (p.Thr4038Ser) rs758968807
NM_001267550.2(TTN):c.12117C>T (p.Pro4039=) rs55895721
NM_001267550.2(TTN):c.1212C>T (p.Tyr404=) rs139187345
NM_001267550.2(TTN):c.1213G>A (p.Ala405Thr) rs112266780
NM_001267550.2(TTN):c.12145C>T (p.Pro4049Ser) rs201888760
NM_001267550.2(TTN):c.12175G>T (p.Gly4059Cys) rs377114166
NM_001267550.2(TTN):c.12181G>A (p.Ala4061Thr) rs397517829
NM_001267550.2(TTN):c.12195T>C (p.Leu4065=) rs201129413
NM_001267550.2(TTN):c.12208G>A (p.Glu4070Lys) rs397517830
NM_001267550.2(TTN):c.12233C>T (p.Thr4078Ile) rs80136515
NM_001267550.2(TTN):c.12234C>G (p.Thr4078=) rs192857526
NM_001267550.2(TTN):c.12235A>G (p.Ile4079Val) rs34070843
NM_001267550.2(TTN):c.12316C>T (p.Gln4106Ter) rs1553940122
NM_001267550.2(TTN):c.12324T>C (p.Pro4108=) rs537284713
NM_001267550.2(TTN):c.12332C>G (p.Ala4111Gly) rs140289517
NM_001267550.2(TTN):c.12358C>T (p.Gln4120Ter)
NM_001267550.2(TTN):c.12369C>T (p.Leu4123=) rs372053333
NM_001267550.2(TTN):c.12387G>A (p.Arg4129=) rs199546417
NM_001267550.2(TTN):c.12397_12505dup (p.Pro4169fs) rs1553939638
NM_001267550.2(TTN):c.12404A>G (p.Asn4135Ser) rs565638291
NM_001267550.2(TTN):c.12416A>G (p.His4139Arg) rs72648920
NM_001267550.2(TTN):c.12423G>A (p.Gln4141=) rs1310898352
NM_001267550.2(TTN):c.12434A>C (p.Glu4145Ala) rs372744369
NM_001267550.2(TTN):c.12470C>T (p.Ser4157Phe) rs771706692
NM_001267550.2(TTN):c.12484T>C (p.Ser4162Pro) rs548726318
NM_001267550.2(TTN):c.12517_12518GA[1] (p.Glu4173fs) rs1553939605
NM_001267550.2(TTN):c.12543C>T (p.Thr4181=) rs764856949
NM_001267550.2(TTN):c.12547A>G (p.Lys4183Glu) rs201565932
NM_001267550.2(TTN):c.12572T>C (p.Ile4191Thr) rs371669309
NM_001267550.2(TTN):c.12580A>T (p.Ile4194Phe) rs34618570
NM_001267550.2(TTN):c.12587C>A (p.Ser4196Ter) rs370912401
NM_001267550.2(TTN):c.12612_12625del (p.Thr4204_Leu4205insTer)
NM_001267550.2(TTN):c.12679A>T (p.Thr4227Ser) rs1553939161
NM_001267550.2(TTN):c.12680C>A (p.Thr4227Asn) rs777055785
NM_001267550.2(TTN):c.12704C>A (p.Ser4235Ter) rs1253161767
NM_001267550.2(TTN):c.12726T>C (p.Ser4242=) rs1191147375
NM_001267550.2(TTN):c.12733A>C (p.Asn4245His) rs199652066
NM_001267550.2(TTN):c.12742C>T (p.Gln4248Ter) rs794729308
NM_001267550.2(TTN):c.12766G>A (p.Glu4256Lys) rs1560908997
NM_001267550.2(TTN):c.12780G>T (p.Ala4260=) rs746578
NM_001267550.2(TTN):c.12801A>T (p.Leu4267Phe) rs750553032
NM_001267550.2(TTN):c.12813C>A (p.His4271Gln) rs373302409
NM_001267550.2(TTN):c.12817G>A (p.Glu4273Lys) rs1553938808
NM_001267550.2(TTN):c.12821G>A (p.Ser4274Asn) rs200348414
NM_001267550.2(TTN):c.12823C>T (p.Leu4275Phe) rs773905874
NM_001267550.2(TTN):c.12830G>A (p.Ser4277Asn) rs878854286
NM_001267550.2(TTN):c.12845T>A (p.Ile4282Asn) rs747907234
NM_001267550.2(TTN):c.12870dup (p.Val4291fs) rs869025556
NM_001267550.2(TTN):c.12889T>G (p.Cys4297Gly) rs377063950
NM_001267550.2(TTN):c.12895G>C (p.Glu4299Gln) rs1430420761
NM_001267550.2(TTN):c.12937A>G (p.Asn4313Asp) rs1553938408
NM_001267550.2(TTN):c.12957G>A (p.Ala4319=) rs762330685
NM_001267550.2(TTN):c.1297G>A (p.Val433Ile) rs146000949
NM_001267550.2(TTN):c.12981C>G (p.Ser4327=) rs1553938292
NM_001267550.2(TTN):c.12986G>A (p.Arg4329Lys) rs199560188
NM_001267550.2(TTN):c.13015G>A (p.Val4339Ile) rs756186781
NM_001267550.2(TTN):c.13023C>T (p.Leu4341=) rs377195944
NM_001267550.2(TTN):c.13048G>A (p.Val4350Met) rs781206839
NM_001267550.2(TTN):c.1304T>C (p.Met435Thr) rs770187975
NM_001267550.2(TTN):c.13062C>T (p.Asp4354=) rs1553938075
NM_001267550.2(TTN):c.13068C>A (p.Ile4356=) rs1553938065
NM_001267550.2(TTN):c.13075T>C (p.Ser4359Pro) rs1060500434
NM_001267550.2(TTN):c.13086G>A (p.Glu4362=) rs753471578
NM_001267550.2(TTN):c.13098_13101AAAG[1] (p.Lys4368fs) rs1553937967
NM_001267550.2(TTN):c.13117C>T (p.Gln4373Ter) rs1064793411
NM_001267550.2(TTN):c.13144dup (p.Ser4382fs) rs1560902834
NM_001267550.2(TTN):c.1318G>A (p.Glu440Lys) rs747410439
NM_001267550.2(TTN):c.13194A>G (p.Gln4398=) rs375347596
NM_001267550.2(TTN):c.13202G>A (p.Arg4401Gln) rs200431386
NM_001267550.2(TTN):c.13219G>A (p.Val4407Met) rs539154603
NM_001267550.2(TTN):c.13262A>G (p.Asn4421Ser) rs72648922
NM_001267550.2(TTN):c.13265T>G (p.Ile4422Ser) rs727503656
NM_001267550.2(TTN):c.13282G>A (p.Glu4428Lys) rs528766978
NM_001267550.2(TTN):c.13287T>C (p.Ala4429=) rs370604524
NM_001267550.2(TTN):c.1330A>G (p.Ser444Gly) rs767156649
NM_001267550.2(TTN):c.13320G>A (p.Met4440Ile) rs768996215
NM_001267550.2(TTN):c.1332C>T (p.Ser444=) rs759520186
NM_001267550.2(TTN):c.1333G>A (p.Ala445Thr) rs142414432
NM_001267550.2(TTN):c.13371C>T (p.Ile4457=) rs570991398
NM_001267550.2(TTN):c.13435G>A (p.Ala4479Thr) rs776871094
NM_001267550.2(TTN):c.13458C>T (p.Asp4486=) rs748885610
NM_001267550.2(TTN):c.13459A>G (p.Ile4487Val) rs1553937057
NM_001267550.2(TTN):c.13487A>G (p.Gln4496Arg) rs878854287
NM_001267550.2(TTN):c.13488G>T (p.Gln4496His) rs1383626434
NM_001267550.2(TTN):c.13510C>A (p.Gln4504Lys) rs761901186
NM_001267550.2(TTN):c.13525del (p.Ser4509fs) rs1553936898
NM_001267550.2(TTN):c.13555A>G (p.Ile4519Val) rs759140842
NM_001267550.2(TTN):c.13618G>A (p.Val4540Met) rs201046911
NM_001267550.2(TTN):c.13701T>G (p.Asp4567Glu) rs200422152
NM_001267550.2(TTN):c.13706G>A (p.Ser4569Asn) rs115532048
NM_001267550.2(TTN):c.13782G>A (p.Gln4594=) rs188071134
NM_001267550.2(TTN):c.13817C>G (p.Pro4606Arg) rs762079270
NM_001267550.2(TTN):c.13821G>T (p.Met4607Ile) rs1553936266
NM_001267550.2(TTN):c.13829C>G (p.Thr4610Arg) rs748210214
NM_001267550.2(TTN):c.13859G>A (p.Gly4620Asp) rs55857742
NM_001267550.2(TTN):c.13883C>T (p.Ser4628Phe) rs794729602
NM_001267550.2(TTN):c.13900G>T (p.Glu4634Ter) rs869312103
NM_001267550.2(TTN):c.13934C>A (p.Pro4645His) rs1553936055
NM_001267550.2(TTN):c.13940A>G (p.Asp4647Gly) rs781348816
NM_001267550.2(TTN):c.13943_13947dup (p.Phe4650fs) rs767038068
NM_001267550.2(TTN):c.13945A>G (p.Lys4649Glu) rs1060500392
NM_001267550.2(TTN):c.13969A>C (p.Asn4657His) rs200204761
NM_001267550.2(TTN):c.13G>A (p.Ala5Thr) rs552620474
NM_001267550.2(TTN):c.14002A>G (p.Thr4668Ala) rs758920941
NM_001267550.2(TTN):c.14004C>T (p.Thr4668=) rs201200682
NM_001267550.2(TTN):c.14014C>A (p.Gln4672Lys) rs1553935908
NM_001267550.2(TTN):c.14022G>A (p.Glu4674=) rs761849101
NM_001267550.2(TTN):c.1402A>C (p.Arg468=) rs1554033812
NM_001267550.2(TTN):c.14050G>A (p.Gly4684Arg) rs377579941
NM_001267550.2(TTN):c.14095G>T (p.Ala4699Ser) rs1172448062
NM_001267550.2(TTN):c.14118C>G (p.Ile4706Met) rs267599072
NM_001267550.2(TTN):c.14152A>G (p.Lys4718Glu) rs757119133
NM_001267550.2(TTN):c.14171A>G (p.Gln4724Arg) rs1553934896
NM_001267550.2(TTN):c.14188C>A (p.Arg4730=)
NM_001267550.2(TTN):c.14189G>A (p.Arg4730Gln) rs202017278
NM_001267550.2(TTN):c.14198G>A (p.Trp4733Ter)
NM_001267550.2(TTN):c.14212C>A (p.Arg4738=) rs1311308523
NM_001267550.2(TTN):c.14232C>A (p.Asp4744Glu) rs55906845
NM_001267550.2(TTN):c.14287del (p.Gln4763fs) rs1560880125
NM_001267550.2(TTN):c.14296G>A (p.Asp4766Asn) rs981499527
NM_001267550.2(TTN):c.1429A>T (p.Thr477Ser) rs727503705
NM_001267550.2(TTN):c.14302G>A (p.Gly4768Ser) rs727503652
NM_001267550.2(TTN):c.14309A>G (p.Tyr4770Cys) rs371552518
NM_001267550.2(TTN):c.14320G>A (p.Ala4774Thr) rs1404878972
NM_001267550.2(TTN):c.14343C>T (p.Val4781=) rs570400005
NM_001267550.2(TTN):c.14371+8C>T rs751432909
NM_001267550.2(TTN):c.14372-2A>C rs747942388
NM_001267550.2(TTN):c.14424G>C (p.Val4808=) rs374479775
NM_001267550.2(TTN):c.14451A>G (p.Thr4817=) rs370621465
NM_001267550.2(TTN):c.14464C>T (p.Pro4822Ser) rs762428750
NM_001267550.2(TTN):c.1447G>A (p.Ala483Thr) rs34337578
NM_001267550.2(TTN):c.14486A>C (p.Gln4829Pro) rs375177753
NM_001267550.2(TTN):c.14502A>G (p.Ala4834=) rs779926164
NM_001267550.2(TTN):c.14533G>A (p.Asp4845Asn) rs373378672
NM_001267550.2(TTN):c.14535C>T (p.Asp4845=) rs184307461
NM_001267550.2(TTN):c.14536G>A (p.Ala4846Thr) rs752150323
NM_001267550.2(TTN):c.14583T>C (p.Asp4861=) rs1317422659
NM_001267550.2(TTN):c.14624C>G (p.Ala4875Gly) rs369989679
NM_001267550.2(TTN):c.14662C>G (p.Pro4888Ala) rs376799249
NM_001267550.2(TTN):c.14697C>T (p.Ser4899=) rs372740215
NM_001267550.2(TTN):c.14698G>A (p.Ala4900Thr) rs72648923
NM_001267550.2(TTN):c.14709G>C (p.Lys4903Asn) rs1060500444
NM_001267550.2(TTN):c.14710A>T (p.Lys4904Ter) rs1560853002
NM_001267550.2(TTN):c.14713G>T (p.Val4905Phe) rs774495507
NM_001267550.2(TTN):c.14753C>T (p.Thr4918Ile) rs749179515
NM_001267550.2(TTN):c.14759C>T (p.Thr4920Met) rs371455094
NM_001267550.2(TTN):c.14765G>A (p.Ser4922Asn) rs184740744
NM_001267550.2(TTN):c.14784C>A (p.Leu4928=) rs373875040
NM_001267550.2(TTN):c.14788C>A (p.Pro4930Thr) rs201744218
NM_001267550.2(TTN):c.14788C>G (p.Pro4930Ala) rs201744218
NM_001267550.2(TTN):c.14813T>C (p.Phe4938Ser) rs560537668
NM_001267550.2(TTN):c.14869A>C (p.Thr4957Pro) rs780405420
NM_001267550.2(TTN):c.14870C>G (p.Thr4957Ser) rs72648925
NM_001267550.2(TTN):c.14873A>G (p.Tyr4958Cys) rs530572005
NM_001267550.2(TTN):c.14898T>C (p.Ala4966=) rs370105333
NM_001267550.2(TTN):c.14911T>G (p.Cys4971Gly) rs537312655
NM_001267550.2(TTN):c.1492G>A (p.Val498Ile) rs72647851
NM_001267550.2(TTN):c.14949C>T (p.Phe4983=) rs758324605
NM_001267550.2(TTN):c.14973T>C (p.Tyr4991=) rs761666344
NM_001267550.2(TTN):c.14983C>T (p.Pro4995Ser) rs776578141
NM_001267550.2(TTN):c.14984C>G (p.Pro4995Arg) rs72648927
NM_001267550.2(TTN):c.14998C>T (p.Arg5000Cys) rs369933152
NM_001267550.2(TTN):c.14999G>A (p.Arg5000His) rs377062348
NM_001267550.2(TTN):c.15007T>A (p.Cys5003Ser) rs1553930348
NM_001267550.2(TTN):c.15040A>T (p.Thr5014Ser) rs143093473
NM_001267550.2(TTN):c.15125C>T (p.Thr5042Met) rs1060500462
NM_001267550.2(TTN):c.15177C>A (p.Asp5059Glu) rs74607159
NM_001267550.2(TTN):c.15178G>A (p.Val5060Ile) rs72648929
NM_001267550.2(TTN):c.15178G>C (p.Val5060Leu) rs72648929
NM_001267550.2(TTN):c.15179_15180insA (p.Gly5061fs) rs1385955660
NM_001267550.2(TTN):c.15180C>T (p.Val5060=) rs376217206
NM_001267550.2(TTN):c.15181G>T (p.Gly5061Cys) rs1441268700
NM_001267550.2(TTN):c.15196A>G (p.Ser5066Gly) rs756793304
NM_001267550.2(TTN):c.15218-2A>G
NM_001267550.2(TTN):c.1521C>T (p.His507=) rs372875660
NM_001267550.2(TTN):c.15224C>T (p.Pro5075Leu) rs1553929816
NM_001267550.2(TTN):c.15263G>A (p.Arg5088Lys) rs766300782
NM_001267550.2(TTN):c.15277C>G (p.Leu5093Val) rs764663290
NM_001267550.2(TTN):c.15333C>T (p.Asp5111=) rs368695667
NM_001267550.2(TTN):c.15354T>C (p.Ser5118=) rs964395276
NM_001267550.2(TTN):c.15464A>C (p.Lys5155Thr) rs727504207
NM_001267550.2(TTN):c.15475A>G (p.Met5159Val) rs1553929310
NM_001267550.2(TTN):c.15496+1G>T rs397517481
NM_001267550.2(TTN):c.15496+7G>T rs746995346
NM_001267550.2(TTN):c.15497-2A>G rs1232334931
NM_001267550.2(TTN):c.15500C>T (p.Pro5167Leu) rs730880237
NM_001267550.2(TTN):c.15542G>C (p.Gly5181Ala) rs201185434
NM_001267550.2(TTN):c.15552C>T (p.Thr5184=) rs146353237
NM_001267550.2(TTN):c.15563A>C (p.Gln5188Pro) rs72648930
NM_001267550.2(TTN):c.15576del (p.Ser5194fs)
NM_001267550.2(TTN):c.15584A>G (p.Glu5195Gly) rs72648931
NM_001267550.2(TTN):c.15600A>G (p.Thr5200=) rs369464051
NM_001267550.2(TTN):c.15605T>C (p.Met5202Thr) rs764755768
NM_001267550.2(TTN):c.156C>G (p.Pro52=) rs72647842
NM_001267550.2(TTN):c.156C>T (p.Pro52=) rs72647842
NM_001267550.2(TTN):c.15717G>A (p.Thr5239=) rs72648932
NM_001267550.2(TTN):c.15749C>T (p.Thr5250Ile) rs759384825
NM_001267550.2(TTN):c.15796C>T (p.Arg5266Ter) rs372277017
NM_001267550.2(TTN):c.157G>A (p.Gly53Ser) rs150902810
NM_001267550.2(TTN):c.15822A>T (p.Ala5274=) rs779456916
NM_001267550.2(TTN):c.15831C>T (p.Pro5277=) rs780784090
NM_001267550.2(TTN):c.15850G>A (p.Val5284Met) rs66839174
NM_001267550.2(TTN):c.1585G>A (p.Ala529Thr) rs143030869
NM_001267550.2(TTN):c.15860C>T (p.Thr5287Met) rs148551876
NM_001267550.2(TTN):c.15906C>T (p.Val5302=) rs375179152
NM_001267550.2(TTN):c.15922C>T (p.Arg5308Ter) rs886042995
NM_001267550.2(TTN):c.15940A>G (p.Asn5314Asp) rs371044267
NM_001267550.2(TTN):c.15947C>T (p.Ala5316Val) rs879242937
NM_001267550.2(TTN):c.15952del (p.Leu5318fs) rs778392667
NM_001267550.2(TTN):c.15972G>A (p.Glu5324=) rs1057522988
NM_001267550.2(TTN):c.15986G>A (p.Gly5329Asp) rs202234492
NM_001267550.2(TTN):c.16010A>G (p.Asn5337Ser) rs752924679
NM_001267550.2(TTN):c.16023C>A (p.Ser5341Arg) rs1553927522
NM_001267550.2(TTN):c.16028C>T (p.Ser5343Phe) rs369132752
NM_001267550.2(TTN):c.16055-9A>C rs368897883
NM_001267550.2(TTN):c.16056T>C (p.Asp5352=) rs376820575
NM_001267550.2(TTN):c.16057C>A (p.Arg5353=) rs267599069
NM_001267550.2(TTN):c.16058G>A (p.Arg5353Gln) rs751653047
NM_001267550.2(TTN):c.16090C>T (p.Arg5364Cys) rs886044310
NM_001267550.2(TTN):c.16093A>C (p.Asn5365His) rs878854288
NM_001267550.2(TTN):c.16095C>T (p.Asn5365=) rs72648935
NM_001267550.2(TTN):c.16096G>A (p.Val5366Met) rs372176136
NM_001267550.2(TTN):c.16113T>C (p.Asn5371=) rs143845692
NM_001267550.2(TTN):c.16118C>A (p.Thr5373Asn) rs1057103177
NM_001267550.2(TTN):c.16126C>A (p.Leu5376Met) rs72648936
NM_001267550.2(TTN):c.16133G>A (p.Cys5378Tyr) rs754271006
NM_001267550.2(TTN):c.16136A>C (p.Lys5379Thr) rs752346935
NM_001267550.2(TTN):c.16138A>G (p.Ile5380Val) rs1280725528
NM_001267550.2(TTN):c.16156A>G (p.Met5386Val) rs567457007
NM_001267550.2(TTN):c.16160G>C (p.Arg5387Thr) rs748155563
NM_001267550.2(TTN):c.1616T>A (p.Ile539Asn) rs774503024
NM_001267550.2(TTN):c.16275G>A (p.Gly5425=) rs772821743
NM_001267550.2(TTN):c.16288C>T (p.Arg5430Ter) rs772235481
NM_001267550.2(TTN):c.16303G>A (p.Val5435Met) rs72648937
NM_001267550.2(TTN):c.16310G>A (p.Ser5437Asn) rs794727755
NM_001267550.2(TTN):c.16313A>G (p.Lys5438Arg) rs190636272
NM_001267550.2(TTN):c.16351A>G (p.Ser5451Gly) rs760722200
NM_001267550.2(TTN):c.16369G>A (p.Gly5457Ser) rs774425875
NM_001267550.2(TTN):c.1640A>G (p.Gln547Arg) rs774937703
NM_001267550.2(TTN):c.16422A>G (p.Gln5474=) rs371026448
NM_001267550.2(TTN):c.16446A>G (p.Arg5482=) rs1426268579
NM_001267550.2(TTN):c.16489T>A (p.Tyr5497Asn) rs1279249843
NM_001267550.2(TTN):c.16515T>C (p.Ser5505=) rs201625116
NM_001267550.2(TTN):c.16529A>G (p.Tyr5510Cys) rs72648939
NM_001267550.2(TTN):c.16546G>T (p.Asp5516Tyr) rs72648940
NM_001267550.2(TTN):c.16550C>T (p.Ser5517Leu) rs769165258
NM_001267550.2(TTN):c.16557G>A (p.Thr5519=) rs753480595
NM_001267550.2(TTN):c.16621+10G>A rs539530049
NM_001267550.2(TTN):c.16621+1G>T
NM_001267550.2(TTN):c.16621+7A>T rs10200398
NM_001267550.2(TTN):c.16693T>C (p.Cys5565Arg) rs1228967454
NM_001267550.2(TTN):c.16709C>T (p.Thr5570Ile) rs535319438
NM_001267550.2(TTN):c.16716A>G (p.Pro5572=) rs367821526
NM_001267550.2(TTN):c.16750A>G (p.Ile5584Val) rs368116422
NM_001267550.2(TTN):c.16752T>A (p.Ile5584=) rs758374634
NM_001267550.2(TTN):c.16825G>A (p.Glu5609Lys) rs374682077
NM_001267550.2(TTN):c.16834G>A (p.Gly5612Ser) rs1060500588
NM_001267550.2(TTN):c.16863G>A (p.Glu5621=) rs727504441
NM_001267550.2(TTN):c.16868G>T (p.Gly5623Val) rs768364912
NM_001267550.2(TTN):c.16903+2T>C rs1060500574
NM_001267550.2(TTN):c.16907C>T (p.Ser5636Leu) rs1553925181
NM_001267550.2(TTN):c.16934C>T (p.Pro5645Leu) rs370889765
NM_001267550.2(TTN):c.16961T>G (p.Val5654Gly) rs763581306
NM_001267550.2(TTN):c.16975G>A (p.Glu5659Lys) rs763708860
