ClinVar Miner

List of variants in gene TTN reported as uncertain significance by Invitae

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 3199
Download table as spreadsheet
HGVS dbSNP
NC_000002.11:g.(?_179460214)_(179487514_?)dup
NC_000002.11:g.(?_179489172)_(179501546_?)del
NC_000002.11:g.(?_179505958)_(179515008_?)dup
NC_000002.11:g.(?_179516971)_(179518254_?)del
NC_000002.11:g.(?_179557214)_(179600811_?)dup
NC_000002.11:g.(?_179574273)_(179576096_?)del
NC_000002.11:g.(?_179581802)_(179589285_?)dup
NC_000002.11:g.(?_179648427)_(179650888_?)del
NC_000002.11:g.(?_179669259)_(179669389_?)del
NM_001256850.1(TTN):c.16510+1G>T rs747990127
NM_001256850.1(TTN):c.19885+5G>A rs1064796629
NM_001256850.1(TTN):c.21578-7C>A rs769076842
NM_001256850.1(TTN):c.28091-2A>C rs6716782
NM_001256850.1(TTN):c.29560+3G>A rs563582627
NM_001256850.1(TTN):c.30895+1G>A rs794727043
NM_001256850.1(TTN):c.32389+5A>C rs373367032
NM_001256850.1(TTN):c.34690+6C>T rs187365142
NM_001256850.1(TTN):c.39231+6G>T rs794729234
NM_001256850.1(TTN):c.40166_40168delAAG rs759525338
NM_001256850.1(TTN):c.43537+5G>A rs374413644
NM_001256850.1(TTN):c.48364+6G>A rs149890360
NM_001256850.1(TTN):c.48958+5G>T rs753527304
NM_001256850.1(TTN):c.83086+5G>A rs148231754
NM_001256850.1(TTN):c.91981+4T>C rs373514079
NM_001256850.1(TTN):c.93175+3G>A rs556524594
NM_001267550.1(TTN):c.46387G>A rs200042932
NM_001267550.2(TTN):c.100018C>A (p.Gln33340Lys) rs558954116
NM_001267550.2(TTN):c.100049C>T (p.Thr33350Ile) rs370300135
NM_001267550.2(TTN):c.100058T>C (p.Ile33353Thr) rs138234724
NM_001267550.2(TTN):c.100060G>C (p.Val33354Leu) rs879221791
NM_001267550.2(TTN):c.100117G>A (p.Gly33373Ser) rs55880786
NM_001267550.2(TTN):c.100133T>G (p.Leu33378Arg) rs1060500454
NM_001267550.2(TTN):c.100163G>A (p.Ser33388Asn) rs745406517
NM_001267550.2(TTN):c.100172-3T>C
NM_001267550.2(TTN):c.100194A>T (p.Lys33398Asn) rs1060500553
NM_001267550.2(TTN):c.100204A>G (p.Thr33402Ala) rs777018654
NM_001267550.2(TTN):c.100244C>T (p.Pro33415Leu)
NM_001267550.2(TTN):c.100295G>A (p.Arg33432His) rs374876608
NM_001267550.2(TTN):c.100384G>A (p.Glu33462Lys) rs748104690
NM_001267550.2(TTN):c.100390G>A (p.Glu33464Lys) rs374920916
NM_001267550.2(TTN):c.100396C>T (p.Arg33466Cys) rs371908649
NM_001267550.2(TTN):c.100397G>A (p.Arg33466His) rs189626540
NM_001267550.2(TTN):c.100400T>G (p.Val33467Gly) rs200166942
NM_001267550.2(TTN):c.100432T>G (p.Trp33478Gly) rs372304158
NM_001267550.2(TTN):c.100436G>A (p.Ser33479Asn) rs1553501815
NM_001267550.2(TTN):c.100447G>C (p.Glu33483Gln) rs368321767
NM_001267550.2(TTN):c.100449A>C (p.Glu33483Asp) rs762690616
NM_001267550.2(TTN):c.10046C>T (p.Thr3349Ile) rs727503678
NM_001267550.2(TTN):c.10062del (p.Val3355fs) rs1553983844
NM_001267550.2(TTN):c.100649G>A (p.Gly33550Asp) rs370253076
NM_001267550.2(TTN):c.100696A>G (p.Thr33566Ala) rs878854282
NM_001267550.2(TTN):c.100745C>G (p.Thr33582Ser) rs1289282264
NM_001267550.2(TTN):c.100759G>A (p.Val33587Met) rs1401200720
NM_001267550.2(TTN):c.100786C>T (p.Pro33596Ser)
NM_001267550.2(TTN):c.100800A>C (p.Glu33600Asp)
NM_001267550.2(TTN):c.100804A>G (p.Met33602Val)
NM_001267550.2(TTN):c.100858A>C (p.Ser33620Arg) rs1553500669
NM_001267550.2(TTN):c.100880T>C (p.Ile33627Thr) rs1553500627
NM_001267550.2(TTN):c.100903C>T (p.Leu33635Phe) rs879048474
NM_001267550.2(TTN):c.100972G>A (p.Gly33658Arg) rs780484535
NM_001267550.2(TTN):c.10099C>T (p.Arg3367Trp) rs762791706
NM_001267550.2(TTN):c.101008T>C (p.Cys33670Arg)
NM_001267550.2(TTN):c.101012C>A (p.Ala33671Asp)
NM_001267550.2(TTN):c.101016A>G (p.Lys33672=)
NM_001267550.2(TTN):c.101040G>T (p.Lys33680Asn) rs776913696
NM_001267550.2(TTN):c.101053G>A (p.Asp33685Asn)
NM_001267550.2(TTN):c.101117T>C (p.Val33706Ala)
NM_001267550.2(TTN):c.10112C>T (p.Thr3371Ile) rs1060500429
NM_001267550.2(TTN):c.101136G>C (p.Glu33712Asp)
NM_001267550.2(TTN):c.101213G>A (p.Arg33738His) rs192391568
NM_001267550.2(TTN):c.101218G>A (p.Gly33740Arg) rs536705240
NM_001267550.2(TTN):c.101236C>T (p.Arg33746Cys) rs199594729
NM_001267550.2(TTN):c.101251A>C (p.Asn33751His) rs753658469
NM_001267550.2(TTN):c.10127C>T (p.Ser3376Leu) rs781368765
NM_001267550.2(TTN):c.101281C>T (p.Arg33761Trp) rs201421156
NM_001267550.2(TTN):c.101284G>A (p.Val33762Ile)
NM_001267550.2(TTN):c.101291C>G (p.Ala33764Gly) rs773542514
NM_001267550.2(TTN):c.101306G>A (p.Gly33769Asp) rs1553499045
NM_001267550.2(TTN):c.101326C>G (p.Pro33776Ala) rs746665837
NM_001267550.2(TTN):c.101345C>T (p.Thr33782Ile)
NM_001267550.2(TTN):c.101378A>T (p.Asp33793Val) rs200675195
NM_001267550.2(TTN):c.101380G>A (p.Glu33794Lys)
NM_001267550.2(TTN):c.101387T>C (p.Val33796Ala) rs1454018253
NM_001267550.2(TTN):c.101439G>A (p.Lys33813=) rs72629781
NM_001267550.2(TTN):c.101472T>A (p.Asp33824Glu)
NM_001267550.2(TTN):c.101506T>A (p.Cys33836Ser) rs766439271
NM_001267550.2(TTN):c.101557A>G (p.Lys33853Glu) rs727505163
NM_001267550.2(TTN):c.101572G>C (p.Val33858Leu) rs1060500584
NM_001267550.2(TTN):c.101599C>G (p.Leu33867Val) rs76194811
NM_001267550.2(TTN):c.101675T>C (p.Phe33892Ser)
NM_001267550.2(TTN):c.101693T>C (p.Leu33898Pro)
NM_001267550.2(TTN):c.101875G>A (p.Glu33959Lys) rs886055224
NM_001267550.2(TTN):c.101912A>T (p.Asn33971Ile) rs1553497184
NM_001267550.2(TTN):c.101948C>T (p.Ala33983Val) rs1553497101
NM_001267550.2(TTN):c.101993T>C (p.Met33998Thr) rs1559039438
NM_001267550.2(TTN):c.101997G>C (p.Trp33999Cys) rs764821435
NM_001267550.2(TTN):c.102011T>A (p.Leu34004Gln) rs727504897
NM_001267550.2(TTN):c.102030T>G (p.Ser34010Arg) rs1296387134
NM_001267550.2(TTN):c.102038A>C (p.Asn34013Thr) rs1559038960
NM_001267550.2(TTN):c.102105T>A (p.Asp34035Glu) rs370647845
NM_001267550.2(TTN):c.102116T>C (p.Phe34039Ser) rs1553496582
NM_001267550.2(TTN):c.102121G>A (p.Glu34041Lys) rs377600383
NM_001267550.2(TTN):c.102139A>G (p.Met34047Val) rs755244797
NM_001267550.2(TTN):c.102148G>A (p.Val34050Ile)
NM_001267550.2(TTN):c.102155G>A (p.Arg34052Gln) rs369245991
NM_001267550.2(TTN):c.102173G>A (p.Arg34058Lys) rs886039007
NM_001267550.2(TTN):c.102182G>A (p.Arg34061His) rs774174825
NM_001267550.2(TTN):c.102190G>A (p.Ala34064Thr) rs200237973
NM_001267550.2(TTN):c.102191C>T (p.Ala34064Val)
NM_001267550.2(TTN):c.102202C>T (p.Leu34068Phe)
NM_001267550.2(TTN):c.102214T>C (p.Trp34072Arg) rs375159973
NM_001267550.2(TTN):c.102230T>C (p.Ile34077Thr) rs1290306844
NM_001267550.2(TTN):c.102232G>C (p.Glu34078Gln) rs1454101167
NM_001267550.2(TTN):c.102272G>A (p.Arg34091Gln) rs763708375
NM_001267550.2(TTN):c.102275G>A (p.Arg34092His) rs757918924
NM_001267550.2(TTN):c.102329G>C (p.Arg34110Pro) rs565347600
NM_001267550.2(TTN):c.102368T>G (p.Val34123Gly) rs1060500587
NM_001267550.2(TTN):c.102377C>T (p.Ala34126Val)
NM_001267550.2(TTN):c.102397A>C (p.Ile34133Leu)
NM_001267550.2(TTN):c.102423G>T (p.Gln34141His) rs1553495068
NM_001267550.2(TTN):c.102428T>C (p.Met34143Thr) rs397517786
NM_001267550.2(TTN):c.102431A>G (p.His34144Arg) rs1553495003
NM_001267550.2(TTN):c.102451G>C (p.Gly34151Arg) rs191522469
NM_001267550.2(TTN):c.102510G>C (p.Trp34170Cys) rs1559033550
NM_001267550.2(TTN):c.102520G>A (p.Val34174Ile) rs200430493
NM_001267550.2(TTN):c.102524G>A (p.Arg34175Gln) rs201954720
NM_001267550.2(TTN):c.102541G>A (p.Glu34181Lys) rs1559033148
NM_001267550.2(TTN):c.102586G>A (p.Val34196Ile) rs1185169765
NM_001267550.2(TTN):c.102592G>A (p.Asp34198Asn) rs948836784
NM_001267550.2(TTN):c.102607_102615del (p.Asp34203_Gly34205del) rs1559032218
NM_001267550.2(TTN):c.102638A>G (p.Asn34213Ser) rs375332499
NM_001267550.2(TTN):c.102657T>A (p.Ser34219Arg) rs370077023
NM_001267550.2(TTN):c.102682G>C (p.Gly34228Arg) rs555664963
NM_001267550.2(TTN):c.102725A>G (p.Lys34242Arg) rs1553493858
NM_001267550.2(TTN):c.102745G>C (p.Asp34249His)
NM_001267550.2(TTN):c.102749C>A (p.Thr34250Lys)
NM_001267550.2(TTN):c.102752T>A (p.Met34251Lys) rs750864230
NM_001267550.2(TTN):c.102752T>C (p.Met34251Thr)
NM_001267550.2(TTN):c.102761T>C (p.Leu34254Pro) rs556155561
NM_001267550.2(TTN):c.102772C>T (p.Pro34258Ser)
NM_001267550.2(TTN):c.102794A>G (p.Tyr34265Cys) rs1559030437
NM_001267550.2(TTN):c.102795_102797TAA[1] (p.Asn34266del) rs886044414
NM_001267550.2(TTN):c.102811G>A (p.Val34271Ile) rs794727542
NM_001267550.2(TTN):c.102811G>T (p.Val34271Leu)
NM_001267550.2(TTN):c.102823G>A (p.Val34275Ile) rs879063086
NM_001267550.2(TTN):c.102877A>G (p.Lys34293Glu) rs72629783
NM_001267550.2(TTN):c.10288A>C (p.Asn3430His) rs376029089
NM_001267550.2(TTN):c.102890A>C (p.Lys34297Thr) rs1559029083
NM_001267550.2(TTN):c.102992A>G (p.Tyr34331Cys) rs765213170
NM_001267550.2(TTN):c.103121G>T (p.Cys34374Phe) rs368493317
NM_001267550.2(TTN):c.103216G>A (p.Gly34406Arg)
NM_001267550.2(TTN):c.103226T>C (p.Ile34409Thr) rs879013405
NM_001267550.2(TTN):c.10328C>T (p.Thr3443Ile) rs746052197
NM_001267550.2(TTN):c.103340G>A (p.Cys34447Tyr) rs770558110
NM_001267550.2(TTN):c.103351C>G (p.Leu34451Val) rs1559023612
NM_001267550.2(TTN):c.103364G>A (p.Arg34455His) rs756023873
NM_001267550.2(TTN):c.103391A>C (p.Lys34464Thr)
NM_001267550.2(TTN):c.103409A>T (p.Glu34470Val) rs1553491559
NM_001267550.2(TTN):c.103417G>A (p.Val34473Ile) rs188917199
NM_001267550.2(TTN):c.103430T>C (p.Ile34477Thr) rs751914956
NM_001267550.2(TTN):c.103434C>A (p.Asp34478Glu) rs376371272
NM_001267550.2(TTN):c.103476T>A (p.Ser34492Arg) rs878854283
NM_001267550.2(TTN):c.103478T>C (p.Val34493Ala) rs1553491321
NM_001267550.2(TTN):c.1034G>A (p.Trp345Ter)
NM_001267550.2(TTN):c.103536G>A (p.Pro34512=)
NM_001267550.2(TTN):c.103540G>T (p.Val34514Leu) rs769311670
NM_001267550.2(TTN):c.103576G>C (p.Glu34526Gln) rs770742837
NM_001267550.2(TTN):c.103580T>C (p.Ile34527Thr) rs370618537
NM_001267550.2(TTN):c.103583A>G (p.Glu34528Gly) rs745616639
NM_001267550.2(TTN):c.103598A>G (p.Glu34533Gly) rs1484143627
NM_001267550.2(TTN):c.103623T>G (p.Asp34541Glu) rs1559020199
NM_001267550.2(TTN):c.103636C>T (p.Arg34546Cys) rs777626473
NM_001267550.2(TTN):c.103659_103661AGA[2] (p.Glu34555del) rs759860918
NM_001267550.2(TTN):c.103679A>G (p.Lys34560Arg) rs544590023
NM_001267550.2(TTN):c.103687G>A (p.Val34563Met) rs369429739
NM_001267550.2(TTN):c.103693A>G (p.Met34565Val)
NM_001267550.2(TTN):c.103750C>T (p.Leu34584Phe) rs1559018367
NM_001267550.2(TTN):c.103759G>A (p.Val34587Ile)
NM_001267550.2(TTN):c.103772G>A (p.Arg34591Gln) rs778021095
NM_001267550.2(TTN):c.103774C>T (p.Pro34592Ser) rs748291093
NM_001267550.2(TTN):c.103796G>C (p.Arg34599Thr) rs1362778188
NM_001267550.2(TTN):c.103828C>T (p.Arg34610Cys) rs376443365
NM_001267550.2(TTN):c.103882G>T (p.Asp34628Tyr) rs1553490035
NM_001267550.2(TTN):c.103906C>T (p.Arg34636Cys) rs768575577
NM_001267550.2(TTN):c.103909C>T (p.Arg34637Trp) rs200716930
NM_001267550.2(TTN):c.10391A>C (p.Lys3464Thr) rs1553970272
NM_001267550.2(TTN):c.103946G>A (p.Arg34649Gln) rs397517788
NM_001267550.2(TTN):c.103958G>T (p.Arg34653Leu) rs72629786
NM_001267550.2(TTN):c.103999A>G (p.Ile34667Val) rs749651526
NM_001267550.2(TTN):c.1039C>T (p.Gln347Ter) rs1561470471
NM_001267550.2(TTN):c.104000T>C (p.Ile34667Thr) rs727504476
NM_001267550.2(TTN):c.104005G>A (p.Asp34669Asn)
NM_001267550.2(TTN):c.104015C>T (p.Ala34672Val) rs79666048
NM_001267550.2(TTN):c.104024G>A (p.Arg34675Lys) rs765125364
NM_001267550.2(TTN):c.104027C>G (p.Thr34676Arg) rs761644963
NM_001267550.2(TTN):c.104059C>A (p.Leu34687Ile)
NM_001267550.2(TTN):c.104069G>T (p.Gly34690Val) rs964554853
NM_001267550.2(TTN):c.104089A>G (p.Ser34697Gly) rs1177374613
NM_001267550.2(TTN):c.104098C>T (p.Pro34700Ser) rs778877604
NM_001267550.2(TTN):c.104125C>T (p.Arg34709Cys) rs530959653
NM_001267550.2(TTN):c.104194C>G (p.His34732Asp) rs753769495
NM_001267550.2(TTN):c.104195A>G (p.His34732Arg) rs1250361204
NM_001267550.2(TTN):c.104222C>T (p.Thr34741Ile) rs727505306
NM_001267550.2(TTN):c.104261C>T (p.Ala34754Val) rs727505020
NM_001267550.2(TTN):c.104263T>A (p.Tyr34755Asn) rs1553488819
NM_001267550.2(TTN):c.104281C>T (p.Arg34761Trp)
NM_001267550.2(TTN):c.104282G>A (p.Arg34761Gln) rs200773170
NM_001267550.2(TTN):c.104333C>T (p.Thr34778Met) rs762158917
NM_001267550.2(TTN):c.104359A>G (p.Lys34787Glu) rs769788281
NM_001267550.2(TTN):c.10435G>A (p.Gly3479Arg) rs746691102
NM_001267550.2(TTN):c.104365G>C (p.Glu34789Gln) rs190565627
NM_001267550.2(TTN):c.104368C>T (p.Leu34790Phe) rs551824963
NM_001267550.2(TTN):c.104414G>A (p.Arg34805Gln) rs115150240
NM_001267550.2(TTN):c.104444T>C (p.Ile34815Thr)
NM_001267550.2(TTN):c.10444G>A (p.Val3482Ile) rs1553970119
NM_001267550.2(TTN):c.104458G>A (p.Glu34820Lys) rs766062367
NM_001267550.2(TTN):c.104483A>G (p.Glu34828Gly)
NM_001267550.2(TTN):c.104519G>A (p.Arg34840Gln) rs199710082
NM_001267550.2(TTN):c.104561T>G (p.Val34854Gly) rs768717312
NM_001267550.2(TTN):c.104575C>T (p.Arg34859Trp) rs879243057
NM_001267550.2(TTN):c.104582G>A (p.Arg34861His) rs777774818
NM_001267550.2(TTN):c.104605G>A (p.Glu34869Lys) rs563430855
NM_001267550.2(TTN):c.104627C>T (p.Ser34876Leu)
NM_001267550.2(TTN):c.104660C>T (p.Pro34887Leu) rs774131659
NM_001267550.2(TTN):c.104690C>T (p.Ser34897Leu) rs373446383
NM_001267550.2(TTN):c.104711G>T (p.Arg34904Ile) rs780506196
NM_001267550.2(TTN):c.104822C>A (p.Ala34941Asp) rs1445357252
NM_001267550.2(TTN):c.104867G>A (p.Gly34956Asp) rs145748940
NM_001267550.2(TTN):c.104883T>G (p.Phe34961Leu)
NM_001267550.2(TTN):c.104904G>C (p.Lys34968Asn) rs1274496471
NM_001267550.2(TTN):c.104914G>A (p.Glu34972Lys) rs727504918
NM_001267550.2(TTN):c.104936G>C (p.Gly34979Ala) rs376634193
NM_001267550.2(TTN):c.104952A>C (p.Glu34984Asp) rs1434654451
NM_001267550.2(TTN):c.104953A>G (p.Ser34985Gly) rs765030518
NM_001267550.2(TTN):c.104986G>T (p.Val34996Phe)
NM_001267550.2(TTN):c.10504C>T (p.Gln3502Ter)
NM_001267550.2(TTN):c.105091G>A (p.Val35031Met) rs552058608
NM_001267550.2(TTN):c.105128G>A (p.Arg35043His) rs370137295
NM_001267550.2(TTN):c.105134A>T (p.Asp35045Val) rs1001393566
NM_001267550.2(TTN):c.105182C>A (p.Ala35061Glu)
NM_001267550.2(TTN):c.1051G>A (p.Val351Met) rs772889673
NM_001267550.2(TTN):c.105260C>T (p.Thr35087Met) rs397517795
NM_001267550.2(TTN):c.105301T>C (p.Ser35101Pro) rs759062212
NM_001267550.2(TTN):c.105317G>A (p.Ser35106Asn)
NM_001267550.2(TTN):c.10535T>C (p.Val3512Ala) rs200918396
NM_001267550.2(TTN):c.105374C>T (p.Thr35125Met) rs747161494
NM_001267550.2(TTN):c.105413T>C (p.Met35138Thr) rs771741670
NM_001267550.2(TTN):c.105424G>C (p.Glu35142Gln)
NM_001267550.2(TTN):c.105429C>T (p.Gly35143=) rs368591364
NM_001267550.2(TTN):c.105482C>A (p.Thr35161Asn) rs372263729
NM_001267550.2(TTN):c.105490C>T (p.Arg35164Cys) rs200123047
NM_001267550.2(TTN):c.105491G>A (p.Arg35164His) rs768358201
NM_001267550.2(TTN):c.105493A>G (p.Lys35165Glu)
NM_001267550.2(TTN):c.105497G>T (p.Gly35166Val) rs1060500538
NM_001267550.2(TTN):c.105499C>G (p.Gln35167Glu) rs1558994144
NM_001267550.2(TTN):c.105514_105516del (p.Ser35172del) rs573843615
NM_001267550.2(TTN):c.105515C>A (p.Ser35172Tyr)
NM_001267550.2(TTN):c.105521G>A (p.Arg35174His) rs756575734
NM_001267550.2(TTN):c.105539C>A (p.Thr35180Lys)
NM_001267550.2(TTN):c.105571G>A (p.Val35191Ile) rs1290162863
NM_001267550.2(TTN):c.105600C>G (p.Ser35200Arg) rs1553485050
NM_001267550.2(TTN):c.105608T>C (p.Val35203Ala) rs771136390
NM_001267550.2(TTN):c.105642C>A (p.Phe35214Leu) rs560557634
NM_001267550.2(TTN):c.105662C>A (p.Ala35221Asp) rs1558992011
NM_001267550.2(TTN):c.105718C>T (p.Arg35240Trp) rs752729073
NM_001267550.2(TTN):c.105719G>A (p.Arg35240Gln) rs530537991
NM_001267550.2(TTN):c.105737C>G (p.Ala35246Gly) rs370476812
NM_001267550.2(TTN):c.105757G>A (p.Val35253Met) rs373655492
NM_001267550.2(TTN):c.105790G>C (p.Val35264Leu) rs770730954
NM_001267550.2(TTN):c.105821C>T (p.Thr35274Ile) rs2857271
NM_001267550.2(TTN):c.105851C>G (p.Ala35284Gly) rs1553484434
NM_001267550.2(TTN):c.105873C>A (p.Phe35291Leu)
NM_001267550.2(TTN):c.10589A>T (p.Tyr3530Phe) rs755931621
NM_001267550.2(TTN):c.105916G>A (p.Val35306Met) rs1434315858
NM_001267550.2(TTN):c.105920T>C (p.Val35307Ala) rs780629996
NM_001267550.2(TTN):c.105929G>C (p.Ser35310Thr) rs1553484229
NM_001267550.2(TTN):c.10592C>G (p.Ser3531Ter) rs767420661
NM_001267550.2(TTN):c.105940G>A (p.Ala35314Thr) rs377171054
NM_001267550.2(TTN):c.105953C>G (p.Thr35318Ser) rs1391706140
NM_001267550.2(TTN):c.106018G>A (p.Gly35340Ser) rs373610666
NM_001267550.2(TTN):c.106025A>G (p.Tyr35342Cys) rs1060500560
NM_001267550.2(TTN):c.106044C>A (p.Asn35348Lys) rs145560044
NM_001267550.2(TTN):c.106057G>A (p.Asp35353Asn)
NM_001267550.2(TTN):c.106061A>G (p.Gln35354Arg) rs546343124
NM_001267550.2(TTN):c.106073T>A (p.Val35358Asp) rs1172243981
NM_001267550.2(TTN):c.106094G>A (p.Gly35365Asp) rs778524334
NM_001267550.2(TTN):c.10609T>C (p.Tyr3537His) rs1553969617
NM_001267550.2(TTN):c.106133C>G (p.Ala35378Gly) rs555476312
NM_001267550.2(TTN):c.106188T>A (p.Asp35396Glu) rs770681247
NM_001267550.2(TTN):c.106229C>G (p.Pro35410Arg) rs1553483445
NM_001267550.2(TTN):c.106240G>C (p.Glu35414Gln) rs1558984927
NM_001267550.2(TTN):c.106286C>A (p.Thr35429Lys) rs1241466221
NM_001267550.2(TTN):c.106379T>C (p.Ile35460Thr) rs1398739704
NM_001267550.2(TTN):c.106439A>G (p.His35480Arg) rs766337455
NM_001267550.2(TTN):c.106442A>G (p.Lys35481Arg) rs200716018
NM_001267550.2(TTN):c.106451C>A (p.Thr35484Asn) rs754163825
NM_001267550.2(TTN):c.106511G>C (p.Ser35504Thr) rs575070622
NM_001267550.2(TTN):c.106525A>G (p.Ile35509Val) rs1553482514
NM_001267550.2(TTN):c.106531+6T>C rs772189154
NM_001267550.2(TTN):c.106531G>A (p.Ala35511Thr)
NM_001267550.2(TTN):c.106537A>G (p.Lys35513Glu)
NM_001267550.2(TTN):c.10654G>C (p.Ala3552Pro) rs774004409
NM_001267550.2(TTN):c.106556A>G (p.Lys35519Arg) rs1422047351
NM_001267550.2(TTN):c.106573A>G (p.Thr35525Ala)
NM_001267550.2(TTN):c.10657A>G (p.Thr3553Ala) rs1553969472
NM_001267550.2(TTN):c.106601C>T (p.Ala35534Val) rs878854284
NM_001267550.2(TTN):c.106603G>A (p.Val35535Ile) rs1553481274
NM_001267550.2(TTN):c.106604T>C (p.Val35535Ala) rs368179478
NM_001267550.2(TTN):c.106648A>G (p.Ile35550Val)
NM_001267550.2(TTN):c.106675G>C (p.Glu35559Gln) rs199632397
NM_001267550.2(TTN):c.1066G>C (p.Glu356Gln) rs144531477
NM_001267550.2(TTN):c.106723G>A (p.Glu35575Lys) rs886055217
NM_001267550.2(TTN):c.106727T>G (p.Val35576Gly)
NM_001267550.2(TTN):c.106801G>A (p.Glu35601Lys) rs1558972236
NM_001267550.2(TTN):c.106820C>T (p.Ala35607Val) rs377337528
NM_001267550.2(TTN):c.106853T>C (p.Ile35618Thr)
NM_001267550.2(TTN):c.106857C>A (p.Asn35619Lys)
NM_001267550.2(TTN):c.106895G>T (p.Gly35632Val) rs1210557316
NM_001267550.2(TTN):c.106955G>A (p.Arg35652Gln) rs200497615
NM_001267550.2(TTN):c.106957T>G (p.Tyr35653Asp) rs886042500
NM_001267550.2(TTN):c.106991T>G (p.Ile35664Ser) rs1060500501
NM_001267550.2(TTN):c.107066A>G (p.Gln35689Arg) rs1451601178
NM_001267550.2(TTN):c.107080C>G (p.Leu35694Val) rs769369764
NM_001267550.2(TTN):c.107098G>A (p.Asp35700Asn)
NM_001267550.2(TTN):c.107099A>G (p.Asp35700Gly) rs1060500391
NM_001267550.2(TTN):c.107104C>G (p.Pro35702Ala) rs551126367
NM_001267550.2(TTN):c.107105C>T (p.Pro35702Leu) rs772957495
NM_001267550.2(TTN):c.107123C>T (p.Pro35708Leu) rs71423567
NM_001267550.2(TTN):c.107181C>T (p.Gly35727=) rs762859509
NM_001267550.2(TTN):c.107225T>C (p.Ile35742Thr) rs1553479315
NM_001267550.2(TTN):c.107230A>G (p.Ile35744Val) rs142336788
NM_001267550.2(TTN):c.107255G>A (p.Arg35752His) rs760107623
NM_001267550.2(TTN):c.107284C>A (p.Arg35762=) rs1477669354
NM_001267550.2(TTN):c.107290G>T (p.Ala35764Ser) rs879048717
NM_001267550.2(TTN):c.107292A>G (p.Ala35764=) rs1553479171
NM_001267550.2(TTN):c.107320A>G (p.Ile35774Val) rs774401824
NM_001267550.2(TTN):c.107339G>A (p.Arg35780His) rs770904787
NM_001267550.2(TTN):c.107387A>C (p.Glu35796Ala) rs1553478042
NM_001267550.2(TTN):c.107517T>G (p.Ser35839Arg) rs776981475
NM_001267550.2(TTN):c.107540A>G (p.Lys35847Arg)
NM_001267550.2(TTN):c.107557G>A (p.Ala35853Thr) rs1553477669
NM_001267550.2(TTN):c.107564G>T (p.Ser35855Ile) rs1053387515
NM_001267550.2(TTN):c.107590G>C (p.Val35864Leu) rs746430344
NM_001267550.2(TTN):c.107591T>C (p.Val35864Ala) rs374859388
NM_001267550.2(TTN):c.10759A>C (p.Thr3587Pro) rs370496599
NM_001267550.2(TTN):c.107630T>C (p.Met35877Thr) rs375824821
NM_001267550.2(TTN):c.107671G>A (p.Gly35891Ser) rs201298767
NM_001267550.2(TTN):c.10770G>C (p.Glu3590Asp) rs377401997
NM_001267550.2(TTN):c.107753G>A (p.Cys35918Tyr) rs193212275
NM_001267550.2(TTN):c.107774C>A (p.Thr35925Asn) rs755111765
NM_001267550.2(TTN):c.107774C>T (p.Thr35925Ile) rs755111765
NM_001267550.2(TTN):c.107833T>A (p.Phe35945Ile)
NM_001267550.2(TTN):c.107839A>G (p.Ile35947Val) rs1553476576
NM_001267550.2(TTN):c.107840T>G (p.Ile35947Ser) rs281864928
NM_001267550.2(TTN):c.107864C>T (p.Thr35955Ile) rs370267738
NM_001267550.2(TTN):c.107881G>A (p.Val35961Ile) rs780886524
NM_001267550.2(TTN):c.107900G>A (p.Gly35967Glu) rs780316966
NM_001267550.2(TTN):c.107957T>C (p.Ile35986Thr) rs1060500541
NM_001267550.2(TTN):c.107965C>T (p.Arg35989Ter) rs770506970
NM_001267550.2(TTN):c.10825G>A (p.Glu3609Lys) rs1016683077
NM_001267550.2(TTN):c.10834G>C (p.Val3612Leu) rs1352067592
NM_001267550.2(TTN):c.10840G>T (p.Glu3614Ter) rs540059730
NM_001267550.2(TTN):c.11209G>A (p.Asp3737Asn) rs1243794346
NM_001267550.2(TTN):c.11252_11253delinsAA (p.Gly3751Glu) rs1553967105
NM_001267550.2(TTN):c.11288_11289del (p.Gln3763fs)
NM_001267550.2(TTN):c.11324C>T (p.Ser3775Phe) rs892763465