NM_001267550.2(TTN):c.16989T>C (p.Thr5663=) rs879099217
NM_001267550.2(TTN):c.17047T>G (p.Tyr5683Asp) rs371062603
NM_001267550.2(TTN):c.17048A>G (p.Tyr5683Cys) rs72648942
NM_001267550.2(TTN):c.17079C>T (p.Ser5693=) rs372588069
NM_001267550.2(TTN):c.17082G>T (p.Leu5694=) rs750996600
NM_001267550.2(TTN):c.1709C>T (p.Ala570Val) rs146690035
NM_001267550.2(TTN):c.17115C>T (p.Gly5705=) rs370036981
NM_001267550.2(TTN):c.17116G>A (p.Glu5706Lys) rs376593556
NM_001267550.2(TTN):c.17129G>A (p.Arg5710Gln) rs200018866
NM_001267550.2(TTN):c.17160C>T (p.Cys5720=) rs972381308
NM_001267550.2(TTN):c.17189C>T (p.Pro5730Leu) rs779187099
NM_001267550.2(TTN):c.17201_17203AGA[1] (p.Lys5735del) rs1060500441
NM_001267550.2(TTN):c.17213G>A (p.Ser5738Asn) rs1060500502
NM_001267550.2(TTN):c.17216C>T (p.Thr5739Ile) rs751087281
NM_001267550.2(TTN):c.17217C>T (p.Thr5739=) rs1553924564
NM_001267550.2(TTN):c.17224C>T (p.Leu5742Phe) rs72648943
NM_001267550.2(TTN):c.17227C>T (p.Arg5743Trp) rs377193479
NM_001267550.2(TTN):c.17228G>A (p.Arg5743Gln) rs753892271
NM_001267550.2(TTN):c.17259G>A (p.Leu5753=) rs1060503934
NM_001267550.2(TTN):c.17279C>T (p.Thr5760Met) rs770310501
NM_001267550.2(TTN):c.17300G>A (p.Ser5767Asn) rs200692495
NM_001267550.2(TTN):c.17301C>T (p.Ser5767=) rs777677229
NM_001267550.2(TTN):c.17302G>A (p.Asp5768Asn) rs576904726
NM_001267550.2(TTN):c.17312C>G (p.Thr5771Ser) rs16866477
NM_001267550.2(TTN):c.17319C>T (p.Asp5773=) rs760724229
NM_001267550.2(TTN):c.17320G>A (p.Asp5774Asn) rs752660722
NM_001267550.2(TTN):c.17328A>G (p.Ile5776Met) rs928844023
NM_001267550.2(TTN):c.17331A>T (p.Arg5777Ser) rs367942154
NM_001267550.2(TTN):c.17357G>T (p.Ser5786Ile) rs1553924253
NM_001267550.2(TTN):c.17375T>C (p.Ile5792Thr) rs1225094303
NM_001267550.2(TTN):c.17423C>T (p.Ala5808Val) rs1409068952
NM_001267550.2(TTN):c.1742C>T (p.Pro581Leu) rs199778910
NM_001267550.2(TTN):c.17442T>C (p.Ser5814=) rs770532942
NM_001267550.2(TTN):c.17543G>A (p.Gly5848Glu) rs185962498
NM_001267550.2(TTN):c.17556T>C (p.Ile5852=) rs370776424
NM_001267550.2(TTN):c.17565A>G (p.Lys5855=) rs745763221
NM_001267550.2(TTN):c.17596G>T (p.Gly5866Cys) rs753136638
NM_001267550.2(TTN):c.17645T>C (p.Ile5882Thr) rs763665430
NM_001267550.2(TTN):c.17669G>C (p.Ser5890Thr) rs775293848
NM_001267550.2(TTN):c.17686G>A (p.Glu5896Lys) rs561557554
NM_001267550.2(TTN):c.1771C>G (p.Gln591Glu) rs747286444
NM_001267550.2(TTN):c.1776T>C (p.Asp592=) rs147081804
NM_001267550.2(TTN):c.17773C>A (p.Leu5925Met) rs750909367
NM_001267550.2(TTN):c.17787C>T (p.Asp5929=) rs1227964604
NM_001267550.2(TTN):c.177C>T (p.Ser59=) rs191057824
NM_001267550.2(TTN):c.17806A>G (p.Ile5936Val) rs72648945
NM_001267550.2(TTN):c.17818T>C (p.Cys5940Arg) rs374882815
NM_001267550.2(TTN):c.17869C>G (p.Gln5957Glu) rs201672969
NM_001267550.2(TTN):c.17871A>T (p.Gln5957His) rs181067357
NM_001267550.2(TTN):c.17875A>G (p.Ile5959Val) rs1060500508
NM_001267550.2(TTN):c.17888A>G (p.Glu5963Gly) rs146983095
NM_001267550.2(TTN):c.17893T>C (p.Tyr5965His) rs752226947
NM_001267550.2(TTN):c.178G>T (p.Asp60Tyr) rs35683768
NM_001267550.2(TTN):c.17928G>A (p.Leu5976=) rs373963067
NM_001267550.2(TTN):c.17989G>A (p.Ala5997Thr) rs72648946
NM_001267550.2(TTN):c.17992G>A (p.Gly5998Arg) rs757934638
NM_001267550.2(TTN):c.18028+1G>A rs1560786548
NM_001267550.2(TTN):c.18037T>C (p.Tyr6013His) rs548015673
NM_001267550.2(TTN):c.18075C>T (p.Pro6025=) rs557350005
NM_001267550.2(TTN):c.18084G>A (p.Arg6028=) rs775372762
NM_001267550.2(TTN):c.18098C>T (p.Ala6033Val) rs771457862
NM_001267550.2(TTN):c.180T>C (p.Asp60=) rs144750850
NM_001267550.2(TTN):c.18114T>C (p.Thr6038=) rs1221916366
NM_001267550.2(TTN):c.18172C>T (p.Arg6058Cys) rs189127014
NM_001267550.2(TTN):c.18173G>A (p.Arg6058His) rs376012117
NM_001267550.2(TTN):c.18231C>T (p.Thr6077=) rs377639910
NM_001267550.2(TTN):c.18317A>G (p.Gln6106Arg) rs1553921829
NM_001267550.2(TTN):c.18325A>G (p.Lys6109Glu) rs73973139
NM_001267550.2(TTN):c.18371C>A (p.Thr6124Lys) rs1280788914
NM_001267550.2(TTN):c.18374T>C (p.Phe6125Ser) rs375003845
NM_001267550.2(TTN):c.18379T>G (p.Cys6127Gly) rs370812788
NM_001267550.2(TTN):c.18390A>T (p.Thr6130=) rs66523653
NM_001267550.2(TTN):c.18407G>A (p.Arg6136Gln) rs117551279
NM_001267550.2(TTN):c.18445A>G (p.Ile6149Val) rs368897297
NM_001267550.2(TTN):c.18485C>T (p.Thr6162Ile) rs367685188
NM_001267550.2(TTN):c.18510A>G (p.Val6170=) rs761425332
NM_001267550.2(TTN):c.18528T>C (p.Tyr6176=) rs375408819
NM_001267550.2(TTN):c.18531G>C (p.Val6177=) rs370684491
NM_001267550.2(TTN):c.18549C>T (p.Asp6183=) rs200549353
NM_001267550.2(TTN):c.18550G>A (p.Ala6184Thr) rs72648947
NM_001267550.2(TTN):c.18560C>T (p.Ala6187Val) rs758380777
NM_001267550.2(TTN):c.18561G>A (p.Ala6187=) rs377556808
NM_001267550.2(TTN):c.18589+4C>T rs1449021840
NM_001267550.2(TTN):c.185G>A (p.Arg62His) rs758169489
NM_001267550.2(TTN):c.18609A>G (p.Arg6203=) rs777227340
NM_001267550.2(TTN):c.18655G>A (p.Glu6219Lys) rs72648948
NM_001267550.2(TTN):c.18657G>A (p.Glu6219=) rs1282711943
NM_001267550.2(TTN):c.18659G>C (p.Cys6220Ser) rs191692293
NM_001267550.2(TTN):c.18663A>C (p.Glu6221Asp) rs369544339
NM_001267550.2(TTN):c.18677C>A (p.Pro6226His) rs746345160
NM_001267550.2(TTN):c.18684T>C (p.Phe6228=) rs368427156
NM_001267550.2(TTN):c.1869A>G (p.Gln623=) rs750034931
NM_001267550.2(TTN):c.186C>T (p.Arg62=) rs528853682
NM_001267550.2(TTN):c.18709A>T (p.Arg6237Trp) rs750368911
NM_001267550.2(TTN):c.18720A>G (p.Arg6240=) rs201395913
NM_001267550.2(TTN):c.18736A>G (p.Thr6246Ala) rs1553920950
NM_001267550.2(TTN):c.18745G>A (p.Asp6249Asn) rs201263441
NM_001267550.2(TTN):c.18776C>G (p.Thr6259Ser) rs72648949
NM_001267550.2(TTN):c.18782G>A (p.Cys6261Tyr) rs1060500581
NM_001267550.2(TTN):c.187G>A (p.Ala63Thr) rs764892312
NM_001267550.2(TTN):c.18807C>T (p.Tyr6269=) rs189167196
NM_001267550.2(TTN):c.18816T>C (p.Ile6272=) rs146219199
NM_001267550.2(TTN):c.18824A>G (p.Asn6275Ser) rs184412722
NM_001267550.2(TTN):c.18856G>A (p.Val6286Ile) rs149131555
NM_001267550.2(TTN):c.18887A>G (p.Lys6296Arg) rs1553920476
NM_001267550.2(TTN):c.18903C>T (p.Thr6301=) rs72648950
NM_001267550.2(TTN):c.18950G>T (p.Gly6317Val) rs1060500522
NM_001267550.2(TTN):c.18959C>A (p.Pro6320His) rs886246785
NM_001267550.2(TTN):c.1895G>A (p.Gly632Asp) rs150231219
NM_001267550.2(TTN):c.18961A>G (p.Ile6321Val) rs145204073
NM_001267550.2(TTN):c.18972C>T (p.Thr6324=) rs769659495
NM_001267550.2(TTN):c.18978A>G (p.Leu6326=) rs1315197288
NM_001267550.2(TTN):c.19004A>G (p.Asp6335Gly) rs72648951
NM_001267550.2(TTN):c.19016A>G (p.Tyr6339Cys) rs192553687
NM_001267550.2(TTN):c.19036G>A (p.Val6346Met) rs537966944
NM_001267550.2(TTN):c.19063G>T (p.Asp6355Tyr) rs188878341
NM_001267550.2(TTN):c.19118A>G (p.Glu6373Gly) rs367868361
NM_001267550.2(TTN):c.19150C>A (p.Pro6384Thr) rs72648953
NM_001267550.2(TTN):c.19180del (p.Val6394fs) rs1560763939
NM_001267550.2(TTN):c.19191G>A (p.Thr6397=) rs140495148
NM_001267550.2(TTN):c.19204A>G (p.Met6402Val) rs72648954
NM_001267550.2(TTN):c.1925T>C (p.Ile642Thr) rs772036467
NM_001267550.2(TTN):c.19263C>T (p.Asp6421=) rs552531581
NM_001267550.2(TTN):c.19317G>C (p.Val6439=) rs878854289
NM_001267550.2(TTN):c.19347G>A (p.Lys6449=) rs1553919623
NM_001267550.2(TTN):c.19368T>C (p.Thr6456=) rs1553919591
NM_001267550.2(TTN):c.19383T>C (p.Asn6461=) rs76771282
NM_001267550.2(TTN):c.19389C>T (p.Phe6463=) rs267599062
NM_001267550.2(TTN):c.1943G>C (p.Arg648Thr) rs550441902
NM_001267550.2(TTN):c.19447T>C (p.Phe6483Leu) rs373750655
NM_001267550.2(TTN):c.19485C>A (p.Gly6495=) rs780158564
NM_001267550.2(TTN):c.19496A>T (p.His6499Leu) rs375173049
NM_001267550.2(TTN):c.19547A>T (p.Lys6516Met) rs199796249
NM_001267550.2(TTN):c.1964C>A (p.Ala655Asp) rs763912778
NM_001267550.2(TTN):c.19697G>C (p.Gly6566Ala) rs1052515116
NM_001267550.2(TTN):c.19714+1G>T rs1060500423
NM_001267550.2(TTN):c.19715-4A>G rs375009631
NM_001267550.2(TTN):c.19728C>T (p.Phe6576=) rs751902051
NM_001267550.2(TTN):c.19738C>T (p.Pro6580Ser) rs116572520
NM_001267550.2(TTN):c.19744C>T (p.Arg6582Ter) rs794727829
NM_001267550.2(TTN):c.19770A>G (p.Thr6590=) rs775289296
NM_001267550.2(TTN):c.19786A>G (p.Ile6596Val) rs369108292
NM_001267550.2(TTN):c.19818A>G (p.Lys6606=) rs397517492
NM_001267550.2(TTN):c.19848A>G (p.Ser6616=) rs1345701707
NM_001267550.2(TTN):c.19855A>G (p.Lys6619Glu) rs1060500450
NM_001267550.2(TTN):c.19877G>A (p.Gly6626Glu) rs1362220931
NM_001267550.2(TTN):c.19922C>A (p.Thr6641Asn) rs747240394
NM_001267550.2(TTN):c.19931A>G (p.Tyr6644Cys) rs375417679
NM_001267550.2(TTN):c.19933A>G (p.Thr6645Ala) rs370671112
NM_001267550.2(TTN):c.19949A>G (p.Asn6650Ser) rs751222632
NM_001267550.2(TTN):c.19963G>A (p.Asp6655Asn) rs397517493
NM_001267550.2(TTN):c.19964A>G (p.Asp6655Gly) rs772947420
NM_001267550.2(TTN):c.19970G>T (p.Cys6657Phe) rs776748717
NM_001267550.2(TTN):c.19976C>T (p.Thr6659Met) rs16866475
NM_001267550.2(TTN):c.19977G>T (p.Thr6659=) rs1060503954
NM_001267550.2(TTN):c.19983G>A (p.Leu6661=) rs1383144902
NM_001267550.2(TTN):c.19992A>G (p.Thr6664=) rs1560749476
NM_001267550.2(TTN):c.19994-7T>G rs1292778822
NM_001267550.2(TTN):c.19996C>T (p.Pro6666Ser) rs571231816
NM_001267550.2(TTN):c.20025C>A (p.Ala6675=) rs373842558
NM_001267550.2(TTN):c.20035G>A (p.Val6679Met) rs1553917765
NM_001267550.2(TTN):c.20041G>A (p.Ala6681Thr) rs779405672
NM_001267550.2(TTN):c.20057G>A (p.Arg6686Gln) rs202022304
NM_001267550.2(TTN):c.20085A>C (p.Pro6695=) rs1287032649
NM_001267550.2(TTN):c.20096T>A (p.Val6699Asp) rs907862282
NM_001267550.2(TTN):c.20096T>C (p.Val6699Ala) rs907862282
NM_001267550.2(TTN):c.20147T>A (p.Met6716Lys) rs28626194
NM_001267550.2(TTN):c.20156T>C (p.Ile6719Thr) rs770377168
NM_001267550.2(TTN):c.20175A>G (p.Ile6725Met) rs146627500
NM_001267550.2(TTN):c.20185A>G (p.Asn6729Asp) rs794729619
NM_001267550.2(TTN):c.2022A>C (p.Arg674Ser) rs180694107
NM_001267550.2(TTN):c.20236G>A (p.Ala6746Thr) rs202108224
NM_001267550.2(TTN):c.20276-5delT rs779654489
NM_001267550.2(TTN):c.20324del (p.Asn6775fs)
NM_001267550.2(TTN):c.2032A>G (p.Thr678Ala) rs878854290
NM_001267550.2(TTN):c.20335A>T (p.Ser6779Cys) rs149470241
NM_001267550.2(TTN):c.20341G>A (p.Glu6781Lys) rs72648958
NM_001267550.2(TTN):c.20354C>T (p.Ser6785Leu) rs201586695
NM_001267550.2(TTN):c.20355G>A (p.Ser6785=) rs549470227
NM_001267550.2(TTN):c.20367G>T (p.Pro6789=) rs368422028
NM_001267550.2(TTN):c.20396G>A (p.Arg6799Gln) rs780069933
NM_001267550.2(TTN):c.20455C>T (p.His6819Tyr) rs1553916130
NM_001267550.2(TTN):c.20465A>G (p.Asn6822Ser) rs371518764
NM_001267550.2(TTN):c.20472C>T (p.Asp6824=) rs1418781337
NM_001267550.2(TTN):c.20474C>T (p.Thr6825Ile) rs763006525
NM_001267550.2(TTN):c.20484C>G (p.Ile6828Met) rs563320328
NM_001267550.2(TTN):c.20554+10G>C rs1553915945
NM_001267550.2(TTN):c.20554+9A>C rs1060503960
NM_001267550.2(TTN):c.20579T>C (p.Leu6860Pro) rs767944090
NM_001267550.2(TTN):c.205G>A (p.Ala69Thr) rs1370693255
NM_001267550.2(TTN):c.20602G>A (p.Gly6868Arg) rs17355460
NM_001267550.2(TTN):c.20605G>A (p.Glu6869Lys) rs746830456
NM_001267550.2(TTN):c.2061A>G (p.Gln687=) rs188680791
NM_001267550.2(TTN):c.20626T>A (p.Ser6876Thr) rs1359024577
NM_001267550.2(TTN):c.20630T>C (p.Ile6877Thr) rs142794598
NM_001267550.2(TTN):c.20692A>G (p.Ser6898Gly) rs878854291
NM_001267550.2(TTN):c.20696A>G (p.Glu6899Gly) rs777803266
NM_001267550.2(TTN):c.20707A>G (p.Ile6903Val) rs571675433
NM_001267550.2(TTN):c.2073A>T (p.Gly691=) rs72647860
NM_001267550.2(TTN):c.20743G>T (p.Ala6915Ser) rs201728165
NM_001267550.2(TTN):c.20772G>A (p.Lys6924=) rs369993514
NM_001267550.2(TTN):c.20792A>G (p.Asn6931Ser) rs200866883
NM_001267550.2(TTN):c.20798G>C (p.Gly6933Ala) rs200118743
NM_001267550.2(TTN):c.207C>T (p.Ala69=) rs150548328
NM_001267550.2(TTN):c.20808G>A (p.Arg6936=) rs773342572
NM_001267550.2(TTN):c.20837-1G>A rs1553914337
NM_001267550.2(TTN):c.2083G>A (p.Val695Ile) rs747479318
NM_001267550.2(TTN):c.2083G>T (p.Val695Phe) rs747479318
NM_001267550.2(TTN):c.20868G>A (p.Pro6956=) rs367929968
NM_001267550.2(TTN):c.20869A>T (p.Met6957Leu) rs375262781
NM_001267550.2(TTN):c.20873C>T (p.Thr6958Met) rs371824963
NM_001267550.2(TTN):c.20891C>T (p.Thr6964Met) rs765257439
NM_001267550.2(TTN):c.20892G>A (p.Thr6964=) rs727504623
NM_001267550.2(TTN):c.208G>A (p.Val70Met) rs772248060
NM_001267550.2(TTN):c.21002A>G (p.Lys7001Arg) rs200594798
NM_001267550.2(TTN):c.21003A>G (p.Lys7001=) rs727504579
NM_001267550.2(TTN):c.21019A>T (p.Ile7007Phe) rs114626713
NM_001267550.2(TTN):c.21028G>A (p.Val7010Ile) rs564660466
NM_001267550.2(TTN):c.21044C>T (p.Ala7015Val) rs72648960
NM_001267550.2(TTN):c.21106G>A (p.Asp7036Asn) rs72648962
NM_001267550.2(TTN):c.21115+8C>T rs1199697682
NM_001267550.2(TTN):c.21116-4A>G rs375874660
NM_001267550.2(TTN):c.21116-4del rs1553913568
NM_001267550.2(TTN):c.21119G>A (p.Arg7040Gln) rs754476903
NM_001267550.2(TTN):c.2113G>C (p.Val705Leu) rs1320087550
NM_001267550.2(TTN):c.21143G>A (p.Arg7048Gln) rs148072021
NM_001267550.2(TTN):c.21148C>T (p.Leu7050=) rs202089818
NM_001267550.2(TTN):c.21173G>A (p.Gly7058Asp) rs72648964
NM_001267550.2(TTN):c.21246C>T (p.Thr7082=) rs1553913320
NM_001267550.2(TTN):c.21276C>T (p.Thr7092=) rs372264428
NM_001267550.2(TTN):c.21291T>A (p.Asn7097Lys) rs773211607
NM_001267550.2(TTN):c.21332T>C (p.Met7111Thr) rs374408615
NM_001267550.2(TTN):c.21364G>A (p.Ala7122Thr) rs201394117
NM_001267550.2(TTN):c.21378A>C (p.Glu7126Asp) rs786205315
NM_001267550.2(TTN):c.21403+5G>A rs1560709207
NM_001267550.2(TTN):c.21404-8C>G rs761542135
NM_001267550.2(TTN):c.21475G>A (p.Val7159Ile) rs371267140
NM_001267550.2(TTN):c.21488C>A (p.Thr7163Asn) rs370324138
NM_001267550.2(TTN):c.21489C>G (p.Thr7163=) rs376882041
NM_001267550.2(TTN):c.21497T>G (p.Phe7166Cys) rs781740874
NM_001267550.2(TTN):c.21507del (p.Trp7170fs)
NM_001267550.2(TTN):c.2151C>T (p.Pro717=) rs374570732
NM_001267550.2(TTN):c.21548G>A (p.Cys7183Tyr) rs189951108
NM_001267550.2(TTN):c.21555C>A (p.Ile7185=) rs201155967
NM_001267550.2(TTN):c.21573G>A (p.Val7191=) rs1553912562
NM_001267550.2(TTN):c.21574G>A (p.Ala7192Thr) rs1212601280
NM_001267550.2(TTN):c.21612T>G (p.Ser7204Arg) rs780624577
NM_001267550.2(TTN):c.2162G>C (p.Gly721Ala) rs1554022851
NM_001267550.2(TTN):c.21641A>G (p.Asn7214Ser) rs755600935
NM_001267550.2(TTN):c.21642C>T (p.Asn7214=) rs752620885
NM_001267550.2(TTN):c.21653C>T (p.Ala7218Val) rs763125654
NM_001267550.2(TTN):c.21656C>T (p.Ser7219Phe) rs201029552
NM_001267550.2(TTN):c.21666C>A (p.Thr7222=) rs1041546705
NM_001267550.2(TTN):c.21667C>T (p.Arg7223Cys) rs1156609638
NM_001267550.2(TTN):c.21668G>A (p.Arg7223His) rs138853909
NM_001267550.2(TTN):c.21689C>T (p.Ala7230Val) rs761223583
NM_001267550.2(TTN):c.21705A>T (p.Arg7235Ser) rs772506057
NM_001267550.2(TTN):c.21721G>A (p.Val7241Ile) rs367854582
NM_001267550.2(TTN):c.21779C>A (p.Ser7260Tyr) rs187925021
NM_001267550.2(TTN):c.21785C>G (p.Thr7262Ser) rs200954184
NM_001267550.2(TTN):c.21789G>C (p.Trp7263Cys) rs377544260
NM_001267550.2(TTN):c.21799G>A (p.Gly7267Ser) rs772450876
NM_001267550.2(TTN):c.21800G>A (p.Gly7267Asp) rs375627540
NM_001267550.2(TTN):c.21892G>A (p.Gly7298Arg) rs878854292
NM_001267550.2(TTN):c.21906C>T (p.Cys7302=) rs370548693