NM_001267550.2(TTN):c.11359G>A (p.Ala3787Thr) rs779416521
NM_001267550.2(TTN):c.11362G>A (p.Glu3788Lys) rs540469851
NM_001267550.2(TTN):c.11444del (p.Lys3815fs)
NM_001267550.2(TTN):c.11461A>G (p.Ile3821Val) rs867402675
NM_001267550.2(TTN):c.11637del (p.Leu3880fs) rs1560926034
NM_001267550.2(TTN):c.1165A>G (p.Ser389Gly) rs1255499093
NM_001267550.2(TTN):c.11667G>T (p.Glu3889Asp) rs377423256
NM_001267550.2(TTN):c.11678T>C (p.Met3893Thr) rs1553941782
NM_001267550.2(TTN):c.11684G>A (p.Ser3895Asn) rs769466475
NM_001267550.2(TTN):c.11687A>G (p.Asn3896Ser) rs1207560844
NM_001267550.2(TTN):c.11706A>G (p.Ile3902Met) rs368845723
NM_001267550.2(TTN):c.11825A>C (p.Lys3942Thr) rs1060500569
NM_001267550.2(TTN):c.11843G>A (p.Arg3948His) rs775618077
NM_001267550.2(TTN):c.11843G>T (p.Arg3948Leu) rs775618077
NM_001267550.2(TTN):c.11855G>A (p.Gly3952Glu) rs779033634
NM_001267550.2(TTN):c.1185C>A (p.Ala395=) rs372346898
NM_001267550.2(TTN):c.1186G>A (p.Ala396Thr) rs200052202
NM_001267550.2(TTN):c.11881G>A (p.Val3961Met) rs1017307763
NM_001267550.2(TTN):c.118T>C (p.Phe40Leu) rs1554045595
NM_001267550.2(TTN):c.11903C>T (p.Thr3968Ile) rs1416083040
NM_001267550.2(TTN):c.11912G>A (p.Trp3971Ter) rs869312102
NM_001267550.2(TTN):c.12011A>G (p.Glu4004Gly) rs376000381
NM_001267550.2(TTN):c.12016_12019dup (p.Gly4007fs) rs1553940935
NM_001267550.2(TTN):c.12052G>A (p.Gly4018Ser) rs759214389
NM_001267550.2(TTN):c.12066T>G (p.Cys4022Trp) rs931245340
NM_001267550.2(TTN):c.1208G>C (p.Ser403Thr) rs727505091
NM_001267550.2(TTN):c.12113C>A (p.Thr4038Asn) rs758968807
NM_001267550.2(TTN):c.12113C>G (p.Thr4038Ser) rs758968807
NM_001267550.2(TTN):c.12145C>T (p.Pro4049Ser) rs201888760
NM_001267550.2(TTN):c.12175G>T (p.Gly4059Cys) rs377114166
NM_001267550.2(TTN):c.12181G>A (p.Ala4061Thr) rs397517829
NM_001267550.2(TTN):c.12208G>A (p.Glu4070Lys) rs397517830
NM_001267550.2(TTN):c.12316C>T (p.Gln4106Ter) rs1553940122
NM_001267550.2(TTN):c.12332C>G (p.Ala4111Gly) rs140289517
NM_001267550.2(TTN):c.12358C>T (p.Gln4120Ter)
NM_001267550.2(TTN):c.12397_12505dup (p.Pro4169fs) rs1553939638
NM_001267550.2(TTN):c.12404A>G (p.Asn4135Ser) rs565638291
NM_001267550.2(TTN):c.12416A>G (p.His4139Arg) rs72648920
NM_001267550.2(TTN):c.12434A>C (p.Glu4145Ala) rs372744369
NM_001267550.2(TTN):c.12470C>T (p.Ser4157Phe) rs771706692
NM_001267550.2(TTN):c.12484T>C (p.Ser4162Pro) rs548726318
NM_001267550.2(TTN):c.12517_12518GA[1] (p.Glu4173fs) rs1553939605
NM_001267550.2(TTN):c.12547A>G (p.Lys4183Glu) rs201565932
NM_001267550.2(TTN):c.12572T>C (p.Ile4191Thr) rs371669309
NM_001267550.2(TTN):c.12587C>A (p.Ser4196Ter) rs370912401
NM_001267550.2(TTN):c.12612_12625del (p.Thr4204_Leu4205insTer)
NM_001267550.2(TTN):c.12679A>T (p.Thr4227Ser) rs1553939161
NM_001267550.2(TTN):c.12680C>A (p.Thr4227Asn) rs777055785
NM_001267550.2(TTN):c.12704C>A (p.Ser4235Ter) rs1253161767
NM_001267550.2(TTN):c.12742C>T (p.Gln4248Ter) rs794729308
NM_001267550.2(TTN):c.12766G>A (p.Glu4256Lys) rs1560908997
NM_001267550.2(TTN):c.12801A>T (p.Leu4267Phe) rs750553032
NM_001267550.2(TTN):c.12813C>A (p.His4271Gln) rs373302409
NM_001267550.2(TTN):c.12817G>A (p.Glu4273Lys) rs1553938808
NM_001267550.2(TTN):c.12821G>A (p.Ser4274Asn) rs200348414
NM_001267550.2(TTN):c.12823C>T (p.Leu4275Phe) rs773905874
NM_001267550.2(TTN):c.12830G>A (p.Ser4277Asn) rs878854286
NM_001267550.2(TTN):c.12845T>A (p.Ile4282Asn) rs747907234
NM_001267550.2(TTN):c.12870dup (p.Val4291fs) rs869025556
NM_001267550.2(TTN):c.12895G>C (p.Glu4299Gln) rs1430420761
NM_001267550.2(TTN):c.12937A>G (p.Asn4313Asp) rs1553938408
NM_001267550.2(TTN):c.1297G>A (p.Val433Ile) rs146000949
NM_001267550.2(TTN):c.13015G>A (p.Val4339Ile) rs756186781
NM_001267550.2(TTN):c.13048G>A (p.Val4350Met) rs781206839
NM_001267550.2(TTN):c.1304T>C (p.Met435Thr) rs770187975
NM_001267550.2(TTN):c.13075T>C (p.Ser4359Pro) rs1060500434
NM_001267550.2(TTN):c.13098_13101AAAG[1] (p.Lys4368fs) rs1553937967
NM_001267550.2(TTN):c.13117C>T (p.Gln4373Ter) rs1064793411
NM_001267550.2(TTN):c.13144dup (p.Ser4382fs) rs1560902834
NM_001267550.2(TTN):c.1318G>A (p.Glu440Lys) rs747410439
NM_001267550.2(TTN):c.13219G>A (p.Val4407Met) rs539154603
NM_001267550.2(TTN):c.13262A>G (p.Asn4421Ser) rs72648922
NM_001267550.2(TTN):c.13265T>G (p.Ile4422Ser) rs727503656
NM_001267550.2(TTN):c.13282G>A (p.Glu4428Lys) rs528766978
NM_001267550.2(TTN):c.1330A>G (p.Ser444Gly) rs767156649
NM_001267550.2(TTN):c.13320G>A (p.Met4440Ile) rs768996215
NM_001267550.2(TTN):c.1333G>A (p.Ala445Thr) rs142414432
NM_001267550.2(TTN):c.13435G>A (p.Ala4479Thr) rs776871094
NM_001267550.2(TTN):c.13459A>G (p.Ile4487Val) rs1553937057
NM_001267550.2(TTN):c.13487A>G (p.Gln4496Arg) rs878854287
NM_001267550.2(TTN):c.13488G>T (p.Gln4496His) rs1383626434
NM_001267550.2(TTN):c.13510C>A (p.Gln4504Lys) rs761901186
NM_001267550.2(TTN):c.13525del (p.Ser4509fs) rs1553936898
NM_001267550.2(TTN):c.13555A>G (p.Ile4519Val) rs759140842
NM_001267550.2(TTN):c.13701T>G (p.Asp4567Glu) rs200422152
NM_001267550.2(TTN):c.13817C>G (p.Pro4606Arg) rs762079270
NM_001267550.2(TTN):c.13821G>T (p.Met4607Ile) rs1553936266
NM_001267550.2(TTN):c.13829C>G (p.Thr4610Arg) rs748210214
NM_001267550.2(TTN):c.13883C>T (p.Ser4628Phe) rs794729602
NM_001267550.2(TTN):c.13900G>T (p.Glu4634Ter) rs869312103
NM_001267550.2(TTN):c.13934C>A (p.Pro4645His) rs1553936055
NM_001267550.2(TTN):c.13940A>G (p.Asp4647Gly) rs781348816
NM_001267550.2(TTN):c.13943_13947dup (p.Phe4650fs) rs767038068
NM_001267550.2(TTN):c.13945A>G (p.Lys4649Glu) rs1060500392
NM_001267550.2(TTN):c.14002A>G (p.Thr4668Ala) rs758920941
NM_001267550.2(TTN):c.14014C>A (p.Gln4672Lys) rs1553935908
NM_001267550.2(TTN):c.14050G>A (p.Gly4684Arg) rs377579941
NM_001267550.2(TTN):c.14095G>T (p.Ala4699Ser) rs1172448062
NM_001267550.2(TTN):c.14118C>G (p.Ile4706Met) rs267599072
NM_001267550.2(TTN):c.14152A>G (p.Lys4718Glu) rs757119133
NM_001267550.2(TTN):c.14171A>G (p.Gln4724Arg) rs1553934896
NM_001267550.2(TTN):c.14188C>A (p.Arg4730=)
NM_001267550.2(TTN):c.14189G>A (p.Arg4730Gln) rs202017278
NM_001267550.2(TTN):c.14198G>A (p.Trp4733Ter)
NM_001267550.2(TTN):c.14232C>A (p.Asp4744Glu) rs55906845
NM_001267550.2(TTN):c.14287del (p.Gln4763fs) rs1560880125
NM_001267550.2(TTN):c.14296G>A (p.Asp4766Asn) rs981499527
NM_001267550.2(TTN):c.1429A>T (p.Thr477Ser) rs727503705
NM_001267550.2(TTN):c.14302G>A (p.Gly4768Ser) rs727503652
NM_001267550.2(TTN):c.14309A>G (p.Tyr4770Cys) rs371552518
NM_001267550.2(TTN):c.14320G>A (p.Ala4774Thr) rs1404878972
NM_001267550.2(TTN):c.14372-2A>C rs747942388
NM_001267550.2(TTN):c.14464C>T (p.Pro4822Ser) rs762428750
NM_001267550.2(TTN):c.1447G>A (p.Ala483Thr) rs34337578
NM_001267550.2(TTN):c.14486A>C (p.Gln4829Pro) rs375177753
NM_001267550.2(TTN):c.14533G>A (p.Asp4845Asn) rs373378672
NM_001267550.2(TTN):c.14536G>A (p.Ala4846Thr) rs752150323
NM_001267550.2(TTN):c.14624C>G (p.Ala4875Gly) rs369989679
NM_001267550.2(TTN):c.14662C>G (p.Pro4888Ala) rs376799249
NM_001267550.2(TTN):c.14709G>C (p.Lys4903Asn) rs1060500444
NM_001267550.2(TTN):c.14710A>T (p.Lys4904Ter) rs1560853002
NM_001267550.2(TTN):c.14713G>T (p.Val4905Phe) rs774495507
NM_001267550.2(TTN):c.14753C>T (p.Thr4918Ile) rs749179515
NM_001267550.2(TTN):c.14759C>T (p.Thr4920Met) rs371455094
NM_001267550.2(TTN):c.14788C>G (p.Pro4930Ala) rs201744218
NM_001267550.2(TTN):c.14813T>C (p.Phe4938Ser) rs560537668
NM_001267550.2(TTN):c.14869A>C (p.Thr4957Pro) rs780405420
NM_001267550.2(TTN):c.14873A>G (p.Tyr4958Cys) rs530572005
NM_001267550.2(TTN):c.14983C>T (p.Pro4995Ser) rs776578141
NM_001267550.2(TTN):c.14998C>T (p.Arg5000Cys) rs369933152
NM_001267550.2(TTN):c.14999G>A (p.Arg5000His) rs377062348
NM_001267550.2(TTN):c.15007T>A (p.Cys5003Ser) rs1553930348
NM_001267550.2(TTN):c.15040A>T (p.Thr5014Ser) rs143093473
NM_001267550.2(TTN):c.15125C>T (p.Thr5042Met) rs1060500462
NM_001267550.2(TTN):c.15177C>A (p.Asp5059Glu) rs74607159
NM_001267550.2(TTN):c.15179_15180insA (p.Gly5061fs) rs1385955660
NM_001267550.2(TTN):c.15181G>T (p.Gly5061Cys) rs1441268700
NM_001267550.2(TTN):c.15196A>G (p.Ser5066Gly) rs756793304
NM_001267550.2(TTN):c.15218-2A>G
NM_001267550.2(TTN):c.15224C>T (p.Pro5075Leu) rs1553929816
NM_001267550.2(TTN):c.15263G>A (p.Arg5088Lys) rs766300782
NM_001267550.2(TTN):c.15277C>G (p.Leu5093Val) rs764663290
NM_001267550.2(TTN):c.15464A>C (p.Lys5155Thr) rs727504207
NM_001267550.2(TTN):c.15475A>G (p.Met5159Val) rs1553929310
NM_001267550.2(TTN):c.15497-2A>G rs1232334931
NM_001267550.2(TTN):c.15500C>T (p.Pro5167Leu) rs730880237
NM_001267550.2(TTN):c.15576del (p.Ser5194fs)
NM_001267550.2(TTN):c.15605T>C (p.Met5202Thr) rs764755768
NM_001267550.2(TTN):c.15749C>T (p.Thr5250Ile) rs759384825
NM_001267550.2(TTN):c.15796C>T (p.Arg5266Ter) rs372277017
NM_001267550.2(TTN):c.157G>A (p.Gly53Ser) rs150902810
NM_001267550.2(TTN):c.1585G>A (p.Ala529Thr) rs143030869
NM_001267550.2(TTN):c.15922C>T (p.Arg5308Ter) rs886042995
NM_001267550.2(TTN):c.15940A>G (p.Asn5314Asp) rs371044267
NM_001267550.2(TTN):c.15947C>T (p.Ala5316Val) rs879242937
NM_001267550.2(TTN):c.15952del (p.Leu5318fs) rs778392667
NM_001267550.2(TTN):c.15986G>A (p.Gly5329Asp) rs202234492
NM_001267550.2(TTN):c.16010A>G (p.Asn5337Ser) rs752924679
NM_001267550.2(TTN):c.16023C>A (p.Ser5341Arg) rs1553927522
NM_001267550.2(TTN):c.16028C>T (p.Ser5343Phe) rs369132752
NM_001267550.2(TTN):c.16058G>A (p.Arg5353Gln) rs751653047
NM_001267550.2(TTN):c.16090C>T (p.Arg5364Cys) rs886044310
NM_001267550.2(TTN):c.16093A>C (p.Asn5365His) rs878854288
NM_001267550.2(TTN):c.16096G>A (p.Val5366Met) rs372176136
NM_001267550.2(TTN):c.16118C>A (p.Thr5373Asn) rs1057103177
NM_001267550.2(TTN):c.16126C>A (p.Leu5376Met) rs72648936
NM_001267550.2(TTN):c.16133G>A (p.Cys5378Tyr) rs754271006
NM_001267550.2(TTN):c.16136A>C (p.Lys5379Thr) rs752346935
NM_001267550.2(TTN):c.16138A>G (p.Ile5380Val) rs1280725528
NM_001267550.2(TTN):c.16156A>G (p.Met5386Val) rs567457007
NM_001267550.2(TTN):c.16160G>C (p.Arg5387Thr) rs748155563
NM_001267550.2(TTN):c.1616T>A (p.Ile539Asn) rs774503024
NM_001267550.2(TTN):c.16288C>T (p.Arg5430Ter) rs772235481
NM_001267550.2(TTN):c.16310G>A (p.Ser5437Asn) rs794727755
NM_001267550.2(TTN):c.16351A>G (p.Ser5451Gly) rs760722200
NM_001267550.2(TTN):c.16369G>A (p.Gly5457Ser) rs774425875
NM_001267550.2(TTN):c.1640A>G (p.Gln547Arg) rs774937703
NM_001267550.2(TTN):c.16446A>G (p.Arg5482=) rs1426268579
NM_001267550.2(TTN):c.16489T>A (p.Tyr5497Asn) rs1279249843
NM_001267550.2(TTN):c.16550C>T (p.Ser5517Leu) rs769165258
NM_001267550.2(TTN):c.16621+1G>T
NM_001267550.2(TTN):c.16693T>C (p.Cys5565Arg) rs1228967454
NM_001267550.2(TTN):c.16709C>T (p.Thr5570Ile) rs535319438
NM_001267550.2(TTN):c.16750A>G (p.Ile5584Val) rs368116422
NM_001267550.2(TTN):c.16825G>A (p.Glu5609Lys) rs374682077
NM_001267550.2(TTN):c.16834G>A (p.Gly5612Ser) rs1060500588
NM_001267550.2(TTN):c.16868G>T (p.Gly5623Val) rs768364912
NM_001267550.2(TTN):c.16903+2T>C rs1060500574
NM_001267550.2(TTN):c.16907C>T (p.Ser5636Leu) rs1553925181
NM_001267550.2(TTN):c.16934C>T (p.Pro5645Leu) rs370889765
NM_001267550.2(TTN):c.16961T>G (p.Val5654Gly) rs763581306
NM_001267550.2(TTN):c.16975G>A (p.Glu5659Lys) rs763708860
NM_001267550.2(TTN):c.17047T>G (p.Tyr5683Asp) rs371062603
NM_001267550.2(TTN):c.17116G>A (p.Glu5706Lys) rs376593556
NM_001267550.2(TTN):c.17129G>A (p.Arg5710Gln) rs200018866
NM_001267550.2(TTN):c.17189C>T (p.Pro5730Leu) rs779187099
NM_001267550.2(TTN):c.17201_17203AGA[1] (p.Lys5735del) rs1060500441
NM_001267550.2(TTN):c.17213G>A (p.Ser5738Asn) rs1060500502
NM_001267550.2(TTN):c.17216C>T (p.Thr5739Ile) rs751087281
NM_001267550.2(TTN):c.17224C>T (p.Leu5742Phe) rs72648943
NM_001267550.2(TTN):c.17227C>T (p.Arg5743Trp) rs377193479
NM_001267550.2(TTN):c.17279C>T (p.Thr5760Met) rs770310501
NM_001267550.2(TTN):c.17302G>A (p.Asp5768Asn) rs576904726
NM_001267550.2(TTN):c.17320G>A (p.Asp5774Asn) rs752660722
NM_001267550.2(TTN):c.17328A>G (p.Ile5776Met) rs928844023
NM_001267550.2(TTN):c.17331A>T (p.Arg5777Ser) rs367942154
NM_001267550.2(TTN):c.17357G>T (p.Ser5786Ile) rs1553924253
NM_001267550.2(TTN):c.17375T>C (p.Ile5792Thr) rs1225094303
NM_001267550.2(TTN):c.17423C>T (p.Ala5808Val) rs1409068952
NM_001267550.2(TTN):c.1742C>T (p.Pro581Leu) rs199778910
NM_001267550.2(TTN):c.17596G>T (p.Gly5866Cys) rs753136638
NM_001267550.2(TTN):c.17645T>C (p.Ile5882Thr) rs763665430
NM_001267550.2(TTN):c.17669G>C (p.Ser5890Thr) rs775293848
NM_001267550.2(TTN):c.1771C>G (p.Gln591Glu) rs747286444
NM_001267550.2(TTN):c.17773C>A (p.Leu5925Met) rs750909367
NM_001267550.2(TTN):c.17806A>G (p.Ile5936Val) rs72648945
NM_001267550.2(TTN):c.17818T>C (p.Cys5940Arg) rs374882815
NM_001267550.2(TTN):c.17869C>G (p.Gln5957Glu) rs201672969
NM_001267550.2(TTN):c.17871A>T (p.Gln5957His) rs181067357
NM_001267550.2(TTN):c.17875A>G (p.Ile5959Val) rs1060500508
NM_001267550.2(TTN):c.17893T>C (p.Tyr5965His) rs752226947
NM_001267550.2(TTN):c.17928G>A (p.Leu5976=) rs373963067
NM_001267550.2(TTN):c.17992G>A (p.Gly5998Arg) rs757934638
NM_001267550.2(TTN):c.18028+1G>A rs1560786548
NM_001267550.2(TTN):c.18037T>C (p.Tyr6013His) rs548015673
NM_001267550.2(TTN):c.18098C>T (p.Ala6033Val) rs771457862
NM_001267550.2(TTN):c.18172C>T (p.Arg6058Cys) rs189127014
NM_001267550.2(TTN):c.18173G>A (p.Arg6058His) rs376012117
NM_001267550.2(TTN):c.18317A>G (p.Gln6106Arg) rs1553921829
NM_001267550.2(TTN):c.18371C>A (p.Thr6124Lys) rs1280788914
NM_001267550.2(TTN):c.18374T>C (p.Phe6125Ser) rs375003845
NM_001267550.2(TTN):c.18445A>G (p.Ile6149Val) rs368897297
NM_001267550.2(TTN):c.18485C>T (p.Thr6162Ile) rs367685188
NM_001267550.2(TTN):c.18550G>A (p.Ala6184Thr) rs72648947
NM_001267550.2(TTN):c.18560C>T (p.Ala6187Val) rs758380777
NM_001267550.2(TTN):c.18589+4C>T rs1449021840
NM_001267550.2(TTN):c.18655G>A (p.Glu6219Lys) rs72648948
NM_001267550.2(TTN):c.18663A>C (p.Glu6221Asp) rs369544339
NM_001267550.2(TTN):c.18677C>A (p.Pro6226His) rs746345160
NM_001267550.2(TTN):c.18709A>T (p.Arg6237Trp) rs750368911
NM_001267550.2(TTN):c.18736A>G (p.Thr6246Ala) rs1553920950
NM_001267550.2(TTN):c.18782G>A (p.Cys6261Tyr) rs1060500581
NM_001267550.2(TTN):c.187G>A (p.Ala63Thr) rs764892312
NM_001267550.2(TTN):c.18887A>G (p.Lys6296Arg) rs1553920476
NM_001267550.2(TTN):c.18950G>T (p.Gly6317Val) rs1060500522
NM_001267550.2(TTN):c.18959C>A (p.Pro6320His) rs886246785
NM_001267550.2(TTN):c.1895G>A (p.Gly632Asp) rs150231219
NM_001267550.2(TTN):c.19016A>G (p.Tyr6339Cys) rs192553687
NM_001267550.2(TTN):c.19036G>A (p.Val6346Met) rs537966944
NM_001267550.2(TTN):c.19118A>G (p.Glu6373Gly) rs367868361
NM_001267550.2(TTN):c.19180del (p.Val6394fs) rs1560763939
NM_001267550.2(TTN):c.1925T>C (p.Ile642Thr) rs772036467
NM_001267550.2(TTN):c.1943G>C (p.Arg648Thr) rs550441902
NM_001267550.2(TTN):c.19447T>C (p.Phe6483Leu) rs373750655
NM_001267550.2(TTN):c.19496A>T (p.His6499Leu) rs375173049
NM_001267550.2(TTN):c.19547A>T (p.Lys6516Met) rs199796249
NM_001267550.2(TTN):c.1964C>A (p.Ala655Asp) rs763912778
NM_001267550.2(TTN):c.19697G>C (p.Gly6566Ala) rs1052515116
NM_001267550.2(TTN):c.19714+1G>T rs1060500423
NM_001267550.2(TTN):c.19744C>T (p.Arg6582Ter) rs794727829
NM_001267550.2(TTN):c.19786A>G (p.Ile6596Val) rs369108292
NM_001267550.2(TTN):c.19855A>G (p.Lys6619Glu) rs1060500450
NM_001267550.2(TTN):c.19877G>A (p.Gly6626Glu) rs1362220931
NM_001267550.2(TTN):c.19931A>G (p.Tyr6644Cys) rs375417679
NM_001267550.2(TTN):c.19933A>G (p.Thr6645Ala) rs370671112
NM_001267550.2(TTN):c.19949A>G (p.Asn6650Ser) rs751222632
NM_001267550.2(TTN):c.19963G>A (p.Asp6655Asn) rs397517493
NM_001267550.2(TTN):c.19964A>G (p.Asp6655Gly) rs772947420
NM_001267550.2(TTN):c.19970G>T (p.Cys6657Phe) rs776748717
NM_001267550.2(TTN):c.19992A>G (p.Thr6664=) rs1560749476
NM_001267550.2(TTN):c.19994-7T>G rs1292778822
NM_001267550.2(TTN):c.19996C>T (p.Pro6666Ser) rs571231816
NM_001267550.2(TTN):c.20035G>A (p.Val6679Met) rs1553917765
NM_001267550.2(TTN):c.20041G>A (p.Ala6681Thr) rs779405672
NM_001267550.2(TTN):c.20057G>A (p.Arg6686Gln) rs202022304
NM_001267550.2(TTN):c.20096T>A (p.Val6699Asp) rs907862282
NM_001267550.2(TTN):c.20096T>C (p.Val6699Ala) rs907862282
NM_001267550.2(TTN):c.20156T>C (p.Ile6719Thr) rs770377168
NM_001267550.2(TTN):c.20185A>G (p.Asn6729Asp) rs794729619
NM_001267550.2(TTN):c.2022A>C (p.Arg674Ser) rs180694107
NM_001267550.2(TTN):c.20276-5del rs779654489
NM_001267550.2(TTN):c.20324del (p.Asn6775fs)
NM_001267550.2(TTN):c.2032A>G (p.Thr678Ala) rs878854290
NM_001267550.2(TTN):c.20354C>T (p.Ser6785Leu) rs201586695
NM_001267550.2(TTN):c.20396G>A (p.Arg6799Gln) rs780069933
NM_001267550.2(TTN):c.20455C>T (p.His6819Tyr) rs1553916130
NM_001267550.2(TTN):c.20465A>G (p.Asn6822Ser) rs371518764
NM_001267550.2(TTN):c.20474C>T (p.Thr6825Ile) rs763006525
NM_001267550.2(TTN):c.20484C>G (p.Ile6828Met) rs563320328
NM_001267550.2(TTN):c.20579T>C (p.Leu6860Pro) rs767944090
NM_001267550.2(TTN):c.205G>A (p.Ala69Thr) rs1370693255
NM_001267550.2(TTN):c.20605G>A (p.Glu6869Lys) rs746830456
NM_001267550.2(TTN):c.2061A>G (p.Gln687=) rs188680791
NM_001267550.2(TTN):c.20626T>A (p.Ser6876Thr) rs1359024577
NM_001267550.2(TTN):c.20692A>G (p.Ser6898Gly) rs878854291
NM_001267550.2(TTN):c.20696A>G (p.Glu6899Gly) rs777803266
NM_001267550.2(TTN):c.20707A>G (p.Ile6903Val) rs571675433
NM_001267550.2(TTN):c.2073A>T (p.Gly691=) rs72647860
NM_001267550.2(TTN):c.20743G>T (p.Ala6915Ser) rs201728165
NM_001267550.2(TTN):c.20792A>G (p.Asn6931Ser) rs200866883
NM_001267550.2(TTN):c.20837-1G>A rs1553914337
NM_001267550.2(TTN):c.2083G>A (p.Val695Ile) rs747479318
NM_001267550.2(TTN):c.2083G>T (p.Val695Phe) rs747479318
NM_001267550.2(TTN):c.20869A>T (p.Met6957Leu) rs375262781
NM_001267550.2(TTN):c.20873C>T (p.Thr6958Met) rs371824963
NM_001267550.2(TTN):c.20891C>T (p.Thr6964Met) rs765257439
NM_001267550.2(TTN):c.208G>A (p.Val70Met) rs772248060
NM_001267550.2(TTN):c.21028G>A (p.Val7010Ile) rs564660466
NM_001267550.2(TTN):c.21119G>A (p.Arg7040Gln) rs754476903
NM_001267550.2(TTN):c.2113G>C (p.Val705Leu) rs1320087550
NM_001267550.2(TTN):c.21143G>A (p.Arg7048Gln) rs148072021
NM_001267550.2(TTN):c.21291T>A (p.Asn7097Lys) rs773211607
NM_001267550.2(TTN):c.21332T>C (p.Met7111Thr) rs374408615
NM_001267550.2(TTN):c.21378A>C (p.Glu7126Asp) rs786205315
NM_001267550.2(TTN):c.21403+5G>A rs1560709207
NM_001267550.2(TTN):c.21404-8C>G rs761542135
NM_001267550.2(TTN):c.21475G>A (p.Val7159Ile) rs371267140
NM_001267550.2(TTN):c.21488C>A (p.Thr7163Asn) rs370324138
NM_001267550.2(TTN):c.21497T>G (p.Phe7166Cys) rs781740874
NM_001267550.2(TTN):c.21507del (p.Trp7170fs)
NM_001267550.2(TTN):c.21548G>A (p.Cys7183Tyr) rs189951108
NM_001267550.2(TTN):c.21574G>A (p.Ala7192Thr) rs1212601280
NM_001267550.2(TTN):c.21612T>G (p.Ser7204Arg) rs780624577
NM_001267550.2(TTN):c.2162G>C (p.Gly721Ala) rs1554022851
NM_001267550.2(TTN):c.21641A>G (p.Asn7214Ser) rs755600935
NM_001267550.2(TTN):c.21653C>T (p.Ala7218Val) rs763125654
NM_001267550.2(TTN):c.21656C>T (p.Ser7219Phe) rs201029552
NM_001267550.2(TTN):c.21667C>T (p.Arg7223Cys) rs1156609638
NM_001267550.2(TTN):c.21689C>T (p.Ala7230Val) rs761223583
NM_001267550.2(TTN):c.21705A>T (p.Arg7235Ser) rs772506057
NM_001267550.2(TTN):c.21721G>A (p.Val7241Ile) rs367854582
NM_001267550.2(TTN):c.21785C>G (p.Thr7262Ser) rs200954184
NM_001267550.2(TTN):c.21789G>C (p.Trp7263Cys) rs377544260
NM_001267550.2(TTN):c.21799G>A (p.Gly7267Ser) rs772450876
NM_001267550.2(TTN):c.21892G>A (p.Gly7298Arg) rs878854292
NM_001267550.2(TTN):c.21907G>A (p.Glu7303Lys) rs774950387
NM_001267550.2(TTN):c.21907G>C (p.Glu7303Gln) rs774950387
NM_001267550.2(TTN):c.21914A>C (p.Glu7305Ala) rs1553911785
NM_001267550.2(TTN):c.21964C>T (p.Pro7322Ser) rs1553911632
NM_001267550.2(TTN):c.22024T>G (p.Leu7342Val) rs1243764269
NM_001267550.2(TTN):c.22039G>A (p.Ala7347Thr) rs1553911494
NM_001267550.2(TTN):c.2203T>C (p.Tyr735His) rs754432983
NM_001267550.2(TTN):c.2206G>A (p.Gly736Arg) rs876658047
NM_001267550.2(TTN):c.22090C>T (p.Arg7364Trp) rs397517500
NM_001267550.2(TTN):c.22241-7C>G rs749798825
NM_001267550.2(TTN):c.22255C>T (p.Pro7419Ser) rs1486377872
NM_001267550.2(TTN):c.22273_22276del (p.Leu7425fs) rs1553910811
NM_001267550.2(TTN):c.22293_22303del (p.Val7432fs) rs1560692247
NM_001267550.2(TTN):c.2233A>G (p.Lys745Glu) rs139957325
NM_001267550.2(TTN):c.22343T>C (p.Ile7448Thr) rs878854293
NM_001267550.2(TTN):c.22384_22385delinsCG (p.Asp7462Arg) rs1060500493
NM_001267550.2(TTN):c.22420G>A (p.Ala7474Thr) rs759713604
NM_001267550.2(TTN):c.22432A>G (p.Ile7478Val) rs1191020503
NM_001267550.2(TTN):c.22439A>C (p.Gln7480Pro) rs201065037
NM_001267550.2(TTN):c.22528+4del
NM_001267550.2(TTN):c.2254C>T (p.Arg752Cys) rs200677631
NM_001267550.2(TTN):c.22592G>A (p.Ser7531Asn) rs267599060
NM_001267550.2(TTN):c.22628C>T (p.Pro7543Leu) rs560272834
NM_001267550.2(TTN):c.22633C>T (p.Arg7545Ter) rs764687326
NM_001267550.2(TTN):c.22687A>T (p.Ile7563Phe) rs1321824189
NM_001267550.2(TTN):c.22689C>G (p.Ile7563Met) rs1060500529
NM_001267550.2(TTN):c.22693T>C (p.Cys7565Arg) rs757611239
NM_001267550.2(TTN):c.22888T>C (p.Cys7630Arg) rs1553908536
NM_001267550.2(TTN):c.22931G>A (p.Arg7644Gln) rs766675017
NM_001267550.2(TTN):c.22942G>A (p.Glu7648Lys) rs397517502
NM_001267550.2(TTN):c.22952A>G (p.Glu7651Gly) rs1461872954
NM_001267550.2(TTN):c.23000C>G (p.Thr7667Arg) rs374430623