NM_001267550.2(TTN):c.21907G>A (p.Glu7303Lys) rs774950387
NM_001267550.2(TTN):c.21907G>C (p.Glu7303Gln) rs774950387
NM_001267550.2(TTN):c.21914A>C (p.Glu7305Ala) rs1553911785
NM_001267550.2(TTN):c.21962-6C>T rs374870814
NM_001267550.2(TTN):c.21964C>T (p.Pro7322Ser) rs1553911632
NM_001267550.2(TTN):c.21980C>T (p.Thr7327Met) rs727504975
NM_001267550.2(TTN):c.21993T>C (p.Pro7331=) rs373223049
NM_001267550.2(TTN):c.22024T>G (p.Leu7342Val) rs1243764269
NM_001267550.2(TTN):c.22039G>A (p.Ala7347Thr) rs1553911494
NM_001267550.2(TTN):c.2203T>C (p.Tyr735His) rs754432983
NM_001267550.2(TTN):c.2206G>A (p.Gly736Arg) rs876658047
NM_001267550.2(TTN):c.22074A>G (p.Lys7358=) rs34562585
NM_001267550.2(TTN):c.22077A>T (p.Gly7359=) rs202102237
NM_001267550.2(TTN):c.22090C>T (p.Arg7364Trp) rs397517500
NM_001267550.2(TTN):c.2218C>A (p.Arg740Ser) rs566299753
NM_001267550.2(TTN):c.22240+3G>A rs768904155
NM_001267550.2(TTN):c.22241-7C>G rs749798825
NM_001267550.2(TTN):c.22255C>T (p.Pro7419Ser) rs1486377872
NM_001267550.2(TTN):c.2226C>A (p.Ser742=) rs151025677
NM_001267550.2(TTN):c.2226C>T (p.Ser742=) rs151025677
NM_001267550.2(TTN):c.22273_22276del (p.Leu7425fs) rs1553910811
NM_001267550.2(TTN):c.22293_22303del (p.Val7432fs) rs1560692247
NM_001267550.2(TTN):c.2229C>T (p.Ala743=) rs746990488
NM_001267550.2(TTN):c.2230G>A (p.Ala744Thr) rs144639994
NM_001267550.2(TTN):c.2233A>G (p.Lys745Glu) rs139957325
NM_001267550.2(TTN):c.22343T>C (p.Ile7448Thr) rs878854293
NM_001267550.2(TTN):c.22383C>T (p.Asp7461=) rs376383610
NM_001267550.2(TTN):c.22384_22385delinsCG (p.Asp7462Arg) rs1060500493
NM_001267550.2(TTN):c.22420G>A (p.Ala7474Thr) rs759713604
NM_001267550.2(TTN):c.22432A>G (p.Ile7478Val) rs1191020503
NM_001267550.2(TTN):c.22439A>C (p.Gln7480Pro) rs201065037
NM_001267550.2(TTN):c.22528+4delT
NM_001267550.2(TTN):c.2254C>T (p.Arg752Cys) rs200677631
NM_001267550.2(TTN):c.22592G>A (p.Ser7531Asn) rs267599060
NM_001267550.2(TTN):c.22599T>C (p.Asp7533=) rs1553909923
NM_001267550.2(TTN):c.22611T>C (p.His7537=) rs16866469
NM_001267550.2(TTN):c.22628C>T (p.Pro7543Leu) rs560272834
NM_001267550.2(TTN):c.22633C>T (p.Arg7545Ter) rs764687326
NM_001267550.2(TTN):c.22634G>A (p.Arg7545Gln) rs72648969
NM_001267550.2(TTN):c.22653T>C (p.Asp7551=) rs371736246
NM_001267550.2(TTN):c.22687A>T (p.Ile7563Phe) rs1321824189
NM_001267550.2(TTN):c.22689C>G (p.Ile7563Met) rs1060500529
NM_001267550.2(TTN):c.22692A>T (p.Thr7564=) rs187182557
NM_001267550.2(TTN):c.22693T>C (p.Cys7565Arg) rs757611239
NM_001267550.2(TTN):c.2270C>T (p.Pro757Leu) rs116307796
NM_001267550.2(TTN):c.22734C>A (p.Gly7578=) rs747844754
NM_001267550.2(TTN):c.2274C>T (p.His758=) rs772664968
NM_001267550.2(TTN):c.22786G>C (p.Asp7596His) rs72648970
NM_001267550.2(TTN):c.2280C>T (p.Val760=) rs727505021
NM_001267550.2(TTN):c.22888T>C (p.Cys7630Arg) rs1553908536
NM_001267550.2(TTN):c.22931G>A (p.Arg7644Gln) rs766675017
NM_001267550.2(TTN):c.22941C>T (p.Ser7647=) rs544355195
NM_001267550.2(TTN):c.22942G>A (p.Glu7648Lys) rs397517502
NM_001267550.2(TTN):c.22952A>G (p.Glu7651Gly) rs1461872954
NM_001267550.2(TTN):c.22968C>T (p.Asn7656=) rs201904848
NM_001267550.2(TTN):c.23000C>G (p.Thr7667Arg) rs374430623
NM_001267550.2(TTN):c.23001G>A (p.Thr7667=) rs16866467
NM_001267550.2(TTN):c.23005A>G (p.Asn7669Asp) rs1060500486
NM_001267550.2(TTN):c.2301A>G (p.Arg767=) rs746831560
NM_001267550.2(TTN):c.23023G>T (p.Asp7675Tyr) rs552951988
NM_001267550.2(TTN):c.23029G>A (p.Gly7677Arg) rs367826445
NM_001267550.2(TTN):c.23052T>C (p.His7684=) rs1553908123
NM_001267550.2(TTN):c.23065G>A (p.Asp7689Asn) rs727505052
NM_001267550.2(TTN):c.23068G>T (p.Ala7690Ser) rs763029699
NM_001267550.2(TTN):c.23100A>T (p.Ala7700=) rs775508685
NM_001267550.2(TTN):c.2310G>T (p.Gln770His) rs541547610
NM_001267550.2(TTN):c.23121G>A (p.Lys7707=) rs72648971
NM_001267550.2(TTN):c.23177C>T (p.Ser7726Leu) rs17452588
NM_001267550.2(TTN):c.2320G>A (p.Glu774Lys) rs1554022511
NM_001267550.2(TTN):c.23215C>A (p.Arg7739=) rs372250586
NM_001267550.2(TTN):c.23232C>G (p.Asn7744Lys) rs72648972
NM_001267550.2(TTN):c.23250C>T (p.Ile7750=) rs1060503967
NM_001267550.2(TTN):c.23286T>A (p.Leu7762=) rs1553907203
NM_001267550.2(TTN):c.23301C>T (p.Ser7767=) rs73038337
NM_001267550.2(TTN):c.23302G>A (p.Asp7768Asn) rs72648973
NM_001267550.2(TTN):c.23305G>A (p.Val7769Ile) rs1553907172
NM_001267550.2(TTN):c.2331C>G (p.Ile777Met) rs1157627413
NM_001267550.2(TTN):c.23353T>C (p.Cys7785Arg) rs371090975
NM_001267550.2(TTN):c.23373C>A (p.Phe7791Leu) rs1553907020
NM_001267550.2(TTN):c.23386C>T (p.Arg7796Ter) rs748111134
NM_001267550.2(TTN):c.2341G>T (p.Asp781Tyr) rs1554022470
NM_001267550.2(TTN):c.23443C>T (p.Arg7815Trp) rs528264100
NM_001267550.2(TTN):c.23467C>A (p.Pro7823Thr) rs768540966
NM_001267550.2(TTN):c.23538C>G (p.Phe7846Leu) rs149523263
NM_001267550.2(TTN):c.2354T>C (p.Met785Thr) rs1060500532
NM_001267550.2(TTN):c.23567G>A (p.Gly7856Glu) rs919783694
NM_001267550.2(TTN):c.23578G>A (p.Ala7860Thr) rs138076523
NM_001267550.2(TTN):c.2358C>G (p.His786Gln) rs199507913
NM_001267550.2(TTN):c.2360T>C (p.Ile787Thr) rs143444636
NM_001267550.2(TTN):c.23616C>T (p.Asn7872=) rs181206334
NM_001267550.2(TTN):c.23694G>A (p.Met7898Ile) rs751897366
NM_001267550.2(TTN):c.23725G>C (p.Glu7909Gln) rs1161435142
NM_001267550.2(TTN):c.23729G>T (p.Cys7910Phe) rs763596594
NM_001267550.2(TTN):c.23770A>C (p.Lys7924Gln) rs770650362
NM_001267550.2(TTN):c.23797A>G (p.Ser7933Gly) rs1553905723
NM_001267550.2(TTN):c.23817C>G (p.Phe7939Leu) rs866647945
NM_001267550.2(TTN):c.23853C>A (p.Ala7951=) rs201766927
NM_001267550.2(TTN):c.2386G>A (p.Asp796Asn) rs766935265
NM_001267550.2(TTN):c.23895C>A (p.Asn7965Lys) rs1363515138
NM_001267550.2(TTN):c.23901T>G (p.Val7967=) rs550995785
NM_001267550.2(TTN):c.2391A>G (p.Leu797=) rs147124267
NM_001267550.2(TTN):c.23925C>T (p.Ser7975=) rs374879942
NM_001267550.2(TTN):c.23926G>A (p.Val7976Ile) rs200395305
NM_001267550.2(TTN):c.2393_2394del (p.Thr798fs) rs1060500528
NM_001267550.2(TTN):c.23947G>A (p.Val7983Met) rs1060500564
NM_001267550.2(TTN):c.23965C>T (p.Arg7989Cys) rs201653851
NM_001267550.2(TTN):c.2396C>T (p.Thr799Met) rs149061352
NM_001267550.2(TTN):c.23970G>A (p.Lys7990=) rs1553905164
NM_001267550.2(TTN):c.2397G>A (p.Thr799=) rs369313128
NM_001267550.2(TTN):c.23996G>C (p.Gly7999Ala) rs750389762
NM_001267550.2(TTN):c.23997G>A (p.Gly7999=) rs1261213256
NM_001267550.2(TTN):c.24013G>C (p.Glu8005Gln) rs757042397
NM_001267550.2(TTN):c.24020G>A (p.Arg8007Gln) rs765789516
NM_001267550.2(TTN):c.24037C>A (p.Pro8013Thr) rs1553904936
NM_001267550.2(TTN):c.24038C>T (p.Pro8013Leu) rs773761640
NM_001267550.2(TTN):c.24045A>T (p.Ser8015=) rs1060503946
NM_001267550.2(TTN):c.24075T>G (p.Ile8025Met) rs371496970
NM_001267550.2(TTN):c.24114C>T (p.Asn8038=) rs199576800
NM_001267550.2(TTN):c.24115G>A (p.Val8039Ile) rs759655046
NM_001267550.2(TTN):c.24137T>C (p.Leu8046Ser) rs1553904761
NM_001267550.2(TTN):c.24150C>T (p.Ser8050=) rs185062935
NM_001267550.2(TTN):c.24156A>G (p.Thr8052=) rs749823104
NM_001267550.2(TTN):c.24160A>T (p.Ile8054Leu) rs72648976
NM_001267550.2(TTN):c.24168G>A (p.Thr8056=) rs563766812
NM_001267550.2(TTN):c.24171T>C (p.Cys8057=) rs777482646
NM_001267550.2(TTN):c.24174G>T (p.Val8058=) rs1553904651
NM_001267550.2(TTN):c.24195C>T (p.Ser8065=) rs182425565
NM_001267550.2(TTN):c.24207A>G (p.Ser8069=) rs370099448
NM_001267550.2(TTN):c.24253G>A (p.Asp8085Asn) rs1553904192
NM_001267550.2(TTN):c.24344G>A (p.Ser8115Asn) rs397517506
NM_001267550.2(TTN):c.24345C>T (p.Ser8115=) rs72648977
NM_001267550.2(TTN):c.24358C>T (p.Pro8120Ser) rs745913661
NM_001267550.2(TTN):c.2435C>T (p.Ala812Val) rs372040052
NM_001267550.2(TTN):c.24453C>T (p.Leu8151=) rs772386098
NM_001267550.2(TTN):c.24469G>A (p.Gly8157Ser) rs753025964
NM_001267550.2(TTN):c.24471C>T (p.Gly8157=) rs113391261
NM_001267550.2(TTN):c.24482G>A (p.Cys8161Tyr) rs372143487
NM_001267550.2(TTN):c.24493C>A (p.Leu8165Ile) rs1060500582
NM_001267550.2(TTN):c.24506-8C>G rs748675191
NM_001267550.2(TTN):c.24520G>A (p.Val8174Met) rs727504961
NM_001267550.2(TTN):c.24546T>A (p.Val8182=) rs397517508
NM_001267550.2(TTN):c.24563T>C (p.Ile8188Thr) rs1184649078
NM_001267550.2(TTN):c.24579A>G (p.Thr8193=) rs72648979
NM_001267550.2(TTN):c.24588C>A (p.Gly8196=) rs1057523933
NM_001267550.2(TTN):c.24622G>A (p.Glu8208Lys) rs190192954
NM_001267550.2(TTN):c.24639A>C (p.Gln8213His) rs397517510
NM_001267550.2(TTN):c.24652A>G (p.Ser8218Gly) rs72648980
NM_001267550.2(TTN):c.24701C>T (p.Thr8234Ile) rs369521909
NM_001267550.2(TTN):c.24706G>A (p.Glu8236Lys) rs377762626
NM_001267550.2(TTN):c.24708_24710del (p.Glu8236del) rs771555243
NM_001267550.2(TTN):c.24729C>T (p.Cys8243=) rs751527077
NM_001267550.2(TTN):c.24756T>G (p.Asp8252Glu) rs764248656
NM_001267550.2(TTN):c.24769C>G (p.Leu8257Val) rs371322658
NM_001267550.2(TTN):c.24795C>T (p.Tyr8265=) rs776344275
NM_001267550.2(TTN):c.24820G>A (p.Glu8274Lys) rs72648981
NM_001267550.2(TTN):c.24833G>C (p.Gly8278Ala) rs778611558
NM_001267550.2(TTN):c.24865G>T (p.Gly8289Ter)
NM_001267550.2(TTN):c.24879T>C (p.Ile8293=) rs1221548315
NM_001267550.2(TTN):c.24880A>G (p.Arg8294Gly) rs72648982
NM_001267550.2(TTN):c.24888T>C (p.Ser8296=) rs535603112
NM_001267550.2(TTN):c.24891G>T (p.Trp8297Cys) rs727504205
NM_001267550.2(TTN):c.24909G>A (p.Lys8303=) rs72648983
NM_001267550.2(TTN):c.24914G>A (p.Arg8305Gln) rs759985618
NM_001267550.2(TTN):c.24927A>G (p.Ala8309=) rs1179963628
NM_001267550.2(TTN):c.24946_24947delinsT (p.Asn8316fs)
NM_001267550.2(TTN):c.24952G>A (p.Val8318Ile) rs200103997
NM_001267550.2(TTN):c.24957T>C (p.Ala8319=) rs758868965
NM_001267550.2(TTN):c.24962T>C (p.Leu8321Ser)
NM_001267550.2(TTN):c.24964G>T (p.Val8322Leu) rs201571580
NM_001267550.2(TTN):c.24972C>A (p.Asn8324Lys) rs879030954
NM_001267550.2(TTN):c.24973A>G (p.Lys8325Glu) rs72648984
NM_001267550.2(TTN):c.25002T>C (p.Tyr8334=) rs371334680
NM_001267550.2(TTN):c.25005A>C (p.Ser8335=) rs879229692
NM_001267550.2(TTN):c.25008C>T (p.Cys8336=) rs116378128
NM_001267550.2(TTN):c.2502A>G (p.Ile834Met) rs752214647
NM_001267550.2(TTN):c.25036G>A (p.Ala8346Thr) rs755302381
NM_001267550.2(TTN):c.25037C>T (p.Ala8346Val) rs747055472
NM_001267550.2(TTN):c.25063+1G>A rs754247415
NM_001267550.2(TTN):c.25063+5T>A rs1553902318
NM_001267550.2(TTN):c.25065G>A (p.Ala8355=) rs397517514
NM_001267550.2(TTN):c.25066C>T (p.Arg8356Cys) rs201810836
NM_001267550.2(TTN):c.2506G>T (p.Gly836Cys) rs751157908
NM_001267550.2(TTN):c.25087G>T (p.Ala8363Ser) rs200972189
NM_001267550.2(TTN):c.25105G>A (p.Val8369Ile) rs755722481
NM_001267550.2(TTN):c.25126C>T (p.Pro8376Ser) rs375209098
NM_001267550.2(TTN):c.25134A>G (p.Ala8378=) rs371819104
NM_001267550.2(TTN):c.25144C>T (p.Arg8382Cys) rs776519143
NM_001267550.2(TTN):c.25154G>C (p.Gly8385Ala) rs775560531
NM_001267550.2(TTN):c.25155C>T (p.Gly8385=) rs772383867
NM_001267550.2(TTN):c.25180T>G (p.Tyr8394Asp) rs898098652
NM_001267550.2(TTN):c.25209T>C (p.Asp8403=) rs569860898
NM_001267550.2(TTN):c.25215T>A (p.Asn8405Lys) rs371923232
NM_001267550.2(TTN):c.25223C>T (p.Thr8408Ile) rs201432372
NM_001267550.2(TTN):c.25231G>A (p.Val8411Ile) rs760523669
NM_001267550.2(TTN):c.25249C>T (p.Leu8417Phe) rs774234445
NM_001267550.2(TTN):c.25270C>G (p.Gln8424Glu) rs370668637
NM_001267550.2(TTN):c.25296C>T (p.Cys8432=) rs375720439
NM_001267550.2(TTN):c.25351+7A>G rs753224694
NM_001267550.2(TTN):c.25398T>A (p.Asp8466Glu) rs72648986
NM_001267550.2(TTN):c.25476T>A (p.Asp8492Glu) rs777349143
NM_001267550.2(TTN):c.25480C>T (p.Arg8494Ter) rs794727945
NM_001267550.2(TTN):c.25481G>A (p.Arg8494Gln) rs201418615
NM_001267550.2(TTN):c.25489C>T (p.Arg8497Cys) rs369517119
NM_001267550.2(TTN):c.25490G>A (p.Arg8497His) rs149855485
NM_001267550.2(TTN):c.25510A>C (p.Met8504Leu) rs761929830
NM_001267550.2(TTN):c.25563C>T (p.Gly8521=) rs556205722
NM_001267550.2(TTN):c.25564G>A (p.Asp8522Asn) rs199619070
NM_001267550.2(TTN):c.25569C>T (p.Ala8523=) rs375022009
NM_001267550.2(TTN):c.25570G>A (p.Gly8524Arg) rs371512914
NM_001267550.2(TTN):c.25600G>T (p.Ala8534Ser) rs779163897
NM_001267550.2(TTN):c.25619C>T (p.Ser8540Phe) rs201523784
NM_001267550.2(TTN):c.25626G>T (p.Gln8542His) rs2562832
NM_001267550.2(TTN):c.25637A>G (p.Gln8546Arg) rs548471822
NM_001267550.2(TTN):c.25639+7G>C rs1365164180
NM_001267550.2(TTN):c.25639G>C (p.Glu8547Gln) rs1060500447
NM_001267550.2(TTN):c.25640-8T>C rs1184501172
NM_001267550.2(TTN):c.25662_25663delinsTT (p.Lys8554Asn) rs1553898915
NM_001267550.2(TTN):c.2568C>T (p.Thr856=) rs1282647790
NM_001267550.2(TTN):c.25704G>A (p.Arg8568=) rs150544093
NM_001267550.2(TTN):c.25707_25708inv (p.Glu8570Lys)
NM_001267550.2(TTN):c.25717A>C (p.Ile8573Leu) rs142609645
NM_001267550.2(TTN):c.25758C>T (p.Asp8586=) rs372802604
NM_001267550.2(TTN):c.25783A>T (p.Lys8595Ter)
NM_001267550.2(TTN):c.25853G>A (p.Gly8618Glu) rs369947439
NM_001267550.2(TTN):c.25877A>G (p.Asn8626Ser) rs200355367
NM_001267550.2(TTN):c.25921G>A (p.Glu8641Lys) rs1553898323
NM_001267550.2(TTN):c.25936C>T (p.Arg8646Cys) rs72648987
NM_001267550.2(TTN):c.25937G>A (p.Arg8646His) rs144587343
NM_001267550.2(TTN):c.25937G>T (p.Arg8646Leu) rs144587343
NM_001267550.2(TTN):c.25971A>T (p.Gly8657=) rs1060500547
NM_001267550.2(TTN):c.25978G>A (p.Val8660Ile) rs141856116
NM_001267550.2(TTN):c.2599A>G (p.Ser867Gly) rs148631577
NM_001267550.2(TTN):c.26019C>T (p.His8673=) rs370266918
NM_001267550.2(TTN):c.26030A>G (p.Tyr8677Cys) rs778578388
NM_001267550.2(TTN):c.26055C>T (p.Ser8685=) rs727505250
NM_001267550.2(TTN):c.2605A>T (p.Thr869Ser) rs370962244
NM_001267550.2(TTN):c.26068A>C (p.Lys8690Gln) rs1060500411
NM_001267550.2(TTN):c.26081A>C (p.Glu8694Ala) rs1553897407
NM_001267550.2(TTN):c.26093C>G (p.Thr8698Ser) rs1060500461
NM_001267550.2(TTN):c.26116G>A (p.Asp8706Asn) rs377074955
NM_001267550.2(TTN):c.2611G>T (p.Val871Leu) rs72647861
NM_001267550.2(TTN):c.26144G>T (p.Cys8715Phe) rs183499397
NM_001267550.2(TTN):c.26157T>C (p.Asn8719=) rs878854294
NM_001267550.2(TTN):c.26161G>A (p.Val8721Met) rs777730788
NM_001267550.2(TTN):c.26170G>A (p.Asp8724Asn) rs756034176
NM_001267550.2(TTN):c.26189T>A (p.Ile8730Asn) rs1060500488
NM_001267550.2(TTN):c.26201-11dup rs727503644
NM_001267550.2(TTN):c.26240del (p.Thr8747fs) rs1553896398
NM_001267550.2(TTN):c.26245G>A (p.Val8749Ile) rs16866457
NM_001267550.2(TTN):c.26261A>T (p.Gln8754Leu) rs1060500568
NM_001267550.2(TTN):c.26275A>G (p.Ile8759Val) rs1317485542
NM_001267550.2(TTN):c.26281G>A (p.Gly8761Ser) rs369385294
NM_001267550.2(TTN):c.26283C>T (p.Gly8761=) rs376046284
NM_001267550.2(TTN):c.26329G>A (p.Val8777Ile) rs376823283
NM_001267550.2(TTN):c.26439C>T (p.Asn8813=) rs200088963
NM_001267550.2(TTN):c.26444C>G (p.Ala8815Gly) rs1168744166
NM_001267550.2(TTN):c.26466C>G (p.Ala8822=) rs140003804
NM_001267550.2(TTN):c.26468C>T (p.Thr8823Met) rs368151971
NM_001267550.2(TTN):c.26482+1G>A
NM_001267550.2(TTN):c.26482+5G>A rs1060500590
NM_001267550.2(TTN):c.26494A>G (p.Ile8832Val) rs72648989
NM_001267550.2(TTN):c.26506C>T (p.Pro8836Ser) rs776799144
NM_001267550.2(TTN):c.26528C>T (p.Thr8843Met) rs72648990
NM_001267550.2(TTN):c.26553T>C (p.Cys8851=) rs1553895388
NM_001267550.2(TTN):c.26579G>A (p.Ser8860Asn) rs1240256366