NM_001267550.2(TTN):c.23005A>G (p.Asn7669Asp) rs1060500486
NM_001267550.2(TTN):c.23065G>A (p.Asp7689Asn) rs727505052
NM_001267550.2(TTN):c.23068G>T (p.Ala7690Ser) rs763029699
NM_001267550.2(TTN):c.2320G>A (p.Glu774Lys) rs1554022511
NM_001267550.2(TTN):c.23305G>A (p.Val7769Ile) rs1553907172
NM_001267550.2(TTN):c.2331C>G (p.Ile777Met) rs1157627413
NM_001267550.2(TTN):c.23353T>C (p.Cys7785Arg) rs371090975
NM_001267550.2(TTN):c.23373C>A (p.Phe7791Leu) rs1553907020
NM_001267550.2(TTN):c.23386C>T (p.Arg7796Ter) rs748111134
NM_001267550.2(TTN):c.2341G>T (p.Asp781Tyr) rs1554022470
NM_001267550.2(TTN):c.23443C>T (p.Arg7815Trp) rs528264100
NM_001267550.2(TTN):c.23467C>A (p.Pro7823Thr) rs768540966
NM_001267550.2(TTN):c.2354T>C (p.Met785Thr) rs1060500532
NM_001267550.2(TTN):c.23567G>A (p.Gly7856Glu) rs919783694
NM_001267550.2(TTN):c.23578G>A (p.Ala7860Thr) rs138076523
NM_001267550.2(TTN):c.2358C>G (p.His786Gln) rs199507913
NM_001267550.2(TTN):c.2360T>C (p.Ile787Thr) rs143444636
NM_001267550.2(TTN):c.23660-13CTT[2] rs563250569
NM_001267550.2(TTN):c.23694G>A (p.Met7898Ile) rs751897366
NM_001267550.2(TTN):c.23725G>C (p.Glu7909Gln) rs1161435142
NM_001267550.2(TTN):c.23729G>T (p.Cys7910Phe) rs763596594
NM_001267550.2(TTN):c.23770A>C (p.Lys7924Gln) rs770650362
NM_001267550.2(TTN):c.23797A>G (p.Ser7933Gly) rs1553905723
NM_001267550.2(TTN):c.23817C>G (p.Phe7939Leu) rs866647945
NM_001267550.2(TTN):c.2386G>A (p.Asp796Asn) rs766935265
NM_001267550.2(TTN):c.23895C>A (p.Asn7965Lys) rs1363515138
NM_001267550.2(TTN):c.23926G>A (p.Val7976Ile) rs200395305
NM_001267550.2(TTN):c.2393_2394del (p.Thr798fs) rs1060500528
NM_001267550.2(TTN):c.23947G>A (p.Val7983Met) rs1060500564
NM_001267550.2(TTN):c.2396C>T (p.Thr799Met) rs149061352
NM_001267550.2(TTN):c.23996G>C (p.Gly7999Ala) rs750389762
NM_001267550.2(TTN):c.24013G>C (p.Glu8005Gln) rs757042397
NM_001267550.2(TTN):c.24020G>A (p.Arg8007Gln) rs765789516
NM_001267550.2(TTN):c.24037C>A (p.Pro8013Thr) rs1553904936
NM_001267550.2(TTN):c.24038C>T (p.Pro8013Leu) rs773761640
NM_001267550.2(TTN):c.24115G>A (p.Val8039Ile) rs759655046
NM_001267550.2(TTN):c.24137T>C (p.Leu8046Ser) rs1553904761
NM_001267550.2(TTN):c.24253G>A (p.Asp8085Asn) rs1553904192
NM_001267550.2(TTN):c.24344G>A (p.Ser8115Asn) rs397517506
NM_001267550.2(TTN):c.24358C>T (p.Pro8120Ser) rs745913661
NM_001267550.2(TTN):c.2435C>T (p.Ala812Val) rs372040052
NM_001267550.2(TTN):c.24469G>A (p.Gly8157Ser) rs753025964
NM_001267550.2(TTN):c.24482G>A (p.Cys8161Tyr) rs372143487
NM_001267550.2(TTN):c.24493C>A (p.Leu8165Ile) rs1060500582
NM_001267550.2(TTN):c.24520G>A (p.Val8174Met) rs727504961
NM_001267550.2(TTN):c.24546T>A (p.Val8182=) rs397517508
NM_001267550.2(TTN):c.24563T>C (p.Ile8188Thr) rs1184649078
NM_001267550.2(TTN):c.24622G>A (p.Glu8208Lys) rs190192954
NM_001267550.2(TTN):c.24639A>C (p.Gln8213His) rs397517510
NM_001267550.2(TTN):c.24701C>T (p.Thr8234Ile) rs369521909
NM_001267550.2(TTN):c.24706G>A (p.Glu8236Lys) rs377762626
NM_001267550.2(TTN):c.24708_24710del (p.Glu8236del) rs771555243
NM_001267550.2(TTN):c.24769C>G (p.Leu8257Val) rs371322658
NM_001267550.2(TTN):c.24833G>C (p.Gly8278Ala) rs778611558
NM_001267550.2(TTN):c.24865G>T (p.Gly8289Ter)
NM_001267550.2(TTN):c.24891G>T (p.Trp8297Cys) rs727504205
NM_001267550.2(TTN):c.24914G>A (p.Arg8305Gln) rs759985618
NM_001267550.2(TTN):c.24946_24947delinsT (p.Asn8316fs)
NM_001267550.2(TTN):c.24962T>C (p.Leu8321Ser)
NM_001267550.2(TTN):c.24972C>A (p.Asn8324Lys) rs879030954
NM_001267550.2(TTN):c.2502A>G (p.Ile834Met) rs752214647
NM_001267550.2(TTN):c.25036G>A (p.Ala8346Thr) rs755302381
NM_001267550.2(TTN):c.25037C>T (p.Ala8346Val) rs747055472
NM_001267550.2(TTN):c.25063+1G>A rs754247415
NM_001267550.2(TTN):c.25063+5T>A rs1553902318
NM_001267550.2(TTN):c.2506G>T (p.Gly836Cys) rs751157908
NM_001267550.2(TTN):c.25105G>A (p.Val8369Ile) rs755722481
NM_001267550.2(TTN):c.25126C>T (p.Pro8376Ser) rs375209098
NM_001267550.2(TTN):c.25144C>T (p.Arg8382Cys) rs776519143
NM_001267550.2(TTN):c.25154G>C (p.Gly8385Ala) rs775560531
NM_001267550.2(TTN):c.25180T>G (p.Tyr8394Asp) rs898098652
NM_001267550.2(TTN):c.25215T>A (p.Asn8405Lys) rs371923232
NM_001267550.2(TTN):c.25231G>A (p.Val8411Ile) rs760523669
NM_001267550.2(TTN):c.25249C>T (p.Leu8417Phe) rs774234445
NM_001267550.2(TTN):c.25270C>G (p.Gln8424Glu) rs370668637
NM_001267550.2(TTN):c.25476T>A (p.Asp8492Glu) rs777349143
NM_001267550.2(TTN):c.25480C>T (p.Arg8494Ter) rs794727945
NM_001267550.2(TTN):c.25489C>T (p.Arg8497Cys) rs369517119
NM_001267550.2(TTN):c.25510A>C (p.Met8504Leu) rs761929830
NM_001267550.2(TTN):c.25563C>T (p.Gly8521=) rs556205722
NM_001267550.2(TTN):c.25564G>A (p.Asp8522Asn) rs199619070
NM_001267550.2(TTN):c.25570G>A (p.Gly8524Arg) rs371512914
NM_001267550.2(TTN):c.25600G>T (p.Ala8534Ser) rs779163897
NM_001267550.2(TTN):c.25619C>T (p.Ser8540Phe) rs201523784
NM_001267550.2(TTN):c.25639G>C (p.Glu8547Gln) rs1060500447
NM_001267550.2(TTN):c.25662_25663delinsTT (p.Lys8554Asn) rs1553898915
NM_001267550.2(TTN):c.25707_25708inv (p.Glu8570Lys)
NM_001267550.2(TTN):c.25717A>C (p.Ile8573Leu) rs142609645
NM_001267550.2(TTN):c.25783A>T (p.Lys8595Ter)
NM_001267550.2(TTN):c.25853G>A (p.Gly8618Glu) rs369947439
NM_001267550.2(TTN):c.25877A>G (p.Asn8626Ser) rs200355367
NM_001267550.2(TTN):c.25921G>A (p.Glu8641Lys) rs1553898323
NM_001267550.2(TTN):c.25937G>A (p.Arg8646His) rs144587343
NM_001267550.2(TTN):c.25937G>T (p.Arg8646Leu) rs144587343
NM_001267550.2(TTN):c.25971A>T (p.Gly8657=) rs1060500547
NM_001267550.2(TTN):c.26030A>G (p.Tyr8677Cys) rs778578388
NM_001267550.2(TTN):c.2605A>T (p.Thr869Ser) rs370962244
NM_001267550.2(TTN):c.26068A>C (p.Lys8690Gln) rs1060500411
NM_001267550.2(TTN):c.26081A>C (p.Glu8694Ala) rs1553897407
NM_001267550.2(TTN):c.26093C>G (p.Thr8698Ser) rs1060500461
NM_001267550.2(TTN):c.26116G>A (p.Asp8706Asn) rs377074955
NM_001267550.2(TTN):c.2611G>T (p.Val871Leu) rs72647861
NM_001267550.2(TTN):c.26144G>T (p.Cys8715Phe) rs183499397
NM_001267550.2(TTN):c.26170G>A (p.Asp8724Asn) rs756034176
NM_001267550.2(TTN):c.26189T>A (p.Ile8730Asn) rs1060500488
NM_001267550.2(TTN):c.26240del (p.Thr8747fs) rs1553896398
NM_001267550.2(TTN):c.26261A>T (p.Gln8754Leu) rs1060500568
NM_001267550.2(TTN):c.26275A>G (p.Ile8759Val) rs1317485542
NM_001267550.2(TTN):c.26281G>A (p.Gly8761Ser) rs369385294
NM_001267550.2(TTN):c.26283C>T (p.Gly8761=) rs376046284
NM_001267550.2(TTN):c.26329G>A (p.Val8777Ile) rs376823283
NM_001267550.2(TTN):c.26444C>G (p.Ala8815Gly) rs1168744166
NM_001267550.2(TTN):c.26468C>T (p.Thr8823Met) rs368151971
NM_001267550.2(TTN):c.26482+1G>A
NM_001267550.2(TTN):c.26482+5G>A rs1060500590
NM_001267550.2(TTN):c.26506C>T (p.Pro8836Ser) rs776799144
NM_001267550.2(TTN):c.26528C>T (p.Thr8843Met) rs72648990
NM_001267550.2(TTN):c.26579G>A (p.Ser8860Asn) rs1240256366
NM_001267550.2(TTN):c.26619C>A (p.Asp8873Glu) rs772596633
NM_001267550.2(TTN):c.26672A>G (p.Asn8891Ser) rs146057575
NM_001267550.2(TTN):c.26674G>A (p.Val8892Ile) rs747832107
NM_001267550.2(TTN):c.266C>G (p.Ala89Gly) rs200165636
NM_001267550.2(TTN):c.26719C>T (p.Pro8907Ser) rs764261158
NM_001267550.2(TTN):c.26744C>G (p.Ala8915Gly) rs536974988
NM_001267550.2(TTN):c.26762-10_26762-9insTTGTTTTGTA rs1553893826
NM_001267550.2(TTN):c.26762-39TTTGT[3] rs71393436
NM_001267550.2(TTN):c.26762-39TTTGT[9] rs71393436
NM_001267550.2(TTN):c.26762-9delins34
NM_001267550.2(TTN):c.26830G>A (p.Val8944Ile) rs72648993
NM_001267550.2(TTN):c.26849A>G (p.Tyr8950Cys) rs199557654
NM_001267550.2(TTN):c.2686G>A (p.Val896Ile) rs376768790
NM_001267550.2(TTN):c.26882A>G (p.His8961Arg) rs766862084
NM_001267550.2(TTN):c.26893G>A (p.Glu8965Lys) rs200325324
NM_001267550.2(TTN):c.26935A>C (p.Asn8979His) rs376982715
NM_001267550.2(TTN):c.26985C>A (p.Asp8995Glu) rs781351100
NM_001267550.2(TTN):c.26989A>G (p.Thr8997Ala) rs953177976
NM_001267550.2(TTN):c.26C>T (p.Thr9Met) rs146123323
NM_001267550.2(TTN):c.27030T>A (p.Ser9010Arg) rs774115714
NM_001267550.2(TTN):c.27121A>G (p.Ile9041Val) rs1395755933
NM_001267550.2(TTN):c.27158T>C (p.Phe9053Ser) rs761745332
NM_001267550.2(TTN):c.2716A>G (p.Ile906Val) rs1304074202
NM_001267550.2(TTN):c.27193T>C (p.Cys9065Arg) rs201229221
NM_001267550.2(TTN):c.27198C>G (p.Asn9066Lys) rs369529493
NM_001267550.2(TTN):c.27224_27228del (p.Glu9075fs) rs1553892376
NM_001267550.2(TTN):c.2731G>A (p.Val911Ile) rs141961878
NM_001267550.2(TTN):c.27329-1G>T rs1378646156
NM_001267550.2(TTN):c.2734C>T (p.Arg912Cys) rs371156190
NM_001267550.2(TTN):c.27350G>C (p.Arg9117Thr) rs375907742
NM_001267550.2(TTN):c.27382C>A (p.Pro9128Thr) rs1283675898
NM_001267550.2(TTN):c.27425C>T (p.Ser9142Leu) rs781609380
NM_001267550.2(TTN):c.27426G>A (p.Ser9142=) rs368081453
NM_001267550.2(TTN):c.27427G>T (p.Val9143Phe) rs186857044
NM_001267550.2(TTN):c.2743C>T (p.Arg915Cys) rs539652641
NM_001267550.2(TTN):c.2744G>C (p.Arg915Pro) rs376922544
NM_001267550.2(TTN):c.2745C>G (p.Arg915=) rs773568773
NM_001267550.2(TTN):c.27532G>T (p.Asp9178Tyr) rs727504202
NM_001267550.2(TTN):c.27592C>G (p.Gln9198Glu) rs72648995
NM_001267550.2(TTN):c.27593A>G (p.Gln9198Arg) rs368297438
NM_001267550.2(TTN):c.27667T>C (p.Ser9223Pro) rs201253546
NM_001267550.2(TTN):c.27709T>G (p.Ser9237Ala) rs766638714
NM_001267550.2(TTN):c.27715T>C (p.Tyr9239His) rs373068293
NM_001267550.2(TTN):c.27746C>T (p.Thr9249Met) rs745792278
NM_001267550.2(TTN):c.27856G>C (p.Val9286Leu) rs777547707
NM_001267550.2(TTN):c.27872T>C (p.Phe9291Ser) rs754982924
NM_001267550.2(TTN):c.27886+5T>C rs876658050
NM_001267550.2(TTN):c.27896T>G (p.Leu9299Arg) rs879046044
NM_001267550.2(TTN):c.278C>G (p.Ala93Gly) rs1473207810
NM_001267550.2(TTN):c.27928G>A (p.Val9310Ile) rs200207722
NM_001267550.2(TTN):c.27988A>G (p.Ile9330Val) rs768696299
NM_001267550.2(TTN):c.28032C>A (p.Ser9344Arg) rs1338895544
NM_001267550.2(TTN):c.28034C>T (p.Pro9345Leu) rs878854296
NM_001267550.2(TTN):c.28093C>T (p.Arg9365Trp) rs190600127
NM_001267550.2(TTN):c.28094G>A (p.Arg9365Gln) rs570608843
NM_001267550.2(TTN):c.28098C>G (p.Ser9366Arg) rs374930292
NM_001267550.2(TTN):c.28099C>T (p.Leu9367Phe) rs748483786
NM_001267550.2(TTN):c.28131C>A (p.Asn9377Lys) rs72648997
NM_001267550.2(TTN):c.28137A>G (p.Ile9379Met) rs1060500516
NM_001267550.2(TTN):c.28151C>G (p.Ser9384Cys) rs760466007
NM_001267550.2(TTN):c.28205G>A (p.Arg9402His) rs773986121
NM_001267550.2(TTN):c.28207C>G (p.Leu9403Val) rs752742472
NM_001267550.2(TTN):c.2824C>T (p.Pro942Ser) rs1060500550
NM_001267550.2(TTN):c.28262C>T (p.Thr9421Met) rs375209383
NM_001267550.2(TTN):c.28308A>C (p.Glu9436Asp) rs906433178
NM_001267550.2(TTN):c.28328A>T (p.Tyr9443Phe) rs1553888051
NM_001267550.2(TTN):c.2836G>A (p.Val946Ile) rs752246051