NM_001267550.2(TTN):c.26619C>A (p.Asp8873Glu) rs772596633
NM_001267550.2(TTN):c.26652A>G (p.Val8884=) rs746179492
NM_001267550.2(TTN):c.26672A>G (p.Asn8891Ser) rs146057575
NM_001267550.2(TTN):c.26674G>A (p.Val8892Ile) rs747832107
NM_001267550.2(TTN):c.26682G>A (p.Pro8894=) rs142812510
NM_001267550.2(TTN):c.26694G>T (p.Gly8898=) rs199525540
NM_001267550.2(TTN):c.266C>G (p.Ala89Gly) rs200165636
NM_001267550.2(TTN):c.26719C>T (p.Pro8907Ser) rs764261158
NM_001267550.2(TTN):c.26744C>G (p.Ala8915Gly) rs536974988
NM_001267550.2(TTN):c.26754G>A (p.Gln8918=) rs1060503939
NM_001267550.2(TTN):c.26762-10_26762-9insTTGTTTTGTA rs1553893826
NM_001267550.2(TTN):c.26762-19_26762-10delTTTGTTTTGT rs71393436
NM_001267550.2(TTN):c.26762-24_26762-10delTTTGTTTTGTTTTGT rs71393436
NM_001267550.2(TTN):c.26762-39TTTGT[10] rs71393436
NM_001267550.2(TTN):c.26762-39TTTGT[11] rs71393436
NM_001267550.2(TTN):c.26762-39TTTGT[5] rs71393436
NM_001267550.2(TTN):c.26762-39TTTGT[7] rs71393436
NM_001267550.2(TTN):c.26762-39TTTGT[8] rs71393436
NM_001267550.2(TTN):c.26762-39_26762-10dup rs71393436
NM_001267550.2(TTN):c.26762-9A>G rs200821070
NM_001267550.2(TTN):c.26762-9delins34
NM_001267550.2(TTN):c.26814A>G (p.Leu8938=) rs764770520
NM_001267550.2(TTN):c.26818G>A (p.Gly8940Ser) rs201005813
NM_001267550.2(TTN):c.26830G>A (p.Val8944Ile) rs72648993
NM_001267550.2(TTN):c.26849A>G (p.Tyr8950Cys) rs199557654
NM_001267550.2(TTN):c.26863A>G (p.Ile8955Val) rs72648994
NM_001267550.2(TTN):c.26868T>C (p.Ser8956=) rs778211975
NM_001267550.2(TTN):c.2686G>A (p.Val896Ile) rs376768790
NM_001267550.2(TTN):c.26882A>G (p.His8961Arg) rs766862084
NM_001267550.2(TTN):c.26893G>A (p.Glu8965Lys) rs200325324
NM_001267550.2(TTN):c.26928G>A (p.Leu8976=) rs370973715
NM_001267550.2(TTN):c.26935A>C (p.Asn8979His) rs376982715
NM_001267550.2(TTN):c.26940T>A (p.Thr8980=) rs1060503948
NM_001267550.2(TTN):c.26958C>T (p.Asn8986=) rs1398273084
NM_001267550.2(TTN):c.26985C>A (p.Asp8995Glu) rs781351100
NM_001267550.2(TTN):c.26989A>G (p.Thr8997Ala) rs953177976
NM_001267550.2(TTN):c.26991A>G (p.Thr8997=) rs61232800
NM_001267550.2(TTN):c.26C>T (p.Thr9Met) rs146123323
NM_001267550.2(TTN):c.27030T>A (p.Ser9010Arg) rs774115714
NM_001267550.2(TTN):c.27045G>A (p.Val9015=) rs769752606
NM_001267550.2(TTN):c.27121A>G (p.Ile9041Val) rs1395755933
NM_001267550.2(TTN):c.27158T>C (p.Phe9053Ser) rs761745332
NM_001267550.2(TTN):c.2716A>G (p.Ile906Val) rs1304074202
NM_001267550.2(TTN):c.27193T>C (p.Cys9065Arg) rs201229221
NM_001267550.2(TTN):c.27198C>G (p.Asn9066Lys) rs369529493
NM_001267550.2(TTN):c.27224_27228del (p.Glu9075fs) rs1553892376
NM_001267550.2(TTN):c.27261A>G (p.Gly9087=) rs878854295
NM_001267550.2(TTN):c.2730C>T (p.Thr910=) rs375432172
NM_001267550.2(TTN):c.2731G>A (p.Val911Ile) rs141961878
NM_001267550.2(TTN):c.27328+5G>A rs397517521
NM_001267550.2(TTN):c.27329-1G>T rs1378646156
NM_001267550.2(TTN):c.2734C>T (p.Arg912Cys) rs371156190
NM_001267550.2(TTN):c.27350G>C (p.Arg9117Thr) rs375907742
NM_001267550.2(TTN):c.27382C>A (p.Pro9128Thr) rs1283675898
NM_001267550.2(TTN):c.27425C>T (p.Ser9142Leu) rs781609380
NM_001267550.2(TTN):c.27426G>A (p.Ser9142=) rs368081453
NM_001267550.2(TTN):c.27427G>T (p.Val9143Phe) rs186857044
NM_001267550.2(TTN):c.2743C>T (p.Arg915Cys) rs539652641
NM_001267550.2(TTN):c.2744G>C (p.Arg915Pro) rs376922544
NM_001267550.2(TTN):c.2745C>G (p.Arg915=) rs773568773
NM_001267550.2(TTN):c.27485C>T (p.Thr9162Met) rs199793620
NM_001267550.2(TTN):c.27498G>A (p.Ser9166=) rs372528823
NM_001267550.2(TTN):c.27532G>T (p.Asp9178Tyr) rs727504202
NM_001267550.2(TTN):c.27592C>G (p.Gln9198Glu) rs72648995
NM_001267550.2(TTN):c.27593A>G (p.Gln9198Arg) rs368297438
NM_001267550.2(TTN):c.2760C>T (p.His920=) rs138788406
NM_001267550.2(TTN):c.27631T>C (p.Leu9211=) rs563954136
NM_001267550.2(TTN):c.27639G>A (p.Pro9213=) rs541105227
NM_001267550.2(TTN):c.2764C>T (p.Arg922Cys) rs72647862
NM_001267550.2(TTN):c.2765G>A (p.Arg922His) rs56046320
NM_001267550.2(TTN):c.27667T>C (p.Ser9223Pro) rs201253546
NM_001267550.2(TTN):c.2767G>A (p.Glu923Lys) rs369195237
NM_001267550.2(TTN):c.27702T>C (p.Ile9234=) rs143368674
NM_001267550.2(TTN):c.27705G>A (p.Gly9235=) rs759964251
NM_001267550.2(TTN):c.27709T>G (p.Ser9237Ala) rs766638714
NM_001267550.2(TTN):c.27711C>A (p.Ser9237=) rs727504749
NM_001267550.2(TTN):c.27711C>T (p.Ser9237=) rs727504749
NM_001267550.2(TTN):c.27715T>C (p.Tyr9239His) rs373068293
NM_001267550.2(TTN):c.27746C>T (p.Thr9249Met) rs745792278
NM_001267550.2(TTN):c.2781A>C (p.Thr927=) rs55892860
NM_001267550.2(TTN):c.27825T>C (p.Tyr9275=) rs375790254
NM_001267550.2(TTN):c.27846C>T (p.Ser9282=) rs182355009
NM_001267550.2(TTN):c.27856G>C (p.Val9286Leu) rs777547707
NM_001267550.2(TTN):c.27872T>C (p.Phe9291Ser) rs754982924
NM_001267550.2(TTN):c.27886+5T>C rs876658050
NM_001267550.2(TTN):c.27887-4A>T rs1553889394
NM_001267550.2(TTN):c.27887-7C>T rs1446519993
NM_001267550.2(TTN):c.27896T>G (p.Leu9299Arg) rs879046044
NM_001267550.2(TTN):c.278C>G (p.Ala93Gly) rs1473207810
NM_001267550.2(TTN):c.27914G>A (p.Arg9305Gln) rs397517527
NM_001267550.2(TTN):c.27928G>A (p.Val9310Ile) rs200207722
NM_001267550.2(TTN):c.27947T>G (p.Leu9316Arg) rs78643968
NM_001267550.2(TTN):c.27988A>G (p.Ile9330Val) rs768696299
NM_001267550.2(TTN):c.27G>A (p.Thr9=) rs760305568
NM_001267550.2(TTN):c.28032C>A (p.Ser9344Arg) rs1338895544
NM_001267550.2(TTN):c.28034C>T (p.Pro9345Leu) rs878854296
NM_001267550.2(TTN):c.28047A>G (p.Thr9349=) rs575817028
NM_001267550.2(TTN):c.28055T>C (p.Leu9352Ser) rs776487201
NM_001267550.2(TTN):c.28070C>T (p.Thr9357Ile) rs144930507
NM_001267550.2(TTN):c.28093C>T (p.Arg9365Trp) rs190600127
NM_001267550.2(TTN):c.28094G>A (p.Arg9365Gln) rs570608843
NM_001267550.2(TTN):c.28098C>G (p.Ser9366Arg) rs374930292
NM_001267550.2(TTN):c.28099C>T (p.Leu9367Phe) rs748483786
NM_001267550.2(TTN):c.28131C>A (p.Asn9377Lys) rs72648997
NM_001267550.2(TTN):c.28131C>T (p.Asn9377=) rs72648997
NM_001267550.2(TTN):c.28137A>G (p.Ile9379Met) rs1060500516
NM_001267550.2(TTN):c.28151C>G (p.Ser9384Cys) rs760466007
NM_001267550.2(TTN):c.28170C>T (p.Leu9390=) rs149910892
NM_001267550.2(TTN):c.28174+7G>C rs1478656719
NM_001267550.2(TTN):c.28187C>T (p.Pro9396Leu) rs373065549
NM_001267550.2(TTN):c.28205G>A (p.Arg9402His) rs773986121
NM_001267550.2(TTN):c.28207C>G (p.Leu9403Val) rs752742472
NM_001267550.2(TTN):c.2824C>T (p.Pro942Ser) rs1060500550
NM_001267550.2(TTN):c.28262C>T (p.Thr9421Met) rs375209383
NM_001267550.2(TTN):c.28269A>G (p.Thr9423=) rs550056960
NM_001267550.2(TTN):c.28275G>A (p.Pro9425=) rs1448968221
NM_001267550.2(TTN):c.28308A>C (p.Glu9436Asp) rs906433178
NM_001267550.2(TTN):c.28313G>A (p.Arg9438Gln) rs72648998
NM_001267550.2(TTN):c.28328A>T (p.Tyr9443Phe) rs1553888051
NM_001267550.2(TTN):c.2836G>A (p.Val946Ile) rs752246051
NM_001267550.2(TTN):c.28391C>T (p.Ser9464Phe) rs1553887984
NM_001267550.2(TTN):c.28424T>G (p.Val9475Gly) rs1363580617
NM_001267550.2(TTN):c.28425G>T (p.Val9475=) rs727503642
NM_001267550.2(TTN):c.28433A>C (p.Asp9478Ala) rs1553887887
NM_001267550.2(TTN):c.28466G>A (p.Arg9489Gln) rs189431308
NM_001267550.2(TTN):c.28480A>T (p.Ser9494Cys) rs1553886767
NM_001267550.2(TTN):c.28495C>T (p.Leu9499Phe) rs1060500573
NM_001267550.2(TTN):c.28507G>A (p.Val9503Ile) rs202160275
NM_001267550.2(TTN):c.28509A>G (p.Val9503=) rs756229382
NM_001267550.2(TTN):c.28524del (p.Asn9509fs)
NM_001267550.2(TTN):c.28542G>A (p.Glu9514=) rs370604793
NM_001267550.2(TTN):c.28547G>A (p.Arg9516His) rs374156904
NM_001267550.2(TTN):c.28592A>C (p.Asn9531Thr) rs537464608
NM_001267550.2(TTN):c.28594A>G (p.Ile9532Val) rs770782767
NM_001267550.2(TTN):c.28644G>A (p.Thr9548=) rs376744914
NM_001267550.2(TTN):c.28662G>A (p.Arg9554=) rs2742332
NM_001267550.2(TTN):c.28667C>T (p.Ala9556Val) rs1060500482
NM_001267550.2(TTN):c.28674G>C (p.Met9558Ile) rs868771235
NM_001267550.2(TTN):c.28677C>T (p.Asn9559=) rs775065173
NM_001267550.2(TTN):c.28726C>G (p.Leu9576Val) rs780753483
NM_001267550.2(TTN):c.28726C>T (p.Leu9576=) rs780753483
NM_001267550.2(TTN):c.28733C>T (p.Thr9578Met) rs184923756
NM_001267550.2(TTN):c.28741A>G (p.Ile9581Val) rs371826762
NM_001267550.2(TTN):c.28744G>A (p.Val9582Ile) rs537805395
NM_001267550.2(TTN):c.28754-7A>T rs398124445
NM_001267550.2(TTN):c.28754A>G (p.Glu9585Gly) rs200856239
NM_001267550.2(TTN):c.28795G>A (p.Val9599Ile) rs887090503
NM_001267550.2(TTN):c.28818C>T (p.Tyr9606=) rs374117152
NM_001267550.2(TTN):c.28819G>A (p.Val9607Met) rs375807609
NM_001267550.2(TTN):c.28829G>A (p.Ser9610Asn) rs371759532
NM_001267550.2(TTN):c.2882C>G (p.Thr961Ser) rs1554018432
NM_001267550.2(TTN):c.28877C>A (p.Ala9626Asp) rs397517530
NM_001267550.2(TTN):c.28880G>A (p.Gly9627Asp) rs878908638
NM_001267550.2(TTN):c.28908C>A (p.Cys9636Ter) rs1553883443
NM_001267550.2(TTN):c.28970C>T (p.Ser9657Leu) rs200049911
NM_001267550.2(TTN):c.28983G>T (p.Val9661=) rs794727991
NM_001267550.2(TTN):c.289G>A (p.Val97Met) rs185921345
NM_001267550.2(TTN):c.29015C>T (p.Thr9672Ile) rs769996978
NM_001267550.2(TTN):c.29024C>A (p.Ser9675Ter) rs886042115
NM_001267550.2(TTN):c.29048C>T (p.Pro9683Leu) rs794729399
NM_001267550.2(TTN):c.29066C>G (p.Thr9689Ser) rs777878480
NM_001267550.2(TTN):c.29079G>A (p.Ala9693=) rs372997298
NM_001267550.2(TTN):c.29128G>A (p.Val9710Ile) rs72649002
NM_001267550.2(TTN):c.2916G>A (p.Pro972=) rs757569345
NM_001267550.2(TTN):c.29178C>A (p.Ile9726=) rs72650003
NM_001267550.2(TTN):c.29185G>T (p.Val9729Phe) rs1060500451
NM_001267550.2(TTN):c.29227G>A (p.Gly9743Ser) rs368073588
NM_001267550.2(TTN):c.29230C>G (p.Arg9744Gly) rs375266859
NM_001267550.2(TTN):c.29230C>T (p.Arg9744Cys) rs375266859
NM_001267550.2(TTN):c.29231G>A (p.Arg9744His) rs760305440
NM_001267550.2(TTN):c.29317G>A (p.Ala9773Thr) rs371163094
NM_001267550.2(TTN):c.29325C>T (p.Asn9775=) rs377442695
NM_001267550.2(TTN):c.29333G>A (p.Gly9778Asp) rs775854531
NM_001267550.2(TTN):c.2940C>T (p.Asp980=) rs201395853
NM_001267550.2(TTN):c.29421-7T>C rs1553879938
NM_001267550.2(TTN):c.29429T>C (p.Ile9810Thr) rs781737736
NM_001267550.2(TTN):c.29464G>T (p.Asp9822Tyr) rs758873870
NM_001267550.2(TTN):c.2949C>T (p.Ile983=) rs56310516
NM_001267550.2(TTN):c.29502A>G (p.Glu9834=) rs759468315
NM_001267550.2(TTN):c.29541C>T (p.Phe9847=) rs56812642
NM_001267550.2(TTN):c.29564A>G (p.Glu9855Gly) rs794727011
NM_001267550.2(TTN):c.29597A>G (p.His9866Arg) rs878919397
NM_001267550.2(TTN):c.29637C>T (p.Asp9879=) rs375591605
NM_001267550.2(TTN):c.2967C>A (p.Phe989Leu) rs376548316
NM_001267550.2(TTN):c.29729C>T (p.Thr9910Ile) rs878854297
NM_001267550.2(TTN):c.29762T>C (p.Ile9921Thr) rs373651676
NM_001267550.2(TTN):c.29777A>C (p.Asn9926Thr) rs377147236
NM_001267550.2(TTN):c.29812A>T (p.Thr9938Ser) rs72650006
NM_001267550.2(TTN):c.29857G>A (p.Gly9953Ser) rs770212603
NM_001267550.2(TTN):c.29864G>A (p.Arg9955Gln) rs182332374
NM_001267550.2(TTN):c.29938G>A (p.Ala9980Thr) rs189286381
NM_001267550.2(TTN):c.29943C>T (p.Ser9981=) rs543490348
NM_001267550.2(TTN):c.29944G>A (p.Ala9982Thr) rs200745162
NM_001267550.2(TTN):c.29965C>A (p.Pro9989Thr) rs1553877891
NM_001267550.2(TTN):c.2996G>A (p.Arg999His) rs371757623
NM_001267550.2(TTN):c.29984T>A (p.Leu9995His) rs1060500554
NM_001267550.2(TTN):c.3002T>G (p.Met1001Arg) rs148269839
NM_001267550.2(TTN):c.30030C>T (p.Cys10010=) rs372290430
NM_001267550.2(TTN):c.30033A>G (p.Gln10011=) rs768497622
NM_001267550.2(TTN):c.30044C>T (p.Pro10015Leu) rs1178694077
NM_001267550.2(TTN):c.3007dup (p.Arg1003fs)
NM_001267550.2(TTN):c.30091dup (p.Gln10031fs) rs1553877628
NM_001267550.2(TTN):c.3010G>A (p.Glu1004Lys) rs200902055
NM_001267550.2(TTN):c.30117A>G (p.Glu10039=) rs772838964
NM_001267550.2(TTN):c.30129T>C (p.His10043=) rs764724866
NM_001267550.2(TTN):c.30139A>T (p.Ile10047Phe) rs1553877530
NM_001267550.2(TTN):c.30181A>C (p.Lys10061Gln) rs184153985
NM_001267550.2(TTN):c.30196G>C (p.Glu10066Gln) rs370072382
NM_001267550.2(TTN):c.3021G>A (p.Ala1007=) rs147603843
NM_001267550.2(TTN):c.30223+5G>A
NM_001267550.2(TTN):c.30231A>G (p.Pro10077=) rs74324101
NM_001267550.2(TTN):c.30274C>T (p.His10092Tyr) rs72650011
NM_001267550.2(TTN):c.30282T>G (p.Ser10094=) rs886042543
NM_001267550.2(TTN):c.30283G>A (p.Ala10095Thr) rs201635835
NM_001267550.2(TTN):c.30299A>C (p.Glu10100Ala) rs1060500579
NM_001267550.2(TTN):c.302C>T (p.Thr101Ile) rs879185669
NM_001267550.2(TTN):c.30309T>C (p.Phe10103=) rs762141482
NM_001267550.2(TTN):c.3035G>A (p.Arg1012Gln) rs368885310
NM_001267550.2(TTN):c.30384T>C (p.Asp10128=) rs188584219
NM_001267550.2(TTN):c.30389G>A (p.Arg10130His) rs373355159
NM_001267550.2(TTN):c.30426C>T (p.Asp10142=) rs147524531
NM_001267550.2(TTN):c.30433+10T>C rs763058822
NM_001267550.2(TTN):c.30433+2T>G rs1060500504
NM_001267550.2(TTN):c.30436G>A (p.Val10146Ile) rs1553875094
NM_001267550.2(TTN):c.30444G>A (p.Ser10148=) rs367901929
NM_001267550.2(TTN):c.30485C>T (p.Thr10162Met) rs200593368
NM_001267550.2(TTN):c.30487del (p.Ala10163fs) rs1560498923
NM_001267550.2(TTN):c.30512-11_30512-10dupTT rs397517532
NM_001267550.2(TTN):c.30513A>T (p.Glu10171Asp) rs577066020
NM_001267550.2(TTN):c.30515T>A (p.Ile10172Asn) rs772028677
NM_001267550.2(TTN):c.30583G>T (p.Ala10195Ser) rs1060500585
NM_001267550.2(TTN):c.30598+4A>T rs1560494355
NM_001267550.2(TTN):c.30598G>C (p.Glu10200Gln) rs779015756
NM_001267550.2(TTN):c.30605C>T (p.Pro10202Leu) rs769528182
NM_001267550.2(TTN):c.30614T>C (p.Val10205Ala) rs1060500449
NM_001267550.2(TTN):c.30683-2A>T rs886043892
NM_001267550.2(TTN):c.30694G>T (p.Ala10232Ser) rs747294929
NM_001267550.2(TTN):c.3069C>T (p.Thr1023=) rs371447978
NM_001267550.2(TTN):c.30718G>T (p.Val10240Phe) rs111671438
NM_001267550.2(TTN):c.30754+8A>G rs1060503958
NM_001267550.2(TTN):c.30781A>G (p.Thr10261Ala) rs1060500409
NM_001267550.2(TTN):c.30811A>G (p.Ile10271Val) rs182720979
NM_001267550.2(TTN):c.30857T>C (p.Ile10286Thr) rs369094355
NM_001267550.2(TTN):c.30888A>G (p.Lys10296=) rs587780978
NM_001267550.2(TTN):c.30899A>G (p.Tyr10300Cys) rs1553864504
NM_001267550.2(TTN):c.30941T>C (p.Ile10314Thr) rs886055288
NM_001267550.2(TTN):c.30952G>A (p.Glu10318Lys) rs73038324
NM_001267550.2(TTN):c.30967G>T (p.Glu10323Ter) rs1425322355
NM_001267550.2(TTN):c.30994C>G (p.Pro10332Ala) rs757869762
NM_001267550.2(TTN):c.3100G>A (p.Val1034Met) rs142951505
NM_001267550.2(TTN):c.31014T>C (p.Tyr10338=) rs397517536
NM_001267550.2(TTN):c.31048G>A (p.Val10350Ile) rs1553864204
NM_001267550.2(TTN):c.31071C>T (p.His10357=) rs368973334
NM_001267550.2(TTN):c.31114G>C (p.Glu10372Gln) rs200831060
NM_001267550.2(TTN):c.31156G>A (p.Glu10386Lys) rs772195716
NM_001267550.2(TTN):c.31227T>G (p.Val10409=) rs748539440
NM_001267550.2(TTN):c.31270G>T (p.Val10424Phe)
NM_001267550.2(TTN):c.31295A>G (p.Lys10432Arg) rs879134517
NM_001267550.2(TTN):c.3133G>A (p.Val1045Met) rs72647868
NM_001267550.2(TTN):c.3138T>A (p.Thr1046=) rs1060503945
NM_001267550.2(TTN):c.31390C>T (p.Arg10464Trp) rs374555701
NM_001267550.2(TTN):c.31391G>A (p.Arg10464Gln) rs727504757
NM_001267550.2(TTN):c.31399G>A (p.Val10467Ile) rs72650019
NM_001267550.2(TTN):c.31422G>A (p.Val10474=) rs72650020
NM_001267550.2(TTN):c.31426+1G>C rs6749719