NM_001267550.2(TTN):c.28391C>T (p.Ser9464Phe) rs1553887984
NM_001267550.2(TTN):c.28424T>G (p.Val9475Gly) rs1363580617
NM_001267550.2(TTN):c.28433A>C (p.Asp9478Ala) rs1553887887
NM_001267550.2(TTN):c.28466G>A (p.Arg9489Gln) rs189431308
NM_001267550.2(TTN):c.28480A>T (p.Ser9494Cys) rs1553886767
NM_001267550.2(TTN):c.28495C>T (p.Leu9499Phe) rs1060500573
NM_001267550.2(TTN):c.28524del (p.Asn9509fs)
NM_001267550.2(TTN):c.28542G>A (p.Glu9514=) rs370604793
NM_001267550.2(TTN):c.28592A>C (p.Asn9531Thr) rs537464608
NM_001267550.2(TTN):c.28594A>G (p.Ile9532Val) rs770782767
NM_001267550.2(TTN):c.28667C>T (p.Ala9556Val) rs1060500482
NM_001267550.2(TTN):c.28674G>C (p.Met9558Ile) rs868771235
NM_001267550.2(TTN):c.28726C>G (p.Leu9576Val) rs780753483
NM_001267550.2(TTN):c.28733C>T (p.Thr9578Met) rs184923756
NM_001267550.2(TTN):c.28741A>G (p.Ile9581Val) rs371826762
NM_001267550.2(TTN):c.28744G>A (p.Val9582Ile) rs537805395
NM_001267550.2(TTN):c.28754A>G (p.Glu9585Gly) rs200856239
NM_001267550.2(TTN):c.28795G>A (p.Val9599Ile) rs887090503
NM_001267550.2(TTN):c.28829G>A (p.Ser9610Asn) rs371759532
NM_001267550.2(TTN):c.2882C>G (p.Thr961Ser) rs1554018432
NM_001267550.2(TTN):c.28877C>A (p.Ala9626Asp) rs397517530
NM_001267550.2(TTN):c.28880G>A (p.Gly9627Asp) rs878908638
NM_001267550.2(TTN):c.28908C>A (p.Cys9636Ter) rs1553883443
NM_001267550.2(TTN):c.29015C>T (p.Thr9672Ile) rs769996978
NM_001267550.2(TTN):c.29024C>A (p.Ser9675Ter) rs886042115
NM_001267550.2(TTN):c.29048C>T (p.Pro9683Leu) rs794729399
NM_001267550.2(TTN):c.29066C>G (p.Thr9689Ser) rs777878480
NM_001267550.2(TTN):c.29185G>T (p.Val9729Phe) rs1060500451
NM_001267550.2(TTN):c.29227G>A (p.Gly9743Ser) rs368073588
NM_001267550.2(TTN):c.29230C>G (p.Arg9744Gly) rs375266859
NM_001267550.2(TTN):c.29230C>T (p.Arg9744Cys) rs375266859
NM_001267550.2(TTN):c.29231G>A (p.Arg9744His) rs760305440
NM_001267550.2(TTN):c.29317G>A (p.Ala9773Thr) rs371163094
NM_001267550.2(TTN):c.29333G>A (p.Gly9778Asp) rs775854531
NM_001267550.2(TTN):c.29429T>C (p.Ile9810Thr) rs781737736
NM_001267550.2(TTN):c.29464G>T (p.Asp9822Tyr) rs758873870
NM_001267550.2(TTN):c.29502A>G (p.Glu9834=) rs759468315
NM_001267550.2(TTN):c.29564A>G (p.Glu9855Gly) rs794727011
NM_001267550.2(TTN):c.29597A>G (p.His9866Arg) rs878919397
NM_001267550.2(TTN):c.2967C>A (p.Phe989Leu) rs376548316
NM_001267550.2(TTN):c.29729C>T (p.Thr9910Ile) rs878854297
NM_001267550.2(TTN):c.29762T>C (p.Ile9921Thr) rs373651676
NM_001267550.2(TTN):c.29777A>C (p.Asn9926Thr) rs377147236
NM_001267550.2(TTN):c.29857G>A (p.Gly9953Ser) rs770212603
NM_001267550.2(TTN):c.29864G>A (p.Arg9955Gln) rs182332374
NM_001267550.2(TTN):c.29944G>A (p.Ala9982Thr) rs200745162
NM_001267550.2(TTN):c.29965C>A (p.Pro9989Thr) rs1553877891
NM_001267550.2(TTN):c.2996G>A (p.Arg999His) rs371757623
NM_001267550.2(TTN):c.29984T>A (p.Leu9995His) rs1060500554
NM_001267550.2(TTN):c.3002T>G (p.Met1001Arg) rs148269839
NM_001267550.2(TTN):c.30033A>G (p.Gln10011=) rs768497622
NM_001267550.2(TTN):c.30044C>T (p.Pro10015Leu) rs1178694077
NM_001267550.2(TTN):c.3007dup (p.Arg1003fs)
NM_001267550.2(TTN):c.30091dup (p.Gln10031fs) rs1553877628
NM_001267550.2(TTN):c.3010G>A (p.Glu1004Lys) rs200902055
NM_001267550.2(TTN):c.30139A>T (p.Ile10047Phe) rs1553877530
NM_001267550.2(TTN):c.30196G>C (p.Glu10066Gln) rs370072382
NM_001267550.2(TTN):c.30223+5G>A
NM_001267550.2(TTN):c.30283G>A (p.Ala10095Thr) rs201635835
NM_001267550.2(TTN):c.30299A>C (p.Glu10100Ala) rs1060500579
NM_001267550.2(TTN):c.302C>T (p.Thr101Ile) rs879185669
NM_001267550.2(TTN):c.3035G>A (p.Arg1012Gln) rs368885310
NM_001267550.2(TTN):c.30389G>A (p.Arg10130His) rs373355159
NM_001267550.2(TTN):c.30433+2T>G rs1060500504
NM_001267550.2(TTN):c.30436G>A (p.Val10146Ile) rs1553875094
NM_001267550.2(TTN):c.30485C>T (p.Thr10162Met) rs200593368
NM_001267550.2(TTN):c.30487del (p.Ala10163fs) rs1560498923
NM_001267550.2(TTN):c.30513A>T (p.Glu10171Asp) rs577066020
NM_001267550.2(TTN):c.30515T>A (p.Ile10172Asn) rs772028677
NM_001267550.2(TTN):c.30583G>T (p.Ala10195Ser) rs1060500585
NM_001267550.2(TTN):c.30598+4A>T rs1560494355
NM_001267550.2(TTN):c.30598G>C (p.Glu10200Gln) rs779015756
NM_001267550.2(TTN):c.30605C>T (p.Pro10202Leu) rs769528182
NM_001267550.2(TTN):c.30614T>C (p.Val10205Ala) rs1060500449
NM_001267550.2(TTN):c.30683-2A>T rs886043892
NM_001267550.2(TTN):c.30694G>T (p.Ala10232Ser) rs747294929
NM_001267550.2(TTN):c.30781A>G (p.Thr10261Ala) rs1060500409
NM_001267550.2(TTN):c.30811A>G (p.Ile10271Val) rs182720979
NM_001267550.2(TTN):c.30857T>C (p.Ile10286Thr) rs369094355
NM_001267550.2(TTN):c.30899A>G (p.Tyr10300Cys) rs1553864504
NM_001267550.2(TTN):c.30941T>C (p.Ile10314Thr) rs886055288
NM_001267550.2(TTN):c.30967G>T (p.Glu10323Ter) rs1425322355
NM_001267550.2(TTN):c.30994C>G (p.Pro10332Ala) rs757869762
NM_001267550.2(TTN):c.31048G>A (p.Val10350Ile) rs1553864204
NM_001267550.2(TTN):c.31114G>C (p.Glu10372Gln) rs200831060
NM_001267550.2(TTN):c.31156G>A (p.Glu10386Lys) rs772195716
NM_001267550.2(TTN):c.31270G>T (p.Val10424Phe)
NM_001267550.2(TTN):c.31295A>G (p.Lys10432Arg) rs879134517
NM_001267550.2(TTN):c.3133G>A (p.Val1045Met) rs72647868
NM_001267550.2(TTN):c.31390C>T (p.Arg10464Trp) rs374555701
NM_001267550.2(TTN):c.31391G>A (p.Arg10464Gln) rs727504757
NM_001267550.2(TTN):c.31426+1G>C rs6749719
NM_001267550.2(TTN):c.31453G>T (p.Val10485Phe) rs762572524
NM_001267550.2(TTN):c.31472T>C (p.Met10491Thr) rs769226745
NM_001267550.2(TTN):c.31486C>G (p.His10496Asp) rs1553860465
NM_001267550.2(TTN):c.31513+1G>A rs1553860401
NM_001267550.2(TTN):c.31525C>A (p.Gln10509Lys) rs1553859889
NM_001267550.2(TTN):c.31563_31564inv (p.Ile10522Val)
NM_001267550.2(TTN):c.31594G>A (p.Val10532Ile) rs763955552
NM_001267550.2(TTN):c.31645A>G (p.Ile10549Val) rs376613199
NM_001267550.2(TTN):c.31669G>T (p.Ala10557Ser) rs1553857863
NM_001267550.2(TTN):c.31672C>A (p.Pro10558Thr) rs769915175
NM_001267550.2(TTN):c.31735A>C (p.Lys10579Gln) rs376287951
NM_001267550.2(TTN):c.31756C>G (p.Pro10586Ala) rs768652249
NM_001267550.2(TTN):c.31757C>T (p.Pro10586Leu) rs200459347
NM_001267550.2(TTN):c.31762+4C>G rs368538884
NM_001267550.2(TTN):c.31762+5_31762+7del rs397517538
NM_001267550.2(TTN):c.31762G>A (p.Val10588Ile) rs372371333
NM_001267550.2(TTN):c.31763-1G>A rs202234172
NM_001267550.2(TTN):c.31787T>C (p.Val10596Ala) rs746313065
NM_001267550.2(TTN):c.31821G>T (p.Lys10607Asn) rs746722623
NM_001267550.2(TTN):c.31837C>G (p.Pro10613Ala) rs200213832
NM_001267550.2(TTN):c.31922C>T (p.Pro10641Leu) rs773886361
NM_001267550.2(TTN):c.32005C>A (p.Pro10669Thr) rs945424720
NM_001267550.2(TTN):c.32005C>T (p.Pro10669Ser) rs945424720
NM_001267550.2(TTN):c.32018C>G (p.Ala10673Gly) rs773935335
NM_001267550.2(TTN):c.32020C>G (p.Leu10674Val) rs766003250
NM_001267550.2(TTN):c.32021T>C (p.Leu10674Pro) rs762662455
NM_001267550.2(TTN):c.32026A>G (p.Lys10676Glu) rs200952728
NM_001267550.2(TTN):c.3205C>G (p.Leu1069Val) rs759873829
NM_001267550.2(TTN):c.32095+5G>C rs869312090
NM_001267550.2(TTN):c.32096-4_32117del rs1560398348
NM_001267550.2(TTN):c.3214G>A (p.Glu1072Lys) rs1263370770
NM_001267550.2(TTN):c.32161G>A (p.Ala10721Thr) rs753365187
NM_001267550.2(TTN):c.32161G>T (p.Ala10721Ser) rs753365187
NM_001267550.2(TTN):c.32164G>A (p.Val10722Ile) rs763742779
NM_001267550.2(TTN):c.32189G>C (p.Arg10730Pro) rs771054923
NM_001267550.2(TTN):c.32194G>A (p.Glu10732Lys) rs374348069
NM_001267550.2(TTN):c.32198-9C>A rs555383226
NM_001267550.2(TTN):c.32311+1G>T
NM_001267550.2(TTN):c.3235C>A (p.Pro1079Thr) rs774643116
NM_001267550.2(TTN):c.3241G>T (p.Ala1081Ser) rs55914517
NM_001267550.2(TTN):c.32470G>T (p.Val10824Phe) rs753951400
NM_001267550.2(TTN):c.32542C>T (p.Pro10848Ser) rs368286625
NM_001267550.2(TTN):c.32554+1G>T
NM_001267550.2(TTN):c.32554+5_32554+6del rs771419718
NM_001267550.2(TTN):c.32555-1G>A
NM_001267550.2(TTN):c.32555-2A>C
NM_001267550.2(TTN):c.32630C>G (p.Pro10877Arg) rs915579403
NM_001267550.2(TTN):c.32660T>C (p.Ile10887Thr) rs371538856
NM_001267550.2(TTN):c.326G>A (p.Arg109Gln) rs766434493
NM_001267550.2(TTN):c.32722+3A>G rs1182220171
NM_001267550.2(TTN):c.32731G>A (p.Glu10911Lys) rs199620003
NM_001267550.2(TTN):c.32735C>T (p.Pro10912Leu) rs781655223
NM_001267550.2(TTN):c.32761G>C (p.Val10921Leu) rs775126784
NM_001267550.2(TTN):c.32780A>G (p.Lys10927Arg) rs373657520
NM_001267550.2(TTN):c.32781A>T (p.Lys10927Asn) rs1250259159
NM_001267550.2(TTN):c.32792A>C (p.Glu10931Ala) rs370498307
NM_001267550.2(TTN):c.32879C>A (p.Pro10960His) rs879029800
NM_001267550.2(TTN):c.32888-3C>A rs397517544
NM_001267550.2(TTN):c.32899A>G (p.Met10967Val) rs1392264858
NM_001267550.2(TTN):c.32930_32932AAG[2] (p.Glu10979del) rs774683936
NM_001267550.2(TTN):c.3295G>A (p.Val1099Met) rs368282893
NM_001267550.2(TTN):c.32970_32987del (p.10987_10989EEY[1]) rs766756026
NM_001267550.2(TTN):c.32971G>A (p.Glu10991Lys) rs201081803
NM_001267550.2(TTN):c.32974T>C (p.Tyr10992His) rs769393540
NM_001267550.2(TTN):c.32C>T (p.Pro11Leu) rs768624416
NM_001267550.2(TTN):c.33049G>A (p.Glu11017Lys) rs753930002
NM_001267550.2(TTN):c.33052C>T (p.Arg11018Trp) rs372118864
NM_001267550.2(TTN):c.33059A>G (p.Tyr11020Cys) rs72650035
NM_001267550.2(TTN):c.3309C>A (p.Cys1103Ter) rs1467686861
NM_001267550.2(TTN):c.33164C>T (p.Pro11055Leu) rs193051231
NM_001267550.2(TTN):c.3319G>A (p.Gly1107Ser) rs767741769
NM_001267550.2(TTN):c.33215T>G (p.Ile11072Ser) rs1553836426
NM_001267550.2(TTN):c.33305G>A (p.Arg11102His) rs368777046
NM_001267550.2(TTN):c.33331G>A (p.Ala11111Thr) rs545067681
NM_001267550.2(TTN):c.33339A>G (p.Lys11113=) rs926306750
NM_001267550.2(TTN):c.33340G>T (p.Val11114Leu) rs1328375389
NM_001267550.2(TTN):c.33344C>A (p.Pro11115His) rs1060500394
NM_001267550.2(TTN):c.33367G>A (p.Ala11123Thr) rs200321239
NM_001267550.2(TTN):c.33377A>C (p.Lys11126Thr) rs760742068
NM_001267550.2(TTN):c.33445C>T (p.Pro11149Ser) rs377760800
NM_001267550.2(TTN):c.33581-8C>G rs888213772
NM_001267550.2(TTN):c.33601C>A (p.Pro11201Thr) rs769195017
NM_001267550.2(TTN):c.33656C>T (p.Pro11219Leu) rs757268986
NM_001267550.2(TTN):c.33664+6C>G rs1060500524
NM_001267550.2(TTN):c.3368C>G (p.Thr1123Ser) rs773799748
NM_001267550.2(TTN):c.33742+1G>T rs772114165
NM_001267550.2(TTN):c.33775G>A (p.Glu11259Lys) rs1060500563
NM_001267550.2(TTN):c.33788T>C (p.Val11263Ala) rs748148683
NM_001267550.2(TTN):c.33796C>T (p.Pro11266Ser) rs201120871
NM_001267550.2(TTN):c.337A>G (p.Met113Val) rs1060500430
NM_001267550.2(TTN):c.33838C>T (p.Pro11280Ser) rs374449452
NM_001267550.2(TTN):c.33856G>A (p.Glu11286Lys) rs376874956
NM_001267550.2(TTN):c.3386A>G (p.Lys1129Arg) rs181375012
NM_001267550.2(TTN):c.33911-7T>C rs397517545