NM_001267550.2(TTN):c.31453G>T (p.Val10485Phe) rs762572524
NM_001267550.2(TTN):c.31472T>C (p.Met10491Thr) rs769226745
NM_001267550.2(TTN):c.31486C>G (p.His10496Asp) rs1553860465
NM_001267550.2(TTN):c.31513+1G>A rs1553860401
NM_001267550.2(TTN):c.31518C>T (p.Pro10506=) rs746912694
NM_001267550.2(TTN):c.31525C>A (p.Gln10509Lys) rs1553859889
NM_001267550.2(TTN):c.31533A>G (p.Glu10511=) rs757499228
NM_001267550.2(TTN):c.31563_31564inv (p.Ile10522Val)
NM_001267550.2(TTN):c.31569C>G (p.Ser10523=) rs766691593
NM_001267550.2(TTN):c.31594G>A (p.Val10532Ile) rs763955552
NM_001267550.2(TTN):c.31645A>G (p.Ile10549Val) rs376613199
NM_001267550.2(TTN):c.31669G>T (p.Ala10557Ser) rs1553857863
NM_001267550.2(TTN):c.31672C>A (p.Pro10558Thr) rs769915175
NM_001267550.2(TTN):c.31731G>A (p.Val10577=) rs751447529
NM_001267550.2(TTN):c.31735A>C (p.Lys10579Gln) rs376287951
NM_001267550.2(TTN):c.31756C>G (p.Pro10586Ala) rs768652249
NM_001267550.2(TTN):c.31757C>A (p.Pro10586Gln) rs200459347
NM_001267550.2(TTN):c.31757C>T (p.Pro10586Leu) rs200459347
NM_001267550.2(TTN):c.31762+4C>G rs368538884
NM_001267550.2(TTN):c.31762+5_31762+7del rs397517538
NM_001267550.2(TTN):c.31762G>A (p.Val10588Ile) rs372371333
NM_001267550.2(TTN):c.31763-1G>A rs202234172
NM_001267550.2(TTN):c.31764C>T (p.Val10588=) rs766441395
NM_001267550.2(TTN):c.31787T>C (p.Val10596Ala) rs746313065
NM_001267550.2(TTN):c.31806C>T (p.Pro10602=) rs370080995
NM_001267550.2(TTN):c.31807G>A (p.Val10603Ile) rs139790668
NM_001267550.2(TTN):c.31821G>T (p.Lys10607Asn) rs746722623
NM_001267550.2(TTN):c.31837C>G (p.Pro10613Ala) rs200213832
NM_001267550.2(TTN):c.31875A>C (p.Thr10625=) rs182934463
NM_001267550.2(TTN):c.31922C>T (p.Pro10641Leu) rs773886361
NM_001267550.2(TTN):c.31941A>G (p.Pro10647=) rs528062079
NM_001267550.2(TTN):c.31989A>G (p.Glu10663=) rs1276917315
NM_001267550.2(TTN):c.32005C>A (p.Pro10669Thr) rs945424720
NM_001267550.2(TTN):c.32005C>T (p.Pro10669Ser) rs945424720
NM_001267550.2(TTN):c.32011+10C>G rs192002980
NM_001267550.2(TTN):c.32018C>G (p.Ala10673Gly) rs773935335
NM_001267550.2(TTN):c.32020C>G (p.Leu10674Val) rs766003250
NM_001267550.2(TTN):c.32021T>C (p.Leu10674Pro) rs762662455
NM_001267550.2(TTN):c.32025T>C (p.Pro10675=) rs369365087
NM_001267550.2(TTN):c.32026A>G (p.Lys10676Glu) rs200952728
NM_001267550.2(TTN):c.32049A>G (p.Lys10683=) rs375408527
NM_001267550.2(TTN):c.3205C>G (p.Leu1069Val) rs759873829
NM_001267550.2(TTN):c.32071G>A (p.Ala10691Thr) rs371452173
NM_001267550.2(TTN):c.32093G>A (p.Arg10698Gln) rs200161147
NM_001267550.2(TTN):c.32095+5G>C rs869312090
NM_001267550.2(TTN):c.32096-4_32117delAAAGCTGAAGTCTCTAAGAAAACTGT rs1560398348
NM_001267550.2(TTN):c.3214G>A (p.Glu1072Lys) rs1263370770
NM_001267550.2(TTN):c.32161G>A (p.Ala10721Thr) rs753365187
NM_001267550.2(TTN):c.32161G>T (p.Ala10721Ser) rs753365187
NM_001267550.2(TTN):c.32164G>A (p.Val10722Ile) rs763742779
NM_001267550.2(TTN):c.32186C>T (p.Thr10729Met) rs115119858
NM_001267550.2(TTN):c.32189G>C (p.Arg10730Pro) rs771054923
NM_001267550.2(TTN):c.32194G>A (p.Glu10732Lys) rs374348069
NM_001267550.2(TTN):c.32198-9C>A rs555383226
NM_001267550.2(TTN):c.32199A>T (p.Val10733=) rs769008912
NM_001267550.2(TTN):c.32254G>A (p.Val10752Ile) rs72650028
NM_001267550.2(TTN):c.32311+1G>T
NM_001267550.2(TTN):c.32350C>G (p.Leu10784Val) rs72650029
NM_001267550.2(TTN):c.3235C>A (p.Pro1079Thr) rs774643116
NM_001267550.2(TTN):c.32367G>A (p.Lys10789=) rs79232842
NM_001267550.2(TTN):c.3241G>A (p.Ala1081Thr) rs55914517
NM_001267550.2(TTN):c.3241G>T (p.Ala1081Ser) rs55914517
NM_001267550.2(TTN):c.32462C>T (p.Pro10821Leu) rs146400809
NM_001267550.2(TTN):c.32470G>T (p.Val10824Phe) rs753951400
NM_001267550.2(TTN):c.32480C>T (p.Ala10827Val) rs72650030
NM_001267550.2(TTN):c.32542C>T (p.Pro10848Ser) rs368286625
NM_001267550.2(TTN):c.32554+1G>T
NM_001267550.2(TTN):c.32554+5_32554+6del rs771419718
NM_001267550.2(TTN):c.32555-1G>A
NM_001267550.2(TTN):c.32555-2A>C
NM_001267550.2(TTN):c.32557C>T (p.Pro10853Ser) rs201738153
NM_001267550.2(TTN):c.32593G>C (p.Val10865Leu) rs150733188
NM_001267550.2(TTN):c.32624C>T (p.Pro10875Leu) rs72650031
NM_001267550.2(TTN):c.32630C>G (p.Pro10877Arg) rs915579403
NM_001267550.2(TTN):c.32648G>A (p.Arg10883Lys) rs116676813
NM_001267550.2(TTN):c.32660T>C (p.Ile10887Thr) rs371538856
NM_001267550.2(TTN):c.326G>A (p.Arg109Gln) rs766434493
NM_001267550.2(TTN):c.32703G>A (p.Glu10901=) rs397517542
NM_001267550.2(TTN):c.32722+3A>G rs1182220171
NM_001267550.2(TTN):c.32731G>A (p.Glu10911Lys) rs199620003
NM_001267550.2(TTN):c.32735C>T (p.Pro10912Leu) rs781655223
NM_001267550.2(TTN):c.32743G>C (p.Ala10915Pro) rs72650032
NM_001267550.2(TTN):c.32750C>T (p.Pro10917Leu) rs73973137
NM_001267550.2(TTN):c.32761G>C (p.Val10921Leu) rs775126784
NM_001267550.2(TTN):c.32780A>G (p.Lys10927Arg) rs373657520
NM_001267550.2(TTN):c.32781A>T (p.Lys10927Asn) rs1250259159
NM_001267550.2(TTN):c.32792A>C (p.Glu10931Ala) rs370498307
NM_001267550.2(TTN):c.32807-10T>A rs138192315
NM_001267550.2(TTN):c.32879C>A (p.Pro10960His) rs879029800
NM_001267550.2(TTN):c.32888-3C>A rs397517544
NM_001267550.2(TTN):c.32899A>G (p.Met10967Val) rs1392264858
NM_001267550.2(TTN):c.32930_32932AAG[2] (p.Glu10979del) rs774683936
NM_001267550.2(TTN):c.32953C>T (p.Arg10985Trp) rs201991864
NM_001267550.2(TTN):c.32954G>C (p.Arg10985Pro) rs181395238
NM_001267550.2(TTN):c.3295G>A (p.Val1099Met) rs368282893
NM_001267550.2(TTN):c.32970_32987del (p.10987_10989EEY[1]) rs766756026
NM_001267550.2(TTN):c.32971G>A (p.Glu10991Lys) rs201081803
NM_001267550.2(TTN):c.32974T>C (p.Tyr10992His) rs769393540
NM_001267550.2(TTN):c.32C>T (p.Pro11Leu) rs768624416
NM_001267550.2(TTN):c.33018A>G (p.Thr11006=) rs765492188
NM_001267550.2(TTN):c.33049G>A (p.Glu11017Lys) rs753930002
NM_001267550.2(TTN):c.33052C>T (p.Arg11018Trp) rs372118864
NM_001267550.2(TTN):c.33053G>A (p.Arg11018Gln) rs72650034
NM_001267550.2(TTN):c.33059A>G (p.Tyr11020Cys) rs72650035
NM_001267550.2(TTN):c.33063A>G (p.Glu11021=) rs115744476
NM_001267550.2(TTN):c.3309C>A (p.Cys1103Ter) rs1467686861
NM_001267550.2(TTN):c.330G>A (p.Leu110=) rs778271204
NM_001267550.2(TTN):c.33164C>T (p.Pro11055Leu) rs193051231
NM_001267550.2(TTN):c.3318C>T (p.Gly1106=) rs141768043
NM_001267550.2(TTN):c.3319G>A (p.Gly1107Ser) rs767741769
NM_001267550.2(TTN):c.33215T>G (p.Ile11072Ser) rs1553836426
NM_001267550.2(TTN):c.33305G>A (p.Arg11102His) rs368777046
NM_001267550.2(TTN):c.33331G>A (p.Ala11111Thr) rs545067681
NM_001267550.2(TTN):c.33339A>G (p.Lys11113=) rs926306750
NM_001267550.2(TTN):c.33340G>T (p.Val11114Leu) rs1328375389
NM_001267550.2(TTN):c.33344C>A (p.Pro11115His) rs1060500394
NM_001267550.2(TTN):c.33366C>T (p.Val11122=) rs878915517
NM_001267550.2(TTN):c.33367G>A (p.Ala11123Thr) rs200321239
NM_001267550.2(TTN):c.33377A>C (p.Lys11126Thr) rs760742068
NM_001267550.2(TTN):c.33416G>C (p.Arg11139Thr) rs72650040
NM_001267550.2(TTN):c.33445C>T (p.Pro11149Ser) rs377760800
NM_001267550.2(TTN):c.33501_33503AGA[6] (p.Glu11172dup) rs368327166
NM_001267550.2(TTN):c.33561G>T (p.Val11187=) rs763629416
NM_001267550.2(TTN):c.33581-8C>G rs888213772
NM_001267550.2(TTN):c.33601C>A (p.Pro11201Thr) rs769195017
NM_001267550.2(TTN):c.33656C>T (p.Pro11219Leu) rs757268986
NM_001267550.2(TTN):c.33657G>A (p.Pro11219=) rs754038093
NM_001267550.2(TTN):c.33664+6C>G rs1060500524
NM_001267550.2(TTN):c.3368C>G (p.Thr1123Ser) rs773799748
NM_001267550.2(TTN):c.33732G>A (p.Pro11244=) rs190604150
NM_001267550.2(TTN):c.33742+1G>T rs772114165
NM_001267550.2(TTN):c.33753G>A (p.Val11251=) rs1366489829
NM_001267550.2(TTN):c.33775G>A (p.Glu11259Lys) rs1060500563
NM_001267550.2(TTN):c.33788T>C (p.Val11263Ala) rs748148683
NM_001267550.2(TTN):c.33796C>T (p.Pro11266Ser) rs201120871
NM_001267550.2(TTN):c.337A>G (p.Met113Val) rs1060500430
NM_001267550.2(TTN):c.33838C>T (p.Pro11280Ser) rs374449452
NM_001267550.2(TTN):c.33856G>A (p.Glu11286Lys) rs376874956
NM_001267550.2(TTN):c.3386A>G (p.Lys1129Arg) rs181375012
NM_001267550.2(TTN):c.33894G>A (p.Glu11298=) rs760806455
NM_001267550.2(TTN):c.33911-7T>C rs397517545
NM_001267550.2(TTN):c.33961G>A (p.Val11321Ile) rs878854298
NM_001267550.2(TTN):c.33966G>A (p.Pro11322=) rs373083865
NM_001267550.2(TTN):c.33995-5T>C rs774359312
NM_001267550.2(TTN):c.33G>A (p.Pro11=) rs138331646
NM_001267550.2(TTN):c.34006C>T (p.Arg11336Cys) rs763380355
NM_001267550.2(TTN):c.34026T>C (p.Pro11342=) rs775256061
NM_001267550.2(TTN):c.34027G>A (p.Val11343Ile) rs369025108
NM_001267550.2(TTN):c.34038T>G (p.Pro11346=) rs375714279
NM_001267550.2(TTN):c.34075C>G (p.Pro11359Ala) rs1060500464
NM_001267550.2(TTN):c.34093_34102del (p.Pro11365fs) rs1553823547
NM_001267550.2(TTN):c.34098_34118GGAAGAGGAAGTTCTACCTGA[1] (p.11363_11369VLPEEEE[3]) rs397517548
NM_001267550.2(TTN):c.34098_34118GGAAGAGGAAGTTCTACCTGA[3] (p.11363_11369VLPEEEE[5]) rs397517548
NM_001267550.2(TTN):c.34098_34118GGAAGAGGAAGTTCTACCTGA[4] (p.11363_11369VLPEEEE[6]) rs397517548
NM_001267550.2(TTN):c.3409G>C (p.Gly1137Arg) rs72647870
NM_001267550.2(TTN):c.34108G>A (p.Val11370Ile) rs1060500545
NM_001267550.2(TTN):c.34129_34149GTTCTACCTGAAGAAGAGGAA[1] (p.11363_11369VLPEEEE[3]) rs587780487
NM_001267550.2(TTN):c.34132C>T (p.Leu11378=) rs960128787
NM_001267550.2(TTN):c.34134A>G (p.Leu11378=) rs575740245
NM_001267550.2(TTN):c.34140A>G (p.Glu11380=) rs147418835
NM_001267550.2(TTN):c.34200C>T (p.Pro11400=) rs750587024
NM_001267550.2(TTN):c.34201G>A (p.Glu11401Lys) rs765827814
NM_001267550.2(TTN):c.34216C>A (p.Pro11406Thr) rs532102837
NM_001267550.2(TTN):c.34225G>A (p.Glu11409Lys) rs770657053
NM_001267550.2(TTN):c.34238C>G (p.Pro11413Arg) rs769658955
NM_001267550.2(TTN):c.34240G>A (p.Glu11414Lys) rs748080418
NM_001267550.2(TTN):c.34241_34243AAG[2] (p.Glu11416del) rs397517549
NM_001267550.2(TTN):c.34247_34248delinsTC (p.Glu11416Val) rs1060500408
NM_001267550.2(TTN):c.34251C>G (p.Val11417=) rs368972294
NM_001267550.2(TTN):c.34253_34277del (p.Leu11418fs) rs1373610867
NM_001267550.2(TTN):c.34294C>T (p.Pro11432Ser) rs534339525
NM_001267550.2(TTN):c.34307A>G (p.Lys11436Arg) rs568554504
NM_001267550.2(TTN):c.34314T>C (p.Pro11438=) rs993206696
NM_001267550.2(TTN):c.34341C>T (p.Pro11447=) rs369715093
NM_001267550.2(TTN):c.34354G>A (p.Val11452Met) rs938988662
NM_001267550.2(TTN):c.34379-3A>T rs1060500497
NM_001267550.2(TTN):c.34400T>C (p.Val11467Ala) rs981211046
NM_001267550.2(TTN):c.34402_34416del (p.Thr11468_Val11472del) rs754236839
NM_001267550.2(TTN):c.34474C>A (p.Pro11492Thr) rs182428755
NM_001267550.2(TTN):c.34486A>G (p.Lys11496Glu) rs1034048129
NM_001267550.2(TTN):c.34505G>T (p.Gly11502Val) rs190209925
NM_001267550.2(TTN):c.34537+3A>G rs1427570685
NM_001267550.2(TTN):c.34566A>C (p.Glu11522Asp) rs140640738
NM_001267550.2(TTN):c.34570C>T (p.Arg11524Ter) rs1441434215
NM_001267550.2(TTN):c.34571G>A (p.Arg11524Gln) rs201622536
NM_001267550.2(TTN):c.34583C>T (p.Pro11528Leu) rs1553815977
NM_001267550.2(TTN):c.34592A>G (p.Glu11531Gly) rs1553815943
NM_001267550.2(TTN):c.34601T>C (p.Leu11534Pro) rs376836503
NM_001267550.2(TTN):c.34612+2T>C
NM_001267550.2(TTN):c.34623G>A (p.Glu11541=) rs1553814697
NM_001267550.2(TTN):c.34660_34662GAA[1] (p.Glu11555del) rs763098227
NM_001267550.2(TTN):c.34670C>T (p.Pro11557Leu) rs887706962
NM_001267550.2(TTN):c.34684G>A (p.Val11562Ile) rs1060500397
NM_001267550.2(TTN):c.34695G>A (p.Val11565=) rs372341590
NM_001267550.2(TTN):c.34708+8C>T rs762808097
NM_001267550.2(TTN):c.34709-1G>A rs727503634
NM_001267550.2(TTN):c.34735C>T (p.Pro11579Ser) rs754511830
NM_001267550.2(TTN):c.34742C>T (p.Ala11581Val) rs1060500436
NM_001267550.2(TTN):c.34769A>G (p.Glu11590Gly) rs201167067
NM_001267550.2(TTN):c.3476G>A (p.Arg1159His) rs149883066
NM_001267550.2(TTN):c.34772C>T (p.Ala11591Val) rs72650052
NM_001267550.2(TTN):c.34816C>T (p.Pro11606Ser) rs1553810609
NM_001267550.2(TTN):c.34823C>T (p.Pro11608Leu) rs1553810583
NM_001267550.2(TTN):c.34826T>C (p.Val11609Ala) rs767524348
NM_001267550.2(TTN):c.34845C>T (p.Pro11615=) rs368781863
NM_001267550.2(TTN):c.34855G>A (p.Val11619Met) rs1560262245
NM_001267550.2(TTN):c.34864G>A (p.Val11622Ile) rs202014478
NM_001267550.2(TTN):c.34931-10G>A rs1553809647
NM_001267550.2(TTN):c.34952A>C (p.Lys11651Thr) rs373656002
NM_001267550.2(TTN):c.34954G>T (p.Val11652Leu) rs371752190
NM_001267550.2(TTN):c.34969C>T (p.Arg11657Cys) rs1187808745
NM_001267550.2(TTN):c.34970G>A (p.Arg11657His) rs59887778
NM_001267550.2(TTN):c.34979T>C (p.Val11660Ala) rs1553809428
NM_001267550.2(TTN):c.34982T>C (p.Val11661Ala) rs199561793
NM_001267550.2(TTN):c.35037G>A (p.Pro11679=) rs369095270
NM_001267550.2(TTN):c.35079A>G (p.Glu11693=) rs779550415
NM_001267550.2(TTN):c.35082C>T (p.Gly11694=) rs377761863
NM_001267550.2(TTN):c.35104T>G (p.Phe11702Val) rs1553809123
NM_001267550.2(TTN):c.35124T>C (p.His11708=) rs1553809060
NM_001267550.2(TTN):c.35155G>T (p.Val11719Phe) rs754098075
NM_001267550.2(TTN):c.35156T>C (p.Val11719Ala) rs754536506
NM_001267550.2(TTN):c.35194G>A (p.Glu11732Lys) rs939014361
NM_001267550.2(TTN):c.3523G>A (p.Ala1175Thr) rs397517570
NM_001267550.2(TTN):c.35264A>C (p.Lys11755Thr) rs189966800
NM_001267550.2(TTN):c.35265A>G (p.Lys11755=) rs774526152
NM_001267550.2(TTN):c.35291A>G (p.Lys11764Arg) rs1060500446
NM_001267550.2(TTN):c.35293G>C (p.Glu11765Gln) rs1060500577
NM_001267550.2(TTN):c.35294A>G (p.Glu11765Gly) rs1319484684
NM_001267550.2(TTN):c.35312C>T (p.Pro11771Leu) rs373508919
NM_001267550.2(TTN):c.35319G>A (p.Val11773=) rs879029141
NM_001267550.2(TTN):c.35330T>C (p.Ile11777Thr) rs1393138345
NM_001267550.2(TTN):c.35384A>C (p.Lys11795Thr) rs890825956
NM_001267550.2(TTN):c.35387C>A (p.Ala11796Glu) rs200321949
NM_001267550.2(TTN):c.35470+4T>C rs1389073196
NM_001267550.2(TTN):c.35471-9T>C rs746940707
NM_001267550.2(TTN):c.35493T>C (p.Ser11831=) rs1553803616
NM_001267550.2(TTN):c.35584G>C (p.Val11862Leu) rs1553800435
NM_001267550.2(TTN):c.35629+3A>G rs751928755
NM_001267550.2(TTN):c.35662G>A (p.Asp11888Asn) rs1356416507
NM_001267550.2(TTN):c.35678C>G (p.Thr11893Ser) rs750832804
NM_001267550.2(TTN):c.35693G>A (p.Arg11898Lys) rs1553799769
NM_001267550.2(TTN):c.35717C>G (p.Pro11906Arg) rs781317174
NM_001267550.2(TTN):c.35794G>T (p.Glu11932Ter) rs878854299
NM_001267550.2(TTN):c.35797+1G>T rs917175304
NM_001267550.2(TTN):c.35797G>A (p.Glu11933Lys)
NM_001267550.2(TTN):c.35797G>C (p.Glu11933Gln) rs769110483
NM_001267550.2(TTN):c.35828dup (p.Glu11945Argfs) rs765879488
NM_001267550.2(TTN):c.35875+8T>G rs192408585
NM_001267550.2(TTN):c.35876-9T>C rs572783607
NM_001267550.2(TTN):c.35890C>T (p.Arg11964Ter) rs1266298136
NM_001267550.2(TTN):c.35897T>G (p.Ile11966Ser) rs1553796799
NM_001267550.2(TTN):c.35924C>A (p.Ala11975Asp) rs182102510
NM_001267550.2(TTN):c.35939T>C (p.Ile11980Thr) rs927982415
NM_001267550.2(TTN):c.35959+5C>T rs758684276
NM_001267550.2(TTN):c.35972T>C (p.Met11991Thr) rs1553796242
NM_001267550.2(TTN):c.36035G>A (p.Arg12012His) rs576436744
NM_001267550.2(TTN):c.36043+4C>T rs370368656
NM_001267550.2(TTN):c.36043+6T>C rs765412168
NM_001267550.2(TTN):c.36044C>G (p.Thr12015Arg) rs199868380
NM_001267550.2(TTN):c.3605T>C (p.Val1202Ala) rs150667217
NM_001267550.2(TTN):c.3608G>C (p.Gly1203Ala) rs564353179