NM_001267550.2(TTN):c.33961G>A (p.Val11321Ile) rs878854298
NM_001267550.2(TTN):c.34006C>T (p.Arg11336Cys) rs763380355
NM_001267550.2(TTN):c.34027G>A (p.Val11343Ile) rs369025108
NM_001267550.2(TTN):c.34075C>G (p.Pro11359Ala) rs1060500464
NM_001267550.2(TTN):c.34093_34102del (p.Pro11365fs) rs1553823547
NM_001267550.2(TTN):c.34098_34118GGAAGAGGAAGTTCTACCTGA[1] (p.11363_11369VLPEEEE[3]) rs397517548
NM_001267550.2(TTN):c.34098_34118GGAAGAGGAAGTTCTACCTGA[3] (p.11363_11369VLPEEEE[5]) rs397517548
NM_001267550.2(TTN):c.34098_34118GGAAGAGGAAGTTCTACCTGA[4] (p.11363_11369VLPEEEE[6]) rs397517548
NM_001267550.2(TTN):c.34108G>A (p.Val11370Ile) rs1060500545
NM_001267550.2(TTN):c.34201G>A (p.Glu11401Lys) rs765827814
NM_001267550.2(TTN):c.34225G>A (p.Glu11409Lys) rs770657053
NM_001267550.2(TTN):c.34238C>G (p.Pro11413Arg) rs769658955
NM_001267550.2(TTN):c.34240G>A (p.Glu11414Lys) rs748080418
NM_001267550.2(TTN):c.34247_34248delinsTC (p.Glu11416Val) rs1060500408
NM_001267550.2(TTN):c.34253_34277del (p.Leu11418fs) rs1373610867
NM_001267550.2(TTN):c.34294C>T (p.Pro11432Ser) rs534339525
NM_001267550.2(TTN):c.34307A>G (p.Lys11436Arg) rs568554504
NM_001267550.2(TTN):c.34354G>A (p.Val11452Met) rs938988662
NM_001267550.2(TTN):c.34379-3A>T rs1060500497
NM_001267550.2(TTN):c.34400T>C (p.Val11467Ala) rs981211046
NM_001267550.2(TTN):c.34402_34416del (p.Thr11468_Val11472del) rs754236839
NM_001267550.2(TTN):c.34486A>G (p.Lys11496Glu) rs1034048129
NM_001267550.2(TTN):c.34537+3A>G rs1427570685
NM_001267550.2(TTN):c.34570C>T (p.Arg11524Ter) rs1441434215
NM_001267550.2(TTN):c.34571G>A (p.Arg11524Gln) rs201622536
NM_001267550.2(TTN):c.34583C>T (p.Pro11528Leu) rs1553815977
NM_001267550.2(TTN):c.34592A>G (p.Glu11531Gly) rs1553815943
NM_001267550.2(TTN):c.34601T>C (p.Leu11534Pro) rs376836503
NM_001267550.2(TTN):c.34612+2T>C
NM_001267550.2(TTN):c.34660_34662GAA[1] (p.Glu11555del) rs763098227
NM_001267550.2(TTN):c.34670C>T (p.Pro11557Leu) rs887706962
NM_001267550.2(TTN):c.34684G>A (p.Val11562Ile) rs1060500397
NM_001267550.2(TTN):c.34709-1G>A rs727503634
NM_001267550.2(TTN):c.34735C>T (p.Pro11579Ser) rs754511830
NM_001267550.2(TTN):c.34742C>T (p.Ala11581Val) rs1060500436
NM_001267550.2(TTN):c.3476G>A (p.Arg1159His) rs149883066
NM_001267550.2(TTN):c.34772C>T (p.Ala11591Val) rs72650052
NM_001267550.2(TTN):c.34816C>T (p.Pro11606Ser) rs1553810609
NM_001267550.2(TTN):c.34823C>T (p.Pro11608Leu) rs1553810583
NM_001267550.2(TTN):c.34826T>C (p.Val11609Ala) rs767524348
NM_001267550.2(TTN):c.34855G>A (p.Val11619Met) rs1560262245
NM_001267550.2(TTN):c.34931-10G>A rs1553809647
NM_001267550.2(TTN):c.34952A>C (p.Lys11651Thr) rs373656002
NM_001267550.2(TTN):c.34954G>T (p.Val11652Leu) rs371752190
NM_001267550.2(TTN):c.34969C>T (p.Arg11657Cys) rs1187808745
NM_001267550.2(TTN):c.34979T>C (p.Val11660Ala) rs1553809428
NM_001267550.2(TTN):c.34982T>C (p.Val11661Ala) rs199561793
NM_001267550.2(TTN):c.35082C>T (p.Gly11694=) rs377761863
NM_001267550.2(TTN):c.35104T>G (p.Phe11702Val) rs1553809123
NM_001267550.2(TTN):c.35155G>T (p.Val11719Phe) rs754098075
NM_001267550.2(TTN):c.35156T>C (p.Val11719Ala) rs754536506
NM_001267550.2(TTN):c.35194G>A (p.Glu11732Lys) rs939014361
NM_001267550.2(TTN):c.35265A>G (p.Lys11755=) rs774526152
NM_001267550.2(TTN):c.35291A>G (p.Lys11764Arg) rs1060500446
NM_001267550.2(TTN):c.35293G>C (p.Glu11765Gln) rs1060500577
NM_001267550.2(TTN):c.35294A>G (p.Glu11765Gly) rs1319484684
NM_001267550.2(TTN):c.35312C>T (p.Pro11771Leu) rs373508919
NM_001267550.2(TTN):c.35330T>C (p.Ile11777Thr) rs1393138345
NM_001267550.2(TTN):c.35384A>C (p.Lys11795Thr) rs890825956
NM_001267550.2(TTN):c.35387C>A (p.Ala11796Glu) rs200321949
NM_001267550.2(TTN):c.35470+4T>C rs1389073196
NM_001267550.2(TTN):c.35471-9T>C rs746940707
NM_001267550.2(TTN):c.35584G>C (p.Val11862Leu) rs1553800435
NM_001267550.2(TTN):c.35629+3A>G rs751928755
NM_001267550.2(TTN):c.35662G>A (p.Asp11888Asn) rs1356416507
NM_001267550.2(TTN):c.35678C>G (p.Thr11893Ser) rs750832804
NM_001267550.2(TTN):c.35693G>A (p.Arg11898Lys) rs1553799769
NM_001267550.2(TTN):c.35717C>G (p.Pro11906Arg) rs781317174
NM_001267550.2(TTN):c.35794G>T (p.Glu11932Ter) rs878854299
NM_001267550.2(TTN):c.35797+1G>T rs917175304
NM_001267550.2(TTN):c.35797G>A (p.Glu11933Lys)
NM_001267550.2(TTN):c.35797G>C (p.Glu11933Gln) rs769110483
NM_001267550.2(TTN):c.35828dup (p.Glu11945Argfs) rs765879488
NM_001267550.2(TTN):c.35890C>T (p.Arg11964Ter) rs1266298136
NM_001267550.2(TTN):c.35897T>G (p.Ile11966Ser) rs1553796799
NM_001267550.2(TTN):c.35924C>A (p.Ala11975Asp) rs182102510
NM_001267550.2(TTN):c.35939T>C (p.Ile11980Thr) rs927982415
NM_001267550.2(TTN):c.35959+5C>T rs758684276
NM_001267550.2(TTN):c.35972T>C (p.Met11991Thr) rs1553796242
NM_001267550.2(TTN):c.36035G>A (p.Arg12012His) rs576436744
NM_001267550.2(TTN):c.36043+4C>T rs370368656
NM_001267550.2(TTN):c.36043+6T>C rs765412168
NM_001267550.2(TTN):c.36044C>G (p.Thr12015Arg) rs199868380
NM_001267550.2(TTN):c.3605T>C (p.Val1202Ala) rs150667217
NM_001267550.2(TTN):c.3608G>C (p.Gly1203Ala) rs564353179
NM_001267550.2(TTN):c.3611A>C (p.Glu1204Ala) rs779302369
NM_001267550.2(TTN):c.36158C>T (p.Thr12053Met) rs761169549
NM_001267550.2(TTN):c.3616G>T (p.Ala1206Ser) rs200749662
NM_001267550.2(TTN):c.36170C>A (p.Pro12057His) rs374834199
NM_001267550.2(TTN):c.3619C>A (p.Pro1207Thr) rs373753003
NM_001267550.2(TTN):c.36227T>C (p.Val12076Ala) rs772990799
NM_001267550.2(TTN):c.36281-9T>C rs760175676
NM_001267550.2(TTN):c.36310G>T (p.Glu12104Ter) rs1455879402
NM_001267550.2(TTN):c.36322T>A (p.Ser12108Thr) rs989137248
NM_001267550.2(TTN):c.36342G>C (p.Lys12114Asn) rs766280406
NM_001267550.2(TTN):c.36364+4dup rs949125365
NM_001267550.2(TTN):c.36365-7T>C rs746341489
NM_001267550.2(TTN):c.3637G>C (p.Glu1213Gln) rs1043395012
NM_001267550.2(TTN):c.36391C>T (p.Arg12131Cys) rs368607833
NM_001267550.2(TTN):c.36427C>T (p.Pro12143Ser) rs779794774
NM_001267550.2(TTN):c.36448G>T (p.Val12150Leu) rs371317962
NM_001267550.2(TTN):c.36461C>G (p.Pro12154Arg) rs371580084
NM_001267550.2(TTN):c.36490C>A (p.Pro12164Thr) rs373422655
NM_001267550.2(TTN):c.36499C>T (p.Pro12167Ser) rs780323492
NM_001267550.2(TTN):c.36520C>A (p.Pro12174Thr) rs762482452
NM_001267550.2(TTN):c.36568A>G (p.Lys12190Glu) rs749339946
NM_001267550.2(TTN):c.36617-5T>A rs771059357
NM_001267550.2(TTN):c.36644C>T (p.Pro12215Leu) rs367720476
NM_001267550.2(TTN):c.36680C>T (p.Pro12227Leu) rs767455362
NM_001267550.2(TTN):c.36685A>G (p.Ser12229Gly) rs1060500531
NM_001267550.2(TTN):c.36696del (p.Glu12233fs) rs1060500458
NM_001267550.2(TTN):c.36701-6T>G rs1060500422
NM_001267550.2(TTN):c.36701-9T>G rs1060500427
NM_001267550.2(TTN):c.36708A>T (p.Glu12236Asp) rs796478043
NM_001267550.2(TTN):c.36737A>T (p.Glu12246Val) rs786205395
NM_001267550.2(TTN):c.36802C>G (p.Pro12268Ala) rs1461810893
NM_001267550.2(TTN):c.36803C>G (p.Pro12268Arg) rs997014833
NM_001267550.2(TTN):c.36830C>T (p.Ala12277Val) rs878854300
NM_001267550.2(TTN):c.36847A>C (p.Lys12283Gln) rs1479390801
NM_001267550.2(TTN):c.36865C>A (p.Arg12289Ser) rs1480219250
NM_001267550.2(TTN):c.36952G>A (p.Val12318Ile) rs762149243
NM_001267550.2(TTN):c.36982A>G (p.Thr12328Ala) rs146313925
NM_001267550.2(TTN):c.37019C>T (p.Pro12340Leu) rs778829839
NM_001267550.2(TTN):c.3701T>C (p.Val1234Ala) rs1060500401
NM_001267550.2(TTN):c.37029A>G (p.Pro12343=) rs200163049
NM_001267550.2(TTN):c.37099C>G (p.Pro12367Ala) rs973940125
NM_001267550.2(TTN):c.37193C>T (p.Pro12398Leu) rs570730533
NM_001267550.2(TTN):c.37208A>C (p.Glu12403Ala) rs878854301
NM_001267550.2(TTN):c.37222G>A (p.Val12408Ile) rs1553786445
NM_001267550.2(TTN):c.37373C>T (p.Pro12458Leu) rs1553782191
NM_001267550.2(TTN):c.37397C>T (p.Pro12466Leu) rs727503632
NM_001267550.2(TTN):c.37408G>T (p.Val12470Leu) rs398124448
NM_001267550.2(TTN):c.37421T>C (p.Ile12474Thr) rs72650057
NM_001267550.2(TTN):c.37447C>G (p.Pro12483Ala) rs1060500552
NM_001267550.2(TTN):c.37477G>A (p.Glu12493Lys) rs1426948805
NM_001267550.2(TTN):c.37489G>A (p.Glu12497Lys) rs1553781387
NM_001267550.2(TTN):c.37496A>C (p.Lys12499Thr) rs1367017667
NM_001267550.2(TTN):c.37502C>T (p.Pro12501Leu) rs1236045684
NM_001267550.2(TTN):c.37543+1G>A rs1374931889
NM_001267550.2(TTN):c.37543+5G>T rs570767771
NM_001267550.2(TTN):c.37576A>T (p.Lys12526Ter) rs1560149950
NM_001267550.2(TTN):c.37616_37627+12del rs1560149416
NM_001267550.2(TTN):c.37651G>A (p.Val12551Ile) rs1437747405
NM_001267550.2(TTN):c.37702G>A (p.Ala12568Thr) rs1060500468
NM_001267550.2(TTN):c.37711G>A (p.Val12571Met)
NM_001267550.2(TTN):c.37903G>C (p.Glu12635Gln) rs749935074
NM_001267550.2(TTN):c.37949T>C (p.Val12650Ala) rs1553779318
NM_001267550.2(TTN):c.37996C>A (p.Pro12666Thr) rs201684070
NM_001267550.2(TTN):c.38000C>A (p.Ser12667Ter)
NM_001267550.2(TTN):c.38002A>G (p.Thr12668Ala) rs1168512202
NM_001267550.2(TTN):c.38042C>T (p.Pro12681Leu) rs1553777756
NM_001267550.2(TTN):c.38101C>T (p.Pro12701Ser) rs1284117197
NM_001267550.2(TTN):c.38123-8C>A rs1481421931
NM_001267550.2(TTN):c.38147T>A (p.Val12716Asp) rs1553777417
NM_001267550.2(TTN):c.38161G>T (p.Val12721Leu) rs794729416
NM_001267550.2(TTN):c.38230G>A (p.Glu12744Lys) rs1553777033
NM_001267550.2(TTN):c.38249A>C (p.Lys12750Thr) rs1337231554
NM_001267550.2(TTN):c.38275C>G (p.Pro12759Ala) rs1162101042
NM_001267550.2(TTN):c.38316A>C (p.Glu12772Asp) rs1195550297
NM_001267550.2(TTN):c.38321T>C (p.Val12774Ala) rs747414237
NM_001267550.2(TTN):c.38353A>G (p.Lys12785Glu) rs864622709
NM_001267550.2(TTN):c.38372G>C (p.Arg12791Pro) rs1237577240
NM_001267550.2(TTN):c.38424del (p.Lys12809fs) rs1553775991
NM_001267550.2(TTN):c.38465-5T>A rs906108078
NM_001267550.2(TTN):c.38465-8C>A rs937031915
NM_001267550.2(TTN):c.38519A>G (p.Lys12840Arg) rs1250144035
NM_001267550.2(TTN):c.38546-2del rs1486772794
NM_001267550.2(TTN):c.38626+4dup rs1260372587
NM_001267550.2(TTN):c.38660del (p.Lys12887fs) rs761617432
NM_001267550.2(TTN):c.38681A>G (p.Lys12894Arg) rs574694398
NM_001267550.2(TTN):c.38723_38725AAG[1] (p.Glu12909del) rs1060500390
NM_001267550.2(TTN):c.38783C>G (p.Pro12928Arg) rs752337495
NM_001267550.2(TTN):c.38879_38880inv (p.Pro12960Leu)
NM_001267550.2(TTN):c.38915T>C (p.Met12972Thr) rs1060500540
NM_001267550.2(TTN):c.39001C>A (p.Pro13001Thr) rs878854302
NM_001267550.2(TTN):c.39056C>T (p.Pro13019Leu) rs763845436
NM_001267550.2(TTN):c.39057G>C (p.Pro13019=) rs371945519
NM_001267550.2(TTN):c.39059_39061AAG[1] (p.Glu13021del) rs1298186498
NM_001267550.2(TTN):c.39064G>A (p.Val13022Ile) rs767090806
NM_001267550.2(TTN):c.39067G>T (p.Val13023Phe) rs774402932
NM_001267550.2(TTN):c.39089C>T (p.Ala13030Val) rs747459623
NM_001267550.2(TTN):c.39115A>C (p.Thr13039Pro) rs766921440