NM_001267550.2(TTN):c.3611A>C (p.Glu1204Ala) rs779302369
NM_001267550.2(TTN):c.36126A>C (p.Glu12042Asp) rs113231696
NM_001267550.2(TTN):c.36158C>T (p.Thr12053Met) rs761169549
NM_001267550.2(TTN):c.36159G>A (p.Thr12053=) rs773862719
NM_001267550.2(TTN):c.3616G>T (p.Ala1206Ser) rs200749662
NM_001267550.2(TTN):c.36170C>A (p.Pro12057His) rs374834199
NM_001267550.2(TTN):c.3619C>A (p.Pro1207Thr) rs373753003
NM_001267550.2(TTN):c.36202+10G>T rs765321861
NM_001267550.2(TTN):c.36203-9T>C rs2562849
NM_001267550.2(TTN):c.36227T>C (p.Val12076Ala) rs772990799
NM_001267550.2(TTN):c.36254A>G (p.Gln12085Arg) rs183220684
NM_001267550.2(TTN):c.36281-9T>C rs760175676
NM_001267550.2(TTN):c.36285C>T (p.His12095=) rs201184203
NM_001267550.2(TTN):c.36299A>T (p.Glu12100Val) rs73973133
NM_001267550.2(TTN):c.36310G>T (p.Glu12104Ter) rs1455879402
NM_001267550.2(TTN):c.36318A>G (p.Lys12106=) rs2115557
NM_001267550.2(TTN):c.36322T>A (p.Ser12108Thr) rs989137248
NM_001267550.2(TTN):c.36342G>C (p.Lys12114Asn) rs766280406
NM_001267550.2(TTN):c.36347A>G (p.Glu12116Gly) rs200513156
NM_001267550.2(TTN):c.36364+6dup rs949125365
NM_001267550.2(TTN):c.36365-7T>C rs746341489
NM_001267550.2(TTN):c.3637G>C (p.Glu1213Gln) rs1043395012
NM_001267550.2(TTN):c.36391C>T (p.Arg12131Cys) rs368607833
NM_001267550.2(TTN):c.36405G>A (p.Val12135=) rs373815877
NM_001267550.2(TTN):c.36427C>T (p.Pro12143Ser) rs779794774
NM_001267550.2(TTN):c.36448G>T (p.Val12150Leu) rs371317962
NM_001267550.2(TTN):c.36461C>G (p.Pro12154Arg) rs371580084
NM_001267550.2(TTN):c.36489G>A (p.Ala12163=) rs115493456
NM_001267550.2(TTN):c.36490C>A (p.Pro12164Thr) rs373422655
NM_001267550.2(TTN):c.36499C>T (p.Pro12167Ser) rs780323492
NM_001267550.2(TTN):c.36509A>T (p.Glu12170Val) rs200840285
NM_001267550.2(TTN):c.36520C>A (p.Pro12174Thr) rs762482452
NM_001267550.2(TTN):c.36568A>G (p.Lys12190Glu) rs749339946
NM_001267550.2(TTN):c.36617-5T>A rs771059357
NM_001267550.2(TTN):c.36618C>T (p.Val12206=) rs777734136
NM_001267550.2(TTN):c.36625G>T (p.Val12209Leu) rs72650053
NM_001267550.2(TTN):c.36644C>T (p.Pro12215Leu) rs367720476
NM_001267550.2(TTN):c.36655T>G (p.Leu12219Val) rs12994774
NM_001267550.2(TTN):c.36676A>G (p.Lys12226Glu) rs200815663
NM_001267550.2(TTN):c.36680C>T (p.Pro12227Leu) rs767455362
NM_001267550.2(TTN):c.36685A>G (p.Ser12229Gly) rs1060500531
NM_001267550.2(TTN):c.3668C>T (p.Ala1223Val) rs78269740
NM_001267550.2(TTN):c.36696del (p.Glu12233fs) rs1060500458
NM_001267550.2(TTN):c.36701-6T>G rs1060500422
NM_001267550.2(TTN):c.36701-9T>G rs1060500427
NM_001267550.2(TTN):c.36708A>T (p.Glu12236Asp) rs796478043
NM_001267550.2(TTN):c.36737A>T (p.Glu12246Val) rs786205395
NM_001267550.2(TTN):c.36750G>A (p.Pro12250=) rs777458053
NM_001267550.2(TTN):c.36753G>A (p.Val12251=) rs1553788597
NM_001267550.2(TTN):c.36802C>G (p.Pro12268Ala) rs1461810893
NM_001267550.2(TTN):c.36803C>G (p.Pro12268Arg) rs997014833
NM_001267550.2(TTN):c.36810A>G (p.Glu12270=) rs900028908
NM_001267550.2(TTN):c.36816A>T (p.Val12272=) rs1466177296
NM_001267550.2(TTN):c.36830C>T (p.Ala12277Val) rs878854300
NM_001267550.2(TTN):c.36847A>C (p.Lys12283Gln) rs1479390801
NM_001267550.2(TTN):c.36855G>A (p.Pro12285=) rs535294541
NM_001267550.2(TTN):c.36865C>A (p.Arg12289Ser) rs1480219250
NM_001267550.2(TTN):c.36952G>A (p.Val12318Ile) rs762149243
NM_001267550.2(TTN):c.36958+9C>T rs1060503964
NM_001267550.2(TTN):c.36982A>G (p.Thr12328Ala) rs146313925
NM_001267550.2(TTN):c.37009C>T (p.Pro12337Ser) rs201474544
NM_001267550.2(TTN):c.37019C>T (p.Pro12340Leu) rs778829839
NM_001267550.2(TTN):c.3701T>C (p.Val1234Ala) rs1060500401
NM_001267550.2(TTN):c.37029A>G (p.Pro12343=) rs200163049
NM_001267550.2(TTN):c.37099C>G (p.Pro12367Ala) rs973940125
NM_001267550.2(TTN):c.37193C>T (p.Pro12398Leu) rs570730533
NM_001267550.2(TTN):c.37202-4T>C rs202032281
NM_001267550.2(TTN):c.37202-9T>C rs771757256
NM_001267550.2(TTN):c.37208A>C (p.Glu12403Ala) rs878854301
NM_001267550.2(TTN):c.37222G>A (p.Val12408Ile) rs1553786445
NM_001267550.2(TTN):c.37247C>T (p.Ser12416Leu) rs370765948
NM_001267550.2(TTN):c.37248G>A (p.Ser12416=) rs201654513
NM_001267550.2(TTN):c.37373C>T (p.Pro12458Leu) rs1553782191
NM_001267550.2(TTN):c.37397C>T (p.Pro12466Leu) rs727503632
NM_001267550.2(TTN):c.37408G>T (p.Val12470Leu) rs398124448
NM_001267550.2(TTN):c.37421T>C (p.Ile12474Thr) rs72650057
NM_001267550.2(TTN):c.37432C>T (p.Pro12478Ser) rs200992277
NM_001267550.2(TTN):c.37447C>G (p.Pro12483Ala) rs1060500552
NM_001267550.2(TTN):c.37461A>T (p.Glu12487Asp) rs200021871
NM_001267550.2(TTN):c.37473G>C (p.Pro12491=) rs556414069
NM_001267550.2(TTN):c.37477G>A (p.Glu12493Lys) rs1426948805
NM_001267550.2(TTN):c.37489G>A (p.Glu12497Lys) rs1553781387
NM_001267550.2(TTN):c.37496A>C (p.Lys12499Thr) rs1367017667
NM_001267550.2(TTN):c.37502C>T (p.Pro12501Leu) rs1236045684
NM_001267550.2(TTN):c.37525G>A (p.Glu12509Lys) rs201797790
NM_001267550.2(TTN):c.37543+1G>A rs1374931889
NM_001267550.2(TTN):c.37543+5G>T rs570767771
NM_001267550.2(TTN):c.37576A>T (p.Lys12526Ter) rs1560149950
NM_001267550.2(TTN):c.37616_37627+12delCACGTGCAAAAGGTATTTATTCCC rs1560149416
NM_001267550.2(TTN):c.37651G>A (p.Val12551Ile) rs1437747405
NM_001267550.2(TTN):c.37683C>A (p.Ile12561=) rs1553780447
NM_001267550.2(TTN):c.37702G>A (p.Ala12568Thr) rs1060500468
NM_001267550.2(TTN):c.37705G>A (p.Val12569Ile) rs568086259
NM_001267550.2(TTN):c.37711G>A (p.Val12571Met)
NM_001267550.2(TTN):c.37722T>C (p.Val12574=) rs377422414
NM_001267550.2(TTN):c.37734C>T (p.Ala12578=) rs1280095100
NM_001267550.2(TTN):c.37758T>A (p.Ala12586=) rs1308714314
NM_001267550.2(TTN):c.37788C>T (p.Val12596=) rs1060503943
NM_001267550.2(TTN):c.37793-12_37793-10delATA rs770966939
NM_001267550.2(TTN):c.37860C>T (p.Ala12620=) rs1446730289
NM_001267550.2(TTN):c.37873+9T>A rs1060503931
NM_001267550.2(TTN):c.37903G>C (p.Glu12635Gln) rs749935074
NM_001267550.2(TTN):c.37949T>C (p.Val12650Ala) rs1553779318
NM_001267550.2(TTN):c.37956G>T (p.Val12652=) rs541757326
NM_001267550.2(TTN):c.37996C>A (p.Pro12666Thr) rs201684070
NM_001267550.2(TTN):c.38000C>A (p.Ser12667Ter)
NM_001267550.2(TTN):c.38001G>A (p.Ser12667=) rs201179474
NM_001267550.2(TTN):c.38002A>G (p.Thr12668Ala) rs1168512202
NM_001267550.2(TTN):c.38031T>C (p.Pro12677=) rs1060503972
NM_001267550.2(TTN):c.38042C>T (p.Pro12681Leu) rs1553777756
NM_001267550.2(TTN):c.38088T>G (p.Pro12696=) rs1553777636
NM_001267550.2(TTN):c.38101C>T (p.Pro12701Ser) rs1284117197
NM_001267550.2(TTN):c.38123-8C>A rs1481421931
NM_001267550.2(TTN):c.38147T>A (p.Val12716Asp) rs1553777417
NM_001267550.2(TTN):c.38161G>T (p.Val12721Leu) rs794729416
NM_001267550.2(TTN):c.38226G>T (p.Pro12742=) rs965565085
NM_001267550.2(TTN):c.38230G>A (p.Glu12744Lys) rs1553777033
NM_001267550.2(TTN):c.38249A>C (p.Lys12750Thr) rs1337231554
NM_001267550.2(TTN):c.38275C>G (p.Pro12759Ala) rs1162101042
NM_001267550.2(TTN):c.38311A>G (p.Lys12771Glu) rs551811137
NM_001267550.2(TTN):c.38316A>C (p.Glu12772Asp) rs1195550297
NM_001267550.2(TTN):c.38321T>C (p.Val12774Ala) rs747414237
NM_001267550.2(TTN):c.38323C>T (p.Leu12775Phe) rs186232617
NM_001267550.2(TTN):c.38336T>C (p.Val12779Ala) rs2099130
NM_001267550.2(TTN):c.38353A>G (p.Lys12785Glu) rs864622709
NM_001267550.2(TTN):c.38372G>C (p.Arg12791Pro) rs1237577240
NM_001267550.2(TTN):c.38378A>G (p.Lys12793Arg) rs189389531
NM_001267550.2(TTN):c.38424del (p.Lys12809fs) rs1553775991
NM_001267550.2(TTN):c.38465-5T>A rs906108078
NM_001267550.2(TTN):c.38465-8C>A rs937031915
NM_001267550.2(TTN):c.38505C>T (p.Pro12835=) rs745664297
NM_001267550.2(TTN):c.38519A>G (p.Lys12840Arg) rs1250144035
NM_001267550.2(TTN):c.38546-2delA rs1486772794
NM_001267550.2(TTN):c.38598C>T (p.Pro12866=) rs1553775431
NM_001267550.2(TTN):c.38626+9dup rs1260372587
NM_001267550.2(TTN):c.38660del (p.Lys12887fs) rs761617432
NM_001267550.2(TTN):c.38681A>G (p.Lys12894Arg) rs574694398
NM_001267550.2(TTN):c.38707+7G>T rs752801232
NM_001267550.2(TTN):c.38723_38725AAG[1] (p.Glu12909del) rs1060500390
NM_001267550.2(TTN):c.38739A>G (p.Glu12913=) rs759128215
NM_001267550.2(TTN):c.38753T>C (p.Leu12918Ser) rs2562847
NM_001267550.2(TTN):c.38783C>G (p.Pro12928Arg) rs752337495
NM_001267550.2(TTN):c.38876-8C>T rs1060503949
NM_001267550.2(TTN):c.38879_38880inv (p.Pro12960Leu)
NM_001267550.2(TTN):c.38880A>G (p.Pro12960=) rs2742354
NM_001267550.2(TTN):c.38898T>A (p.Val12966=) rs200432936
NM_001267550.2(TTN):c.38902C>T (p.Pro12968Ser) rs192528655
NM_001267550.2(TTN):c.38915T>C (p.Met12972Thr) rs1060500540
NM_001267550.2(TTN):c.38929C>T (p.Pro12977Ser) rs150223722
NM_001267550.2(TTN):c.38955T>G (p.Val12985=) rs375699886
NM_001267550.2(TTN):c.38959+8T>G rs769254204
NM_001267550.2(TTN):c.39001C>A (p.Pro13001Thr) rs878854302
NM_001267550.2(TTN):c.39006G>T (p.Ser13002=) rs548745743
NM_001267550.2(TTN):c.39044-9T>A rs184888200
NM_001267550.2(TTN):c.39045G>C (p.Val13015=) rs192464868
NM_001267550.2(TTN):c.39050A>G (p.Glu13017Gly) rs368056479
NM_001267550.2(TTN):c.39056C>T (p.Pro13019Leu) rs763845436
NM_001267550.2(TTN):c.39057G>A (p.Pro13019=) rs371945519
NM_001267550.2(TTN):c.39057G>C (p.Pro13019=) rs371945519
NM_001267550.2(TTN):c.39059_39061AAG[1] (p.Glu13021del) rs1298186498
NM_001267550.2(TTN):c.39064G>A (p.Val13022Ile) rs767090806
NM_001267550.2(TTN):c.39067G>T (p.Val13023Phe) rs774402932
NM_001267550.2(TTN):c.39082G>A (p.Val13028Met) rs73038314
NM_001267550.2(TTN):c.39085C>A (p.Pro13029Thr) rs397517553
NM_001267550.2(TTN):c.39089C>T (p.Ala13030Val) rs747459623
NM_001267550.2(TTN):c.39090G>A (p.Ala13030=) rs375519815
NM_001267550.2(TTN):c.39099T>C (p.Pro13033=) rs755793186
NM_001267550.2(TTN):c.39115A>C (p.Thr13039Pro) rs766921440
NM_001267550.2(TTN):c.39183T>A (p.Pro13061=) rs12474306
NM_001267550.2(TTN):c.39201_39203dup (p.Pro13068dup) rs748388695
NM_001267550.2(TTN):c.39204del (p.Thr13069fs) rs1560106851
NM_001267550.2(TTN):c.39212-9C>A rs373056460
NM_001267550.2(TTN):c.39219G>A (p.Glu13073=) rs777607934
NM_001267550.2(TTN):c.39235G>A (p.Val13079Ile) rs777119867
NM_001267550.2(TTN):c.39237C>A (p.Val13079=) rs1044693629
NM_001267550.2(TTN):c.39250G>T (p.Val13084Leu) rs72650062
NM_001267550.2(TTN):c.39276G>A (p.Pro13092=) rs369002632
NM_001267550.2(TTN):c.39289C>A (p.Pro13097Thr) rs370157162
NM_001267550.2(TTN):c.39301G>A (p.Glu13101Lys) rs201035457
NM_001267550.2(TTN):c.39374_39376del (p.Pro13125del) rs1292233616
NM_001267550.2(TTN):c.39389C>T (p.Pro13130Leu) rs370520319
NM_001267550.2(TTN):c.39396G>A (p.Lys13132=) rs1553770142
NM_001267550.2(TTN):c.39407C>T (p.Pro13136Leu) rs1060500460
NM_001267550.2(TTN):c.39418G>A (p.Ala13140Thr) rs781407045
NM_001267550.2(TTN):c.39427G>A (p.Val13143Ile) rs375956503
NM_001267550.2(TTN):c.39430G>A (p.Val13144Ile) rs374394719
NM_001267550.2(TTN):c.39466C>A (p.Pro13156Thr) rs72650064
NM_001267550.2(TTN):c.39469G>A (p.Glu13157Lys) rs761974767
NM_001267550.2(TTN):c.39493G>A (p.Glu13165Lys) rs747566528
NM_001267550.2(TTN):c.39511G>A (p.Val13171Met) rs780550944
NM_001267550.2(TTN):c.39525G>C (p.Lys13175Asn) rs1060500515
NM_001267550.2(TTN):c.39563_39565AAG[1] (p.Glu13189del) rs1553769206
NM_001267550.2(TTN):c.39578A>G (p.Glu13193Gly) rs190461403
NM_001267550.2(TTN):c.39606A>G (p.Pro13202=) rs372356060
NM_001267550.2(TTN):c.39616C>T (p.Pro13206Ser) rs186404793
NM_001267550.2(TTN):c.39626-4A>G rs559564145
NM_001267550.2(TTN):c.39673C>T (p.Pro13225Ser) rs202240398
NM_001267550.2(TTN):c.39689C>T (p.Ala13230Val) rs148140756
NM_001267550.2(TTN):c.39690G>A (p.Ala13230=) rs528832388
NM_001267550.2(TTN):c.39704C>G (p.Pro13235Arg) rs72650066
NM_001267550.2(TTN):c.39709+4C>T rs1553768226
NM_001267550.2(TTN):c.39709+7G>A rs750763722
NM_001267550.2(TTN):c.39731_39748TTGCTCCTGAAGAGGAAA[1] (p.13244_13249IAPEEE[1]) rs139512154
NM_001267550.2(TTN):c.39743A>T (p.Glu13248Val) rs1224909860
NM_001267550.2(TTN):c.39786A>G (p.Glu13262=) rs398124450
NM_001267550.2(TTN):c.39802G>T (p.Val13268Phe) rs759268958
NM_001267550.2(TTN):c.39813A>G (p.Pro13271=) rs373429851
NM_001267550.2(TTN):c.39818-9T>C rs368834130
NM_001267550.2(TTN):c.39819_39820delinsTT (p.Pro13274Ser) rs727503630
NM_001267550.2(TTN):c.39851A>G (p.Lys13284Arg) rs768562722
NM_001267550.2(TTN):c.39862G>C (p.Val13288Leu) rs878854303
NM_001267550.2(TTN):c.39883C>A (p.Pro13295Thr) rs749860520
NM_001267550.2(TTN):c.39885G>A (p.Pro13295=) rs756518824
NM_001267550.2(TTN):c.39887C>G (p.Pro13296Arg) rs760464072
NM_001267550.2(TTN):c.39895+1G>C rs749931280
NM_001267550.2(TTN):c.39895+1G>T rs749931280
NM_001267550.2(TTN):c.39895G>T (p.Glu13299Ter)
NM_001267550.2(TTN):c.39919G>T (p.Val13307Phe) rs553280930
NM_001267550.2(TTN):c.39928A>C (p.Lys13310Gln) rs1317959875
NM_001267550.2(TTN):c.39936C>T (p.Val13312=) rs1259485774
NM_001267550.2(TTN):c.39941C>A (p.Thr13314Asn) rs543338451
NM_001267550.2(TTN):c.39943G>C (p.Val13315Leu) rs1553766447
NM_001267550.2(TTN):c.39995T>G (p.Leu13332Arg) rs1424568997
NM_001267550.2(TTN):c.40017T>C (p.Pro13339=) rs1553766018
NM_001267550.2(TTN):c.40109T>C (p.Ile13370Thr) rs904655100
NM_001267550.2(TTN):c.40123G>A (p.Glu13375Lys) rs988844595
NM_001267550.2(TTN):c.40126G>A (p.Val13376Ile) rs1060500428
NM_001267550.2(TTN):c.40141+6C>A rs750448649
NM_001267550.2(TTN):c.40141+6C>T rs750448649
NM_001267550.2(TTN):c.40141+7G>A rs77960621
NM_001267550.2(TTN):c.40222+6T>C rs1182693405
NM_001267550.2(TTN):c.40223A>G (p.Glu13408Gly) rs183950862
NM_001267550.2(TTN):c.40225C>T (p.Arg13409Cys) rs769146381
NM_001267550.2(TTN):c.40227T>C (p.Arg13409=) rs3754951
NM_001267550.2(TTN):c.40250C>T (p.Pro13417Leu) rs537578226
NM_001267550.2(TTN):c.40297+8A>G rs192127273
NM_001267550.2(TTN):c.40316T>C (p.Val13439Ala) rs1553761103
NM_001267550.2(TTN):c.40335C>T (p.Leu13445=) rs727504696
NM_001267550.2(TTN):c.40349C>T (p.Pro13450Leu) rs372424006
NM_001267550.2(TTN):c.40352C>A (p.Pro13451His) rs370048456
NM_001267550.2(TTN):c.40395A>G (p.Ile13465Met) rs766145596
NM_001267550.2(TTN):c.40408+8del rs727504922
NM_001267550.2(TTN):c.40409-2A>C rs1560046529
NM_001267550.2(TTN):c.40409-8C>A rs1351493193
NM_001267550.2(TTN):c.40498G>T (p.Val13500Phe) rs201944202
NM_001267550.2(TTN):c.40511T>G (p.Leu13504Arg) rs776115575
NM_001267550.2(TTN):c.40515G>A (p.Pro13505=) rs367958537
NM_001267550.2(TTN):c.40558+4T>C rs398124451
NM_001267550.2(TTN):c.40558G>C (p.Val13520Leu) rs587780488
NM_001267550.2(TTN):c.40576_40578GAA[3] (p.Glu13529del) rs727504199
NM_001267550.2(TTN):c.40581A>G (p.Glu13527=) rs775954427
NM_001267550.2(TTN):c.40587A>G (p.Glu13529=) rs370597107
NM_001267550.2(TTN):c.40595T>G (p.Val13532Gly) rs756446770
NM_001267550.2(TTN):c.40636C>A (p.Pro13546Thr) rs1393076582
NM_001267550.2(TTN):c.40650T>C (p.Pro13550=) rs1553754047
NM_001267550.2(TTN):c.40666G>A (p.Glu13556Lys) rs781066709
NM_001267550.2(TTN):c.40690A>G (p.Lys13564Glu) rs758942655
NM_001267550.2(TTN):c.40701G>A (p.Arg13567=) rs750761966
NM_001267550.2(TTN):c.40712A>T (p.Glu13571Val) rs1190002260
NM_001267550.2(TTN):c.40723+1del rs876658058
NM_001267550.2(TTN):c.40760_40787-52del rs1553752889
NM_001267550.2(TTN):c.40766C>T (p.Pro13589Leu) rs200939270
NM_001267550.2(TTN):c.40773A>G (p.Pro13591=) rs368521608
NM_001267550.2(TTN):c.40796C>T (p.Thr13599Ile) rs370418677
NM_001267550.2(TTN):c.40812T>C (p.Pro13604=) rs879235662
NM_001267550.2(TTN):c.40869G>A (p.Lys13623=) rs1553752615
NM_001267550.2(TTN):c.40877-3C>A rs746615904
NM_001267550.2(TTN):c.40879G>A (p.Ala13627Thr) rs1060500548
NM_001267550.2(TTN):c.40903G>A (p.Ala13635Thr) rs191699632
NM_001267550.2(TTN):c.40927+1G>A rs1553749862
NM_001267550.2(TTN):c.40929T>C (p.Gly13643=) rs773615100
NM_001267550.2(TTN):c.40946C>T (p.Pro13649Leu) rs771839127
NM_001267550.2(TTN):c.40963G>T (p.Glu13655Ter) rs727504198
NM_001267550.2(TTN):c.40973A>G (p.Lys13658Arg) rs184713215
NM_001267550.2(TTN):c.40988G>A (p.Ser13663Asn) rs1060500537
NM_001267550.2(TTN):c.41010T>C (p.Asp13670=) rs193191368
NM_001267550.2(TTN):c.41018C>T (p.Pro13673Leu) rs765821223
NM_001267550.2(TTN):c.41019G>A (p.Pro13673=) rs762470432
NM_001267550.2(TTN):c.41097C>T (p.Phe13699=) rs377131448
NM_001267550.2(TTN):c.41103C>T (p.Gly13701=) rs72650077
NM_001267550.2(TTN):c.41104T>C (p.Ser13702Pro) rs72650078
NM_001267550.2(TTN):c.41118del (p.Phe13706fs) rs878854305
NM_001267550.2(TTN):c.41146A>G (p.Ile13716Val) rs531807386
NM_001267550.2(TTN):c.41149A>C (p.Thr13717Pro) rs1553747949
NM_001267550.2(TTN):c.41152A>T (p.Thr13718Ser) rs562561380
NM_001267550.2(TTN):c.41180G>A (p.Arg13727His) rs750520224
NM_001267550.2(TTN):c.41222_41223del (p.Arg13741fs) rs1436937190
NM_001267550.2(TTN):c.41254G>A (p.Asp13752Asn) rs1349773180
NM_001267550.2(TTN):c.41273_41274GT[1] (p.Val13759fs)
NM_001267550.2(TTN):c.41309C>T (p.Thr13770Met) rs774214497
NM_001267550.2(TTN):c.41310G>A (p.Thr13770=) rs556498170
NM_001267550.2(TTN):c.41329+9T>C rs779075177
NM_001267550.2(TTN):c.41342G>A (p.Arg13781His) rs370878642
NM_001267550.2(TTN):c.41406C>T (p.Cys13802=) rs749356221
NM_001267550.2(TTN):c.41415_41418del (p.Asn13805fs)
NM_001267550.2(TTN):c.41473C>T (p.Arg13825Ter) rs869312043
NM_001267550.2(TTN):c.41488G>A (p.Val13830Ile) rs149059189
NM_001267550.2(TTN):c.41508T>C (p.Ala13836=) rs55847232
NM_001267550.2(TTN):c.41521G>A (p.Asp13841Asn) rs201257644
NM_001267550.2(TTN):c.41540C>T (p.Ala13847Val) rs1439068447
NM_001267550.2(TTN):c.41542G>A (p.Gly13848Arg) rs1553746427
NM_001267550.2(TTN):c.41548T>C (p.Tyr13850His) rs774281208
NM_001267550.2(TTN):c.41562G>C (p.Val13854=) rs1553746360
NM_001267550.2(TTN):c.41582A>C (p.Glu13861Ala) rs1553746267
NM_001267550.2(TTN):c.41596G>A (p.Val13866Ile) rs375474669
NM_001267550.2(TTN):c.415C>T (p.Arg139Trp) rs752970602
NM_001267550.2(TTN):c.41609-2A>C rs730880244
NM_001267550.2(TTN):c.41609-2A>G rs730880244
NM_001267550.2(TTN):c.41620G>A (p.Asp13874Asn) rs770045249
NM_001267550.2(TTN):c.41641C>T (p.Arg13881Ter)
NM_001267550.2(TTN):c.41703T>C (p.Thr13901=) rs756282138
NM_001267550.2(TTN):c.41744C>T (p.Ala13915Val) rs371426048
NM_001267550.2(TTN):c.41745G>A (p.Ala13915=) rs780790022
NM_001267550.2(TTN):c.41768T>A (p.Ile13923Lys) rs1553745511
NM_001267550.2(TTN):c.41810C>T (p.Ala13937Val) rs545806408
NM_001267550.2(TTN):c.41818G>C (p.Glu13940Gln) rs1172846357
NM_001267550.2(TTN):c.41862C>T (p.Tyr13954=) rs1553745330
NM_001267550.2(TTN):c.41888G>A (p.Arg13963His) rs540582993
NM_001267550.2(TTN):c.41894T>G (p.Val13965Gly) rs878854306
NM_001267550.2(TTN):c.41908C>T (p.Pro13970Ser) rs189799340
NM_001267550.2(TTN):c.41946A>G (p.Ala13982=) rs1553744923
NM_001267550.2(TTN):c.41958A>G (p.Ala13986=) rs186699871
NM_001267550.2(TTN):c.42003A>T (p.Gly14001=) rs1553744821
NM_001267550.2(TTN):c.42023C>T (p.Pro14008Leu) rs751709914
NM_001267550.2(TTN):c.42024+6T>C rs140002940
NM_001267550.2(TTN):c.42046G>A (p.Gly14016Ser) rs367751077
NM_001267550.2(TTN):c.42056G>A (p.Arg14019His) rs374683153
NM_001267550.2(TTN):c.42071A>G (p.His14024Arg) rs2288563
NM_001267550.2(TTN):c.42103C>T (p.Leu14035Phe) rs1433887768
NM_001267550.2(TTN):c.42108C>G (p.Tyr14036Ter) rs1311474144
NM_001267550.2(TTN):c.42152-7_42153delTTTTCAGAA rs1559975119
NM_001267550.2(TTN):c.42156C>T (p.Ile14052=) rs76815324
NM_001267550.2(TTN):c.42157G>A (p.Glu14053Lys) rs759050071
NM_001267550.2(TTN):c.42202dup (p.Arg14068fs) rs1559974529
NM_001267550.2(TTN):c.42214C>T (p.Arg14072Ter) rs794729258
NM_001267550.2(TTN):c.42219C>T (p.Phe14073=) rs150612172
NM_001267550.2(TTN):c.42329T>C (p.Val14110Ala) rs34706299
NM_001267550.2(TTN):c.42382G>A (p.Gly14128Ser) rs1553743503
NM_001267550.2(TTN):c.42401G>A (p.Arg14134Gln) rs764083952
NM_001267550.2(TTN):c.42447A>G (p.Glu14149=) rs879241728
NM_001267550.2(TTN):c.42509T>C (p.Met14170Thr) rs369623392
NM_001267550.2(TTN):c.42598_42599insG (p.Met14200fs) rs1553742630
NM_001267550.2(TTN):c.42672G>T (p.Leu14224=) rs368155350
NM_001267550.2(TTN):c.42687C>T (p.Ala14229=) rs775889693
NM_001267550.2(TTN):c.426C>T (p.Ala142=) rs56137037
NM_001267550.2(TTN):c.42714T>G (p.His14238Gln) rs1438979717
NM_001267550.2(TTN):c.42762G>C (p.Val14254=) rs747807093
NM_001267550.2(TTN):c.42764G>A (p.Ser14255Asn) rs368433387
NM_001267550.2(TTN):c.42769G>A (p.Asp14257Asn) rs746571349
NM_001267550.2(TTN):c.427G>A (p.Glu143Lys) rs754182768
NM_001267550.2(TTN):c.42807T>C (p.Ile14269=) rs778681091
NM_001267550.2(TTN):c.42829A>T (p.Ile14277Phe) rs397517568
NM_001267550.2(TTN):c.42839A>G (p.Asp14280Gly) rs181902304
NM_001267550.2(TTN):c.42840T>G (p.Asp14280Glu) rs760643071
NM_001267550.2(TTN):c.42851G>A (p.Arg14284His) rs368572799
NM_001267550.2(TTN):c.42869A>C (p.Lys14290Thr) rs1060500499
NM_001267550.2(TTN):c.42891C>T (p.Gly14297=) rs550471556
NM_001267550.2(TTN):c.42919_42923del (p.Lys14307fs) rs1060500566
NM_001267550.2(TTN):c.42933T>C (p.Asn14311=) rs148528251
NM_001267550.2(TTN):c.42946+3G>A
NM_001267550.2(TTN):c.42978C>T (p.Tyr14326=) rs369959066
NM_001267550.2(TTN):c.429A>G (p.Glu143=) rs878966869
NM_001267550.2(TTN):c.42C>T (p.Ser14=) rs925948430
NM_001267550.2(TTN):c.43019T>C (p.Ile14340Thr) rs397517571
NM_001267550.2(TTN):c.43044C>T (p.His14348=) rs1060503970
NM_001267550.2(TTN):c.43045G>A (p.Gly14349Ser) rs781452930
NM_001267550.2(TTN):c.43100T>C (p.Ile14367Thr) rs397517572
NM_001267550.2(TTN):c.43120A>G (p.Ile14374Val) rs754227553
NM_001267550.2(TTN):c.43122del (p.Ile14374_Leu14375insTer) rs1203006457
NM_001267550.2(TTN):c.43133A>G (p.His14378Arg) rs878854307
NM_001267550.2(TTN):c.43146G>A (p.Leu14382=) rs751236287
NM_001267550.2(TTN):c.43167C>T (p.Ser14389=) rs375780439
NM_001267550.2(TTN):c.43170C>T (p.Phe14390=) rs776508398
NM_001267550.2(TTN):c.43211A>C (p.Lys14404Thr) rs1296402152
NM_001267550.2(TTN):c.43249G>A (p.Val14417Ile) rs906675886
NM_001267550.2(TTN):c.43260C>T (p.Phe14420=) rs372382546
NM_001267550.2(TTN):c.43315C>T (p.Arg14439Cys) rs200914097
NM_001267550.2(TTN):c.43351G>A (p.Asp14451Asn) rs768931150
NM_001267550.2(TTN):c.43355G>T (p.Arg14452Ile) rs528741819
NM_001267550.2(TTN):c.43422A>T (p.Glu14474Asp) rs998106657
NM_001267550.2(TTN):c.43460G>A (p.Ser14487Asn) rs770233190
NM_001267550.2(TTN):c.43481-16dup rs730880350
NM_001267550.2(TTN):c.43488G>A (p.Arg14496=) rs56034831
NM_001267550.2(TTN):c.43501A>G (p.Thr14501Ala) rs764500643
NM_001267550.2(TTN):c.43502C>G (p.Thr14501Ser) rs115825044
NM_001267550.2(TTN):c.43565A>G (p.His14522Arg) rs374085402
NM_001267550.2(TTN):c.43577G>A (p.Arg14526Gln) rs373491468
NM_001267550.2(TTN):c.43596T>C (p.Asn14532=) rs16866423
NM_001267550.2(TTN):c.43603C>T (p.Arg14535Cys) rs12471771
NM_001267550.2(TTN):c.43623G>A (p.Ser14541=) rs369434563
NM_001267550.2(TTN):c.43666A>G (p.Lys14556Glu) rs1553738199
NM_001267550.2(TTN):c.43669G>A (p.Asp14557Asn) rs794729431
NM_001267550.2(TTN):c.43681G>T (p.Asp14561Tyr) rs745655055
NM_001267550.2(TTN):c.43690T>A (p.Ser14564Thr) rs181189778
NM_001267550.2(TTN):c.43691C>G (p.Ser14564Cys) rs377015571
NM_001267550.2(TTN):c.43704A>G (p.Val14568=) rs368783829
NM_001267550.2(TTN):c.43717A>G (p.Met14573Val) rs755610701
NM_001267550.2(TTN):c.43747+5G>C rs878854308
NM_001267550.2(TTN):c.43748-4G>A rs1301078575
NM_001267550.2(TTN):c.43755C>T (p.Asp14585=) rs759486529
NM_001267550.2(TTN):c.43761T>C (p.Tyr14587=) rs397517574
NM_001267550.2(TTN):c.43836A>G (p.Ala14612=) rs755492644
NM_001267550.2(TTN):c.43913A>G (p.Lys14638Arg) rs878896650
NM_001267550.2(TTN):c.43955T>C (p.Ile14652Thr) rs767038885
NM_001267550.2(TTN):c.43970G>C (p.Cys14657Ser) rs774245300
NM_001267550.2(TTN):c.43986T>G (p.Asp14662Glu) rs201390600
NM_001267550.2(TTN):c.43G>A (p.Val15Ile) rs201857541
NM_001267550.2(TTN):c.44017C>G (p.Arg14673Gly) rs773004022
NM_001267550.2(TTN):c.44035C>T (p.Arg14679Ter)
NM_001267550.2(TTN):c.44036G>A (p.Arg14679Gln) rs369709751
NM_001267550.2(TTN):c.44076A>T (p.Ala14692=) rs535734890
NM_001267550.2(TTN):c.44077C>T (p.Arg14693Cys) rs200445568
NM_001267550.2(TTN):c.44078G>A (p.Arg14693His) rs746380621
NM_001267550.2(TTN):c.44117A>G (p.Asn14706Ser) rs878854309
NM_001267550.2(TTN):c.44154+4A>T
NM_001267550.2(TTN):c.44184A>G (p.Ile14728Met) rs572315033
NM_001267550.2(TTN):c.44191C>T (p.Leu14731Phe) rs771361227
NM_001267550.2(TTN):c.44210G>A (p.Arg14737His) rs373298007
NM_001267550.2(TTN):c.44222C>T (p.Thr14741Met) rs778576436
NM_001267550.2(TTN):c.44272C>T (p.Arg14758Ter) rs140743001
NM_001267550.2(TTN):c.44273G>A (p.Arg14758Gln) rs770389312
NM_001267550.2(TTN):c.44281+1G>A rs771562210
NM_001267550.2(TTN):c.44281+2dup
NM_001267550.2(TTN):c.44281C>T (p.Pro14761Ser) rs192766485
NM_001267550.2(TTN):c.44285G>A (p.Arg14762Gln) rs727505019
NM_001267550.2(TTN):c.44285G>C (p.Arg14762Pro) rs727505019
NM_001267550.2(TTN):c.44323G>A (p.Val14775Met) rs540115992
NM_001267550.2(TTN):c.44331A>G (p.Ala14777=) rs1316025017
NM_001267550.2(TTN):c.44335G>C (p.Glu14779Gln) rs1262894259
NM_001267550.2(TTN):c.44349C>T (p.Phe14783=) rs367744803
NM_001267550.2(TTN):c.44366A>G (p.Tyr14789Cys) rs397517577
NM_001267550.2(TTN):c.44375T>A (p.Ile14792Asn) rs747654057
NM_001267550.2(TTN):c.44413C>G (p.Pro14805Ala) rs753926213
NM_001267550.2(TTN):c.44419G>A (p.Asp14807Asn) rs753053245
NM_001267550.2(TTN):c.44423A>C (p.Lys14808Thr) rs374419129
NM_001267550.2(TTN):c.44425G>A (p.Val14809Met) rs775225695
NM_001267550.2(TTN):c.44435G>A (p.Arg14812His) rs375574483
NM_001267550.2(TTN):c.44472T>G (p.Asp14824Glu) rs377441854
NM_001267550.2(TTN):c.44481_44483AGA[1] (p.Glu14828del) rs727505315
NM_001267550.2(TTN):c.44490T>C (p.Ala14830=) rs1060503932
NM_001267550.2(TTN):c.44492G>A (p.Gly14831Glu) rs751929345
NM_001267550.2(TTN):c.44494del (p.Glu14832fs) rs1553725355
NM_001267550.2(TTN):c.44525C>T (p.Thr14842Ile) rs370782364
NM_001267550.2(TTN):c.44529C>T (p.His14843=) rs55973744
NM_001267550.2(TTN):c.44530G>A (p.Ala14844Thr) rs772053966
NM_001267550.2(TTN):c.44542G>A (p.Val14848Met) rs759373140
NM_001267550.2(TTN):c.44548+9A>G rs372725070
NM_001267550.2(TTN):c.44580G>C (p.Glu14860Asp) rs1060500475
NM_001267550.2(TTN):c.44593G>A (p.Glu14865Lys) rs543102139
NM_001267550.2(TTN):c.44599G>A (p.Gly14867Arg) rs144848584
NM_001267550.2(TTN):c.44667G>C (p.Gly14889=) rs746287950
NM_001267550.2(TTN):c.44706T>C (p.Ala14902=) rs766958603
NM_001267550.2(TTN):c.44736T>A (p.His14912Gln) rs762830792
NM_001267550.2(TTN):c.44743A>G (p.Thr14915Ala) rs878854310
NM_001267550.2(TTN):c.44745C>A (p.Thr14915=) rs762145326
NM_001267550.2(TTN):c.44784T>C (p.Asp14928=) rs186105748
NM_001267550.2(TTN):c.44848G>A (p.Asp14950Asn) rs571524382
NM_001267550.2(TTN):c.44850C>A (p.Asp14950Glu) rs371376631
NM_001267550.2(TTN):c.44899C>T (p.Arg14967Ter) rs727505350
NM_001267550.2(TTN):c.44900G>A (p.Arg14967Gln) rs752671402
NM_001267550.2(TTN):c.44913+1G>T rs1553721106
NM_001267550.2(TTN):c.44913G>C (p.Lys14971Asn)
NM_001267550.2(TTN):c.44916T>A (p.Val14972=) rs373390402
NM_001267550.2(TTN):c.44978G>A (p.Gly14993Glu) rs200931793
NM_001267550.2(TTN):c.44987G>A (p.Arg14996His) rs762128685
NM_001267550.2(TTN):c.44993T>C (p.Leu14998Pro) rs1553719829
NM_001267550.2(TTN):c.44998A>G (p.Ile15000Val) rs775264673
NM_001267550.2(TTN):c.45001A>C (p.Asn15001His) rs373109469
NM_001267550.2(TTN):c.45014T>C (p.Leu15005Pro) rs369992659
NM_001267550.2(TTN):c.45052G>C (p.Ala15018Pro) rs1060500472
NM_001267550.2(TTN):c.45053C>T (p.Ala15018Val) rs72677221
NM_001267550.2(TTN):c.45054G>A (p.Ala15018=) rs781392140
NM_001267550.2(TTN):c.45120T>G (p.Ile15040Met) rs74580375
NM_001267550.2(TTN):c.45128G>A (p.Ser15043Asn) rs376144178
NM_001267550.2(TTN):c.45156T>A (p.Cys15052Ter) rs1060500487
NM_001267550.2(TTN):c.45174C>T (p.Gly15058=) rs372609980
NM_001267550.2(TTN):c.45175G>A (p.Ala15059Thr) rs144668626
NM_001267550.2(TTN):c.45206A>T (p.Glu15069Val) rs114331773
NM_001267550.2(TTN):c.45212T>C (p.Ile15071Thr) rs184078045
NM_001267550.2(TTN):c.45273C>T (p.Asn15091=) rs72677223
NM_001267550.2(TTN):c.45307C>T (p.Arg15103Ter) rs397517580
NM_001267550.2(TTN):c.45322C>T (p.Arg15108Ter) rs1060500405
NM_001267550.2(TTN):c.45328G>A (p.Asp15110Asn) rs17354992
NM_001267550.2(TTN):c.45349+3A>G rs1553718424
NM_001267550.2(TTN):c.45408G>T (p.Lys15136Asn) rs72677225
NM_001267550.2(TTN):c.45449T>G (p.Val15150Gly) rs1060500496
NM_001267550.2(TTN):c.45499G>A (p.Val15167Ile) rs183245562
NM_001267550.2(TTN):c.45505G>A (p.Ala15169Thr) rs759247684
NM_001267550.2(TTN):c.45526C>T (p.Leu15176=) rs61004744
NM_001267550.2(TTN):c.45535A>T (p.Lys15179Ter) rs1559877046
NM_001267550.2(TTN):c.45546A>G (p.Thr15182=) rs1553717666
NM_001267550.2(TTN):c.45589A>G (p.Arg15197Gly) rs748906368
NM_001267550.2(TTN):c.45601C>G (p.His15201Asp) rs794729438
NM_001267550.2(TTN):c.45652C>T (p.Arg15218Trp) rs371621174
NM_001267550.2(TTN):c.45725G>A (p.Arg15242Lys) rs140795503
NM_001267550.2(TTN):c.45737C>T (p.Ala15246Val) rs370233278
NM_001267550.2(TTN):c.45738T>C (p.Ala15246=) rs2303829
NM_001267550.2(TTN):c.45760A>T (p.Ile15254Phe) rs72677226
NM_001267550.2(TTN):c.45779T>C (p.Leu15260Pro) rs552053581
NM_001267550.2(TTN):c.45814del (p.Asp15272fs)
NM_001267550.2(TTN):c.45895+5G>C rs1206842325
NM_001267550.2(TTN):c.45916G>A (p.Glu15306Lys) rs774339883
NM_001267550.2(TTN):c.45940A>T (p.Met15314Leu) rs1391292606
NM_001267550.2(TTN):c.45945G>A (p.Glu15315=) rs774122600
NM_001267550.2(TTN):c.45979C>T (p.Arg15327Cys) rs367774903
NM_001267550.2(TTN):c.45989dup (p.Thr15331fs) rs1553715911
NM_001267550.2(TTN):c.46037G>A (p.Arg15346His) rs367996763
NM_001267550.2(TTN):c.46061A>G (p.Tyr15354Cys) rs886038861
NM_001267550.2(TTN):c.46078_46092del (p.Ile15360_Gly15364del) rs727505075
NM_001267550.2(TTN):c.46142T>C (p.Val15381Ala) rs369269320
NM_001267550.2(TTN):c.46160T>C (p.Ile15387Thr) rs397517585
NM_001267550.2(TTN):c.46169C>T (p.Pro15390Leu) rs879113967
NM_001267550.2(TTN):c.46211A>G (p.Glu15404Gly) rs878854311
NM_001267550.2(TTN):c.46222G>A (p.Ala15408Thr) rs730880239
NM_001267550.2(TTN):c.46273A>C (p.Arg15425=) rs753808735
NM_001267550.2(TTN):c.46285G>T (p.Glu15429Ter)
NM_001267550.2(TTN):c.46305-1G>C rs1553714845
NM_001267550.2(TTN):c.46353T>C (p.Asp15451=) rs373160538
NM_001267550.2(TTN):c.46359G>A (p.Arg15453=) rs1553714751
NM_001267550.2(TTN):c.46362G>C (p.Leu15454=) rs964036554
NM_001267550.2(TTN):c.46363G>A (p.Asp15455Asn) rs370813526
NM_001267550.2(TTN):c.46369G>A (p.Glu15457Lys) rs753664074
NM_001267550.2(TTN):c.46371G>C (p.Glu15457Asp) rs764100235
NM_001267550.2(TTN):c.46386C>T (p.Cys15462=) rs147703145