NM_001267550.2(TTN):c.39201_39203dup (p.Pro13068dup) rs748388695
NM_001267550.2(TTN):c.39204del (p.Thr13069fs) rs1560106851
NM_001267550.2(TTN):c.39235G>A (p.Val13079Ile) rs777119867
NM_001267550.2(TTN):c.39250G>T (p.Val13084Leu) rs72650062
NM_001267550.2(TTN):c.39276G>A (p.Pro13092=) rs369002632
NM_001267550.2(TTN):c.39289C>A (p.Pro13097Thr) rs370157162
NM_001267550.2(TTN):c.39301G>A (p.Glu13101Lys) rs201035457
NM_001267550.2(TTN):c.39374_39376del (p.Pro13125del) rs1292233616
NM_001267550.2(TTN):c.39389C>T (p.Pro13130Leu) rs370520319
NM_001267550.2(TTN):c.39407C>T (p.Pro13136Leu) rs1060500460
NM_001267550.2(TTN):c.39418G>A (p.Ala13140Thr) rs781407045
NM_001267550.2(TTN):c.39427G>A (p.Val13143Ile) rs375956503
NM_001267550.2(TTN):c.39430G>A (p.Val13144Ile) rs374394719
NM_001267550.2(TTN):c.39469G>A (p.Glu13157Lys) rs761974767
NM_001267550.2(TTN):c.39511G>A (p.Val13171Met) rs780550944
NM_001267550.2(TTN):c.39525G>C (p.Lys13175Asn) rs1060500515
NM_001267550.2(TTN):c.39563_39565AAG[1] (p.Glu13189del) rs1553769206
NM_001267550.2(TTN):c.39673C>T (p.Pro13225Ser) rs202240398
NM_001267550.2(TTN):c.39709+4C>T rs1553768226
NM_001267550.2(TTN):c.39743A>T (p.Glu13248Val) rs1224909860
NM_001267550.2(TTN):c.39802G>T (p.Val13268Phe) rs759268958
NM_001267550.2(TTN):c.39819_39820delinsTT (p.Pro13274Ser) rs727503630
NM_001267550.2(TTN):c.39851A>G (p.Lys13284Arg) rs768562722
NM_001267550.2(TTN):c.39862G>C (p.Val13288Leu) rs878854303
NM_001267550.2(TTN):c.39883C>A (p.Pro13295Thr) rs749860520
NM_001267550.2(TTN):c.39887C>G (p.Pro13296Arg) rs760464072
NM_001267550.2(TTN):c.39895+1G>C rs749931280
NM_001267550.2(TTN):c.39895+1G>T rs749931280
NM_001267550.2(TTN):c.39895G>T (p.Glu13299Ter)
NM_001267550.2(TTN):c.39919G>T (p.Val13307Phe) rs553280930
NM_001267550.2(TTN):c.39928A>C (p.Lys13310Gln) rs1317959875
NM_001267550.2(TTN):c.39941C>A (p.Thr13314Asn) rs543338451
NM_001267550.2(TTN):c.39943G>C (p.Val13315Leu) rs1553766447
NM_001267550.2(TTN):c.39995T>G (p.Leu13332Arg) rs1424568997
NM_001267550.2(TTN):c.40109T>C (p.Ile13370Thr) rs904655100
NM_001267550.2(TTN):c.40123G>A (p.Glu13375Lys) rs988844595
NM_001267550.2(TTN):c.40126G>A (p.Val13376Ile) rs1060500428
NM_001267550.2(TTN):c.40141+6C>A rs750448649
NM_001267550.2(TTN):c.40141+6C>T rs750448649
NM_001267550.2(TTN):c.40222+6T>C rs1182693405
NM_001267550.2(TTN):c.40223A>G (p.Glu13408Gly) rs183950862
NM_001267550.2(TTN):c.40225C>T (p.Arg13409Cys) rs769146381
NM_001267550.2(TTN):c.40316T>C (p.Val13439Ala) rs1553761103
NM_001267550.2(TTN):c.40349C>T (p.Pro13450Leu) rs372424006
NM_001267550.2(TTN):c.40352C>A (p.Pro13451His) rs370048456
NM_001267550.2(TTN):c.40395A>G (p.Ile13465Met) rs766145596
NM_001267550.2(TTN):c.40409-2A>C rs1560046529
NM_001267550.2(TTN):c.40409-8C>A rs1351493193
NM_001267550.2(TTN):c.40511T>G (p.Leu13504Arg) rs776115575
NM_001267550.2(TTN):c.40558+4T>C rs398124451
NM_001267550.2(TTN):c.40576_40578GAA[3] (p.Glu13529del) rs727504199
NM_001267550.2(TTN):c.40595T>G (p.Val13532Gly) rs756446770
NM_001267550.2(TTN):c.40636C>A (p.Pro13546Thr) rs1393076582
NM_001267550.2(TTN):c.40666G>A (p.Glu13556Lys) rs781066709
NM_001267550.2(TTN):c.40690A>G (p.Lys13564Glu) rs758942655
NM_001267550.2(TTN):c.40712A>T (p.Glu13571Val) rs1190002260
NM_001267550.2(TTN):c.40723+1del rs876658058
NM_001267550.2(TTN):c.40760_40787-52del rs1553752889
NM_001267550.2(TTN):c.40766C>T (p.Pro13589Leu) rs200939270
NM_001267550.2(TTN):c.40796C>T (p.Thr13599Ile) rs370418677
NM_001267550.2(TTN):c.40877-3C>A rs746615904
NM_001267550.2(TTN):c.40879G>A (p.Ala13627Thr) rs1060500548
NM_001267550.2(TTN):c.40903G>A (p.Ala13635Thr) rs191699632
NM_001267550.2(TTN):c.40927+1G>A rs1553749862
NM_001267550.2(TTN):c.40946C>T (p.Pro13649Leu) rs771839127
NM_001267550.2(TTN):c.40963G>T (p.Glu13655Ter) rs727504198
NM_001267550.2(TTN):c.40973A>G (p.Lys13658Arg) rs184713215
NM_001267550.2(TTN):c.40988G>A (p.Ser13663Asn) rs1060500537
NM_001267550.2(TTN):c.41018C>T (p.Pro13673Leu) rs765821223
NM_001267550.2(TTN):c.41104T>C (p.Ser13702Pro) rs72650078
NM_001267550.2(TTN):c.41118del (p.Phe13706fs) rs878854305
NM_001267550.2(TTN):c.41146A>G (p.Ile13716Val) rs531807386
NM_001267550.2(TTN):c.41149A>C (p.Thr13717Pro) rs1553747949
NM_001267550.2(TTN):c.41152A>T (p.Thr13718Ser) rs562561380
NM_001267550.2(TTN):c.41180G>A (p.Arg13727His) rs750520224
NM_001267550.2(TTN):c.41222_41223del (p.Arg13741fs) rs1436937190
NM_001267550.2(TTN):c.41254G>A (p.Asp13752Asn) rs1349773180
NM_001267550.2(TTN):c.41273_41274GT[1] (p.Val13759fs)
NM_001267550.2(TTN):c.41309C>T (p.Thr13770Met) rs774214497
NM_001267550.2(TTN):c.41342G>A (p.Arg13781His) rs370878642
NM_001267550.2(TTN):c.41406C>T (p.Cys13802=) rs749356221
NM_001267550.2(TTN):c.41415_41418del (p.Asn13805fs)
NM_001267550.2(TTN):c.41473C>T (p.Arg13825Ter) rs869312043
NM_001267550.2(TTN):c.41521G>A (p.Asp13841Asn) rs201257644
NM_001267550.2(TTN):c.41540C>T (p.Ala13847Val) rs1439068447
NM_001267550.2(TTN):c.41542G>A (p.Gly13848Arg) rs1553746427
NM_001267550.2(TTN):c.41548T>C (p.Tyr13850His) rs774281208
NM_001267550.2(TTN):c.41582A>C (p.Glu13861Ala) rs1553746267
NM_001267550.2(TTN):c.41596G>A (p.Val13866Ile) rs375474669
NM_001267550.2(TTN):c.415C>T (p.Arg139Trp) rs752970602
NM_001267550.2(TTN):c.41609-2A>C rs730880244
NM_001267550.2(TTN):c.41609-2A>G rs730880244
NM_001267550.2(TTN):c.41620G>A (p.Asp13874Asn) rs770045249
NM_001267550.2(TTN):c.41641C>T (p.Arg13881Ter)
NM_001267550.2(TTN):c.41744C>T (p.Ala13915Val) rs371426048
NM_001267550.2(TTN):c.41745G>A (p.Ala13915=) rs780790022
NM_001267550.2(TTN):c.41768T>A (p.Ile13923Lys) rs1553745511
NM_001267550.2(TTN):c.41818G>C (p.Glu13940Gln) rs1172846357
NM_001267550.2(TTN):c.41888G>A (p.Arg13963His) rs540582993
NM_001267550.2(TTN):c.41894T>G (p.Val13965Gly) rs878854306
NM_001267550.2(TTN):c.41908C>T (p.Pro13970Ser) rs189799340
NM_001267550.2(TTN):c.42003A>T (p.Gly14001=) rs1553744821
NM_001267550.2(TTN):c.42023C>T (p.Pro14008Leu) rs751709914
NM_001267550.2(TTN):c.42046G>A (p.Gly14016Ser) rs367751077
NM_001267550.2(TTN):c.42103C>T (p.Leu14035Phe) rs1433887768
NM_001267550.2(TTN):c.42108C>G (p.Tyr14036Ter) rs1311474144
NM_001267550.2(TTN):c.42152-7_42153del rs1559975119
NM_001267550.2(TTN):c.42157G>A (p.Glu14053Lys) rs759050071
NM_001267550.2(TTN):c.42202dup (p.Arg14068fs) rs1559974529
NM_001267550.2(TTN):c.42214C>T (p.Arg14072Ter) rs794729258
NM_001267550.2(TTN):c.42382G>A (p.Gly14128Ser) rs1553743503
NM_001267550.2(TTN):c.42401G>A (p.Arg14134Gln) rs764083952
NM_001267550.2(TTN):c.42447A>G (p.Glu14149=) rs879241728
NM_001267550.2(TTN):c.42509T>C (p.Met14170Thr) rs369623392
NM_001267550.2(TTN):c.42598_42599insG (p.Met14200fs) rs1553742630
NM_001267550.2(TTN):c.42714T>G (p.His14238Gln) rs1438979717
NM_001267550.2(TTN):c.42764G>A (p.Ser14255Asn) rs368433387
NM_001267550.2(TTN):c.42769G>A (p.Asp14257Asn) rs746571349
NM_001267550.2(TTN):c.427G>A (p.Glu143Lys) rs754182768
NM_001267550.2(TTN):c.42829A>T (p.Ile14277Phe) rs397517568
NM_001267550.2(TTN):c.42839A>G (p.Asp14280Gly) rs181902304
NM_001267550.2(TTN):c.42840T>G (p.Asp14280Glu) rs760643071
NM_001267550.2(TTN):c.42851G>A (p.Arg14284His) rs368572799
NM_001267550.2(TTN):c.42869A>C (p.Lys14290Thr) rs1060500499
NM_001267550.2(TTN):c.42891C>T (p.Gly14297=) rs550471556
NM_001267550.2(TTN):c.42919_42923del (p.Lys14307fs) rs1060500566
NM_001267550.2(TTN):c.42946+3G>A
NM_001267550.2(TTN):c.43019T>C (p.Ile14340Thr) rs397517571
NM_001267550.2(TTN):c.43045G>A (p.Gly14349Ser) rs781452930
NM_001267550.2(TTN):c.43100T>C (p.Ile14367Thr) rs397517572
NM_001267550.2(TTN):c.43120A>G (p.Ile14374Val) rs754227553
NM_001267550.2(TTN):c.43122del (p.Ile14374_Leu14375insTer) rs1203006457
NM_001267550.2(TTN):c.43133A>G (p.His14378Arg) rs878854307
NM_001267550.2(TTN):c.43146G>A (p.Leu14382=) rs751236287
NM_001267550.2(TTN):c.43211A>C (p.Lys14404Thr) rs1296402152
NM_001267550.2(TTN):c.43249G>A (p.Val14417Ile) rs906675886
NM_001267550.2(TTN):c.43315C>T (p.Arg14439Cys) rs200914097
NM_001267550.2(TTN):c.43351G>A (p.Asp14451Asn) rs768931150
NM_001267550.2(TTN):c.43355G>T (p.Arg14452Ile) rs528741819
NM_001267550.2(TTN):c.43422A>T (p.Glu14474Asp) rs998106657
NM_001267550.2(TTN):c.43460G>A (p.Ser14487Asn) rs770233190
NM_001267550.2(TTN):c.43501A>G (p.Thr14501Ala) rs764500643
NM_001267550.2(TTN):c.43565A>G (p.His14522Arg) rs374085402
NM_001267550.2(TTN):c.43577G>A (p.Arg14526Gln) rs373491468
NM_001267550.2(TTN):c.43666A>G (p.Lys14556Glu) rs1553738199
NM_001267550.2(TTN):c.43669G>A (p.Asp14557Asn) rs794729431
NM_001267550.2(TTN):c.43681G>T (p.Asp14561Tyr) rs745655055
NM_001267550.2(TTN):c.43690T>A (p.Ser14564Thr) rs181189778
NM_001267550.2(TTN):c.43691C>G (p.Ser14564Cys) rs377015571
NM_001267550.2(TTN):c.43717A>G (p.Met14573Val) rs755610701
NM_001267550.2(TTN):c.43747+5G>C rs878854308
NM_001267550.2(TTN):c.43913A>G (p.Lys14638Arg) rs878896650
NM_001267550.2(TTN):c.43955T>C (p.Ile14652Thr) rs767038885
NM_001267550.2(TTN):c.43970G>C (p.Cys14657Ser) rs774245300
NM_001267550.2(TTN):c.43986T>G (p.Asp14662Glu) rs201390600
NM_001267550.2(TTN):c.43G>A (p.Val15Ile) rs201857541
NM_001267550.2(TTN):c.44017C>G (p.Arg14673Gly) rs773004022
NM_001267550.2(TTN):c.44035C>T (p.Arg14679Ter)
NM_001267550.2(TTN):c.44036G>A (p.Arg14679Gln) rs369709751
NM_001267550.2(TTN):c.44078G>A (p.Arg14693His) rs746380621
NM_001267550.2(TTN):c.44117A>G (p.Asn14706Ser) rs878854309
NM_001267550.2(TTN):c.44154+4A>T
NM_001267550.2(TTN):c.44184A>G (p.Ile14728Met) rs572315033
NM_001267550.2(TTN):c.44191C>T (p.Leu14731Phe) rs771361227
NM_001267550.2(TTN):c.44210G>A (p.Arg14737His) rs373298007
NM_001267550.2(TTN):c.44222C>T (p.Thr14741Met) rs778576436
NM_001267550.2(TTN):c.44272C>T (p.Arg14758Ter) rs140743001
NM_001267550.2(TTN):c.44273G>A (p.Arg14758Gln) rs770389312
NM_001267550.2(TTN):c.44281+1G>A rs771562210
NM_001267550.2(TTN):c.44281+2dup
NM_001267550.2(TTN):c.44281C>T (p.Pro14761Ser) rs192766485
NM_001267550.2(TTN):c.44285G>A (p.Arg14762Gln) rs727505019
NM_001267550.2(TTN):c.44285G>C (p.Arg14762Pro) rs727505019
NM_001267550.2(TTN):c.44323G>A (p.Val14775Met) rs540115992
NM_001267550.2(TTN):c.44335G>C (p.Glu14779Gln) rs1262894259
NM_001267550.2(TTN):c.44366A>G (p.Tyr14789Cys) rs397517577
NM_001267550.2(TTN):c.44375T>A (p.Ile14792Asn) rs747654057
NM_001267550.2(TTN):c.44413C>G (p.Pro14805Ala) rs753926213
NM_001267550.2(TTN):c.44419G>A (p.Asp14807Asn) rs753053245
NM_001267550.2(TTN):c.44423A>C (p.Lys14808Thr) rs374419129
NM_001267550.2(TTN):c.44425G>A (p.Val14809Met) rs775225695
NM_001267550.2(TTN):c.44435G>A (p.Arg14812His) rs375574483
NM_001267550.2(TTN):c.44472T>G (p.Asp14824Glu) rs377441854
NM