NM_001267550.2(TTN):c.46399dup (p.Arg15467fs) rs1060500443
NM_001267550.2(TTN):c.46430-8C>T rs773395217
NM_001267550.2(TTN):c.46451G>A (p.Arg15484Lys) rs72677229
NM_001267550.2(TTN):c.46489G>T (p.Val15497Phe) rs371299188
NM_001267550.2(TTN):c.46521G>C (p.Lys15507Asn) rs781291079
NM_001267550.2(TTN):c.46550T>C (p.Met15517Thr) rs1349699547
NM_001267550.2(TTN):c.46569T>A (p.Asp15523Glu) rs1553713980
NM_001267550.2(TTN):c.46569T>C (p.Asp15523=) rs1553713980
NM_001267550.2(TTN):c.46591G>A (p.Gly15531Arg) rs761815745
NM_001267550.2(TTN):c.46693G>T (p.Ala15565Ser) rs145520397
NM_001267550.2(TTN):c.46696+4A>G rs1553713646
NM_001267550.2(TTN):c.46702C>T (p.Pro15568Ser) rs561728671
NM_001267550.2(TTN):c.46724_46725delinsC (p.Gln15575fs) rs1559855146
NM_001267550.2(TTN):c.46732G>C (p.Val15578Leu) rs1553712552
NM_001267550.2(TTN):c.46800A>G (p.Glu15600=) rs190058852
NM_001267550.2(TTN):c.46803G>A (p.Trp15601Ter)
NM_001267550.2(TTN):c.46843dup (p.Thr15615fs) rs1553712292
NM_001267550.2(TTN):c.46847C>T (p.Thr15616Met) rs368057764
NM_001267550.2(TTN):c.46880C>T (p.Ala15627Val) rs115813214
NM_001267550.2(TTN):c.46895_46898del (p.Lys15632fs) rs1553712148
NM_001267550.2(TTN):c.46899G>A (p.Gly15633=) rs727504195
NM_001267550.2(TTN):c.46928A>G (p.His15643Arg) rs368502650
NM_001267550.2(TTN):c.46943G>A (p.Gly15648Glu) rs1060500413
NM_001267550.2(TTN):c.46966G>A (p.Asp15656Asn) rs727504572
NM_001267550.2(TTN):c.47077G>A (p.Val15693Ile) rs201717871
NM_001267550.2(TTN):c.47089C>T (p.Arg15697Cys) rs780334981
NM_001267550.2(TTN):c.47123C>G (p.Thr15708Arg) rs1553711574
NM_001267550.2(TTN):c.47133A>G (p.Ala15711=) rs573218266
NM_001267550.2(TTN):c.47133_47134AG[2] (p.Ser15713fs) rs886039125
NM_001267550.2(TTN):c.47177T>C (p.Val15726Ala) rs1553711371
NM_001267550.2(TTN):c.47191C>T (p.Arg15731Cys) rs72677231
NM_001267550.2(TTN):c.47196G>C (p.Val15732=) rs369979598
NM_001267550.2(TTN):c.47248G>A (p.Val15750Ile) rs72677232
NM_001267550.2(TTN):c.47258G>A (p.Arg15753Lys) rs577133803
NM_001267550.2(TTN):c.47269+10T>G rs1060503966
NM_001267550.2(TTN):c.47269+2T>C rs1060500419
NM_001267550.2(TTN):c.47271T>C (p.Asp15757=) rs76081119
NM_001267550.2(TTN):c.47289G>T (p.Leu15763Phe) rs1553710788
NM_001267550.2(TTN):c.47296A>T (p.Thr15766Ser) rs878854312
NM_001267550.2(TTN):c.47315G>A (p.Arg15772Gln) rs72677233
NM_001267550.2(TTN):c.47379C>T (p.Tyr15793=) rs374281025
NM_001267550.2(TTN):c.47380G>A (p.Val15794Ile) rs727504878
NM_001267550.2(TTN):c.47394_47411del (p.Asp15799_Arg15804del) rs398124453
NM_001267550.2(TTN):c.47400G>A (p.Lys15800=) rs114145817
NM_001267550.2(TTN):c.47430T>C (p.Thr15810=) rs373878153
NM_001267550.2(TTN):c.47494C>T (p.Arg15832Ter) rs751746401
NM_001267550.2(TTN):c.47498T>A (p.Val15833Glu) rs758495958
NM_001267550.2(TTN):c.474C>G (p.Leu158=) rs149574119
NM_001267550.2(TTN):c.47513G>A (p.Arg15838Gln) rs199640194
NM_001267550.2(TTN):c.47515A>G (p.Ile15839Val) rs1553710021
NM_001267550.2(TTN):c.47516T>C (p.Ile15839Thr) rs764388462
NM_001267550.2(TTN):c.47530C>G (p.Pro15844Ala) rs760956511
NM_001267550.2(TTN):c.47537C>T (p.Ala15846Val) rs1183139911
NM_001267550.2(TTN):c.47545C>A (p.Pro15849Thr) rs146181477
NM_001267550.2(TTN):c.47576_47577delGA (p.Arg15859Thrfs) rs1060500489
NM_001267550.2(TTN):c.47626G>A (p.Val15876Ile) rs766025438
NM_001267550.2(TTN):c.47629C>T (p.Gln15877Ter) rs886044009
NM_001267550.2(TTN):c.47676A>G (p.Leu15892=) rs761412068
NM_001267550.2(TTN):c.47687T>C (p.Ile15896Thr) rs1411457226
NM_001267550.2(TTN):c.47692C>T (p.Arg15898Ter) rs775186117
NM_001267550.2(TTN):c.47693G>A (p.Arg15898Gln) rs376278449
NM_001267550.2(TTN):c.47697C>A (p.Cys15899Ter) rs373040154
NM_001267550.2(TTN):c.47698G>A (p.Glu15900Lys) rs772625773
NM_001267550.2(TTN):c.47705G>A (p.Gly15902Glu) rs561284948
NM_001267550.2(TTN):c.47723G>A (p.Arg15908His) rs72677237
NM_001267550.2(TTN):c.47737C>T (p.Leu15913Phe) rs138576504
NM_001267550.2(TTN):c.47740G>C (p.Val15914Leu) rs764059405
NM_001267550.2(TTN):c.47757C>T (p.Tyr15919=) rs1060500551
NM_001267550.2(TTN):c.47758A>C (p.Lys15920Gln) rs775513269
NM_001267550.2(TTN):c.47767G>A (p.Gly15923Arg) rs371943746
NM_001267550.2(TTN):c.47802A>C (p.Val15934=) rs1553708481
NM_001267550.2(TTN):c.47866G>A (p.Asp15956Asn) rs372881122
NM_001267550.2(TTN):c.47875+4_47875+7delAATA rs753206674
NM_001267550.2(TTN):c.47875+6T>C rs780524253
NM_001267550.2(TTN):c.47875+8G>A rs144688960
NM_001267550.2(TTN):c.47875+9A>G rs1553708222
NM_001267550.2(TTN):c.47894T>A (p.Leu15965Ter) rs878982457
NM_001267550.2(TTN):c.47900C>A (p.Ala15967Glu) rs1553707943
NM_001267550.2(TTN):c.47936C>T (p.Pro15979Leu) rs184815126
NM_001267550.2(TTN):c.47938A>G (p.Ile15980Val) rs780634456
NM_001267550.2(TTN):c.47955A>G (p.Pro15985=) rs192953152
NM_001267550.2(TTN):c.47978C>A (p.Thr15993Asn) rs727503622
NM_001267550.2(TTN):c.47998G>C (p.Asp16000His) rs201388509
NM_001267550.2(TTN):c.48023G>A (p.Arg16008Gln) rs771224957
NM_001267550.2(TTN):c.48052G>A (p.Ala16018Thr) rs1451009964
NM_001267550.2(TTN):c.48079C>T (p.Arg16027Cys) rs765032242
NM_001267550.2(TTN):c.48106A>C (p.Lys16036Gln) rs886055271
NM_001267550.2(TTN):c.48119G>A (p.Arg16040His) rs956699957
NM_001267550.2(TTN):c.48143T>C (p.Ile16048Thr) rs749678590
NM_001267550.2(TTN):c.48152A>G (p.Asn16051Ser) rs534426018
NM_001267550.2(TTN):c.48160G>A (p.Ala16054Thr)
NM_001267550.2(TTN):c.48161-11dup rs730880371
NM_001267550.2(TTN):c.48164G>A (p.Arg16055His) rs72677238
NM_001267550.2(TTN):c.48213A>C (p.Ser16071=) rs763351197
NM_001267550.2(TTN):c.48227_48229delinsAAA (p.Trp16076_Glu16077delinsTer) rs1553706971
NM_001267550.2(TTN):c.48246T>C (p.Asp16082=) rs771542149
NM_001267550.2(TTN):c.48270C>T (p.Tyr16090=) rs397517592
NM_001267550.2(TTN):c.48283C>T (p.Arg16095Ter) rs374140736
NM_001267550.2(TTN):c.48296G>A (p.Arg16099Gln) rs376747673
NM_001267550.2(TTN):c.48311A>C (p.Lys16104Thr) rs1060500396
NM_001267550.2(TTN):c.48312+3G>T rs368650224
NM_001267550.2(TTN):c.48331G>A (p.Asp16111Asn) rs769898196
NM_001267550.2(TTN):c.48337G>A (p.Glu16113Lys) rs548275593
NM_001267550.2(TTN):c.48353A>G (p.Asp16118Gly) rs376273101
NM_001267550.2(TTN):c.48359T>C (p.Val16120Ala) rs745999025
NM_001267550.2(TTN):c.48369dup (p.Glu16124fs) rs1553705557
NM_001267550.2(TTN):c.48378_48380del (p.Leu16126del) rs561618839
NM_001267550.2(TTN):c.48394C>T (p.Arg16132Cys) rs2303830
NM_001267550.2(TTN):c.48399C>A (p.Asn16133Lys) rs1060500470
NM_001267550.2(TTN):c.48409C>T (p.Pro16137Ser) rs879009898
NM_001267550.2(TTN):c.48451A>G (p.Thr16151Ala) rs186497293
NM_001267550.2(TTN):c.48461-2A>C rs1553705079
NM_001267550.2(TTN):c.48461-7G>A rs548241708
NM_001267550.2(TTN):c.48461C>T (p.Thr16154Met) rs771120250
NM_001267550.2(TTN):c.48462G>A (p.Thr16154=) rs202141158
NM_001267550.2(TTN):c.48498T>G (p.Asp16166Glu) rs1429263816
NM_001267550.2(TTN):c.48509A>G (p.Asn16170Ser) rs370809363
NM_001267550.2(TTN):c.48542dup (p.Asn16181fs)
NM_001267550.2(TTN):c.48545A>C (p.Asp16182Ala) rs762913484
NM_001267550.2(TTN):c.48556C>T (p.Arg16186Cys) rs377563403
NM_001267550.2(TTN):c.48557G>A (p.Arg16186His) rs769784536
NM_001267550.2(TTN):c.48557G>T (p.Arg16186Leu) rs769784536
NM_001267550.2(TTN):c.48560T>G (p.Ile16187Ser) rs777279411
NM_001267550.2(TTN):c.48589C>T (p.Arg16197Cys) rs748917057
NM_001267550.2(TTN):c.48590G>A (p.Arg16197His) rs369826752
NM_001267550.2(TTN):c.485T>A (p.Leu162Gln) rs145438758
NM_001267550.2(TTN):c.48624T>C (p.Pro16208=) rs72677240
NM_001267550.2(TTN):c.48639-3C>A rs923663993
NM_001267550.2(TTN):c.48668A>C (p.Lys16223Thr) rs1553704101
NM_001267550.2(TTN):c.48683G>A (p.Arg16228His) rs368806005
NM_001267550.2(TTN):c.48727C>A (p.Pro16243Thr) rs72677242
NM_001267550.2(TTN):c.48727C>T (p.Pro16243Ser) rs72677242
NM_001267550.2(TTN):c.48751G>A (p.Asp16251Asn) rs199954570
NM_001267550.2(TTN):c.48838G>A (p.Ala16280Thr) rs372911542
NM_001267550.2(TTN):c.48842C>T (p.Thr16281Ile) rs1553703631
NM_001267550.2(TTN):c.48843C>T (p.Thr16281=) rs547682223
NM_001267550.2(TTN):c.48850G>A (p.Gly16284Arg) rs368527534
NM_001267550.2(TTN):c.48862C>T (p.Pro16288Ser) rs894986526
NM_001267550.2(TTN):c.48879A>T (p.Thr16293=) rs1553703542
NM_001267550.2(TTN):c.48891G>A (p.Met16297Ile) rs754110019
NM_001267550.2(TTN):c.48953T>C (p.Ile16318Thr) rs72677243
NM_001267550.2(TTN):c.48960T>C (p.Asp16320=) rs1057523898
NM_001267550.2(TTN):c.48971G>T (p.Ser16324Ile) rs878948684
NM_001267550.2(TTN):c.48983C>T (p.Thr16328Ile) rs770839243
NM_001267550.2(TTN):c.48987T>C (p.Tyr16329=) rs773944885
NM_001267550.2(TTN):c.48996G>A (p.Glu16332=) rs72677244
NM_001267550.2(TTN):c.49000G>A (p.Val16334Met) rs541384076
NM_001267550.2(TTN):c.49008G>A (p.Val16336=) rs781078888
NM_001267550.2(TTN):c.49015C>T (p.Arg16339Trp) rs201793958
NM_001267550.2(TTN):c.49016G>A (p.Arg16339Gln) rs558487304
NM_001267550.2(TTN):c.49041C>T (p.Asn16347=) rs369981635
NM_001267550.2(TTN):c.49048+4A>G rs766931932
NM_001267550.2(TTN):c.49070C>T (p.Ala16357Val) rs199768159
NM_001267550.2(TTN):c.49129G>A (p.Asp16377Asn) rs757542062
NM_001267550.2(TTN):c.49172G>A (p.Arg16391Gln) rs200944827
NM_001267550.2(TTN):c.49174G>A (p.Ala16392Thr) rs794729446
NM_001267550.2(TTN):c.49175C>A (p.Ala16392Glu) rs750310775
NM_001267550.2(TTN):c.49241A>G (p.Lys16414Arg) rs1329659749
NM_001267550.2(TTN):c.49258G>A (p.Glu16420Lys) rs764682084
NM_001267550.2(TTN):c.49263C>T (p.Tyr16421=) rs376188859
NM_001267550.2(TTN):c.49278T>C (p.Ala16426=) rs372633280
NM_001267550.2(TTN):c.49345+2T>C rs1559805633
NM_001267550.2(TTN):c.49357C>A (p.Pro16453Thr) rs200121902
NM_001267550.2(TTN):c.49363A>G (p.Thr16455Ala) rs374543277
NM_001267550.2(TTN):c.49371A>T (p.Leu16457=) rs146163169
NM_001267550.2(TTN):c.49377T>A (p.Pro16459=) rs564712731
NM_001267550.2(TTN):c.49388C>A (p.Thr16463Asn) rs541307234
NM_001267550.2(TTN):c.49395C>T (p.Asp16465=) rs749308557
NM_001267550.2(TTN):c.49406T>A (p.Leu16469His) rs72677245
NM_001267550.2(TTN):c.49413G>T (p.Trp16471Cys) rs202094100
NM_001267550.2(TTN):c.49443A>C (p.Pro16481=) rs74321406
NM_001267550.2(TTN):c.49465A>C (p.Arg16489=) rs748959693
NM_001267550.2(TTN):c.49488A>G (p.Lys16496=) rs1553701108
NM_001267550.2(TTN):c.49560A>T (p.Lys16520Asn) rs779658426
NM_001267550.2(TTN):c.49648+7T>C rs1553700115
NM_001267550.2(TTN):c.49656A>G (p.Pro16552=) rs982034509
NM_001267550.2(TTN):c.49698A>G (p.Thr16566=) rs778112130
NM_001267550.2(TTN):c.49707G>T (p.Arg16569Ser) rs879180534
NM_001267550.2(TTN):c.49731T>C (p.His16577=) rs2115558
NM_001267550.2(TTN):c.49752G>A (p.Glu16584=) rs763652368
NM_001267550.2(TTN):c.49801G>T (p.Val16601Leu) rs773271774
NM_001267550.2(TTN):c.49812G>A (p.Gly16604=) rs760032120
NM_001267550.2(TTN):c.4981A>G (p.Ile1661Val) rs749438439
NM_001267550.2(TTN):c.49834C>T (p.Leu16612Phe) rs750840061
NM_001267550.2(TTN):c.49837C>G (p.Pro16613Ala) rs1468557688
NM_001267550.2(TTN):c.49871G>A (p.Arg16624Gln) rs367566671
NM_001267550.2(TTN):c.4989A>T (p.Pro1663=) rs756408474
NM_001267550.2(TTN):c.4990C>T (p.Arg1664Trp) rs147695336
NM_001267550.2(TTN):c.49919G>C (p.Ser16640Thr) rs55663050
NM_001267550.2(TTN):c.49937G>A (p.Arg16646Gln) rs746384579
NM_001267550.2(TTN):c.49944G>A (p.Lys16648=) rs190021597
NM_001267550.2(TTN):c.49978G>A (p.Val16660Ile) rs757016105
NM_001267550.2(TTN):c.49985A>C (p.Asn16662Thr) rs36043230
NM_001267550.2(TTN):c.49998T>C (p.Asn16666=) rs376917681
NM_001267550.2(TTN):c.5000A>G (p.Tyr1667Cys) rs140494897
NM_001267550.2(TTN):c.5003G>A (p.Arg1668Lys) rs1554008153
NM_001267550.2(TTN):c.50070_50071GA[2] (p.Asp16692fs) rs1060500513
NM_001267550.2(TTN):c.50076C>T (p.Asp16692=) rs397517598
NM_001267550.2(TTN):c.50077G>A (p.Val16693Ile) rs377141765
NM_001267550.2(TTN):c.50083C>T (p.Arg16695Ter) rs751502842
NM_001267550.2(TTN):c.50084G>A (p.Arg16695Gln) rs794729451
NM_001267550.2(TTN):c.50148T>A (p.Thr16716=) rs374138859
NM_001267550.2(TTN):c.50151G>C (p.Glu16717Asp) rs369623681
NM_001267550.2(TTN):c.50154C>A (p.Gly16718=) rs894625126
NM_001267550.2(TTN):c.50170C>T (p.Arg16724Ter) rs794729265
NM_001267550.2(TTN):c.50189C>T (p.Ala16730Val) rs763483590
NM_001267550.2(TTN):c.50205C>T (p.Asp16735=) rs1185567072
NM_001267550.2(TTN):c.50212G>A (p.Glu16738Lys) rs148018042
NM_001267550.2(TTN):c.50296C>T (p.Arg16766Ter) rs754866489
NM_001267550.2(TTN):c.50297G>A (p.Arg16766Gln) rs747224934
NM_001267550.2(TTN):c.50308C>T (p.Leu16770=) rs370782852
NM_001267550.2(TTN):c.50348T>C (p.Ile16783Thr) rs950940404
NM_001267550.2(TTN):c.50363T>C (p.Ile16788Thr) rs397517599
NM_001267550.2(TTN):c.50385T>C (p.Gly16795=) rs374672630
NM_001267550.2(TTN):c.50390G>A (p.Arg16797His) rs200835354
NM_001267550.2(TTN):c.50400A>T (p.Lys16800Asn) rs794729239
NM_001267550.2(TTN):c.50430C>T (p.Asn16810=) rs878854313
NM_001267550.2(TTN):c.50441C>G (p.Thr16814Ser) rs1559783698
NM_001267550.2(TTN):c.50452G>A (p.Glu16818Lys) rs397517600
NM_001267550.2(TTN):c.50480G>A (p.Arg16827Gln) rs138896856
NM_001267550.2(TTN):c.5048G>A (p.Arg1683Gln) rs368122582
NM_001267550.2(TTN):c.50549_50551+5dup rs1060500453
NM_001267550.2(TTN):c.50554C>T (p.Pro16852Ser) rs752660748
NM_001267550.2(TTN):c.50597G>A (p.Arg16866Lys) rs774137928
NM_001267550.2(TTN):c.50642G>C (p.Gly16881Ala) rs201302681
NM_001267550.2(TTN):c.50648C>A (p.Pro16883His) rs758756600
NM_001267550.2(TTN):c.50669A>C (p.Glu16890Ala) rs752204728
NM_001267550.2(TTN):c.50714G>A (p.Arg16905His) rs191539637
NM_001267550.2(TTN):c.50719A>G (p.Ile16907Val) rs750610895
NM_001267550.2(TTN):c.50749G>A (p.Gly16917Ser) rs1553696081
NM_001267550.2(TTN):c.50758C>G (p.Pro16920Ala) rs377289817
NM_001267550.2(TTN):c.50774T>C (p.Val16925Ala) rs370067597
NM_001267550.2(TTN):c.5080C>T (p.Leu1694Phe) rs769798880
NM_001267550.2(TTN):c.50811C>T (p.Ser16937=)
NM_001267550.2(TTN):c.50850C>A (p.Asp16950Glu) rs200700386
NM_001267550.2(TTN):c.50857+10C>G rs1553695761
NM_001267550.2(TTN):c.50858-10T>C
NM_001267550.2(TTN):c.50858-3C>T rs587782987
NM_001267550.2(TTN):c.50860A>T (p.Lys16954Ter) rs794729268
NM_001267550.2(TTN):c.50869A>G (p.Ile16957Val) rs372013419
NM_001267550.2(TTN):c.50905G>C (p.Gly16969Arg) rs878854314
NM_001267550.2(TTN):c.50954C>T (p.Thr16985Ile) rs116765281
NM_001267550.2(TTN):c.50979A>G (p.Lys16993=) rs913914694
NM_001267550.2(TTN):c.51012G>T (p.Lys17004Asn) rs755153359
NM_001267550.2(TTN):c.51018T>C (p.Asp17006=) rs1163818093
NM_001267550.2(TTN):c.51037G>T (p.Glu17013Ter) rs1060500500
NM_001267550.2(TTN):c.51055C>T (p.Arg17019Cys) rs773394284
NM_001267550.2(TTN):c.51060A>G (p.Ala17020=) rs1553694864
NM_001267550.2(TTN):c.51065C>T (p.Ala17022Val) rs372419267
NM_001267550.2(TTN):c.51079A>T (p.Ile17027Phe) rs770809063
NM_001267550.2(TTN):c.51175A>G (p.Ile17059Val) rs188395969
NM_001267550.2(TTN):c.51231C>A (p.Thr17077=) rs779518431
NM_001267550.2(TTN):c.51234A>C (p.Pro17078=) rs1553693459
NM_001267550.2(TTN):c.51234_51237dup (p.Leu17080fs) rs1553693444
NM_001267550.2(TTN):c.51244dup (p.Tyr17082fs)
NM_001267550.2(TTN):c.51247G>T (p.Val17083Phe) rs746817480
NM_001267550.2(TTN):c.51249C>A (p.Val17083=) rs377342233
NM_001267550.2(TTN):c.51297T>C (p.Ser17099=) rs1237576280
NM_001267550.2(TTN):c.51310C>T (p.Leu17104=) rs1060503959
NM_001267550.2(TTN):c.5132C>T (p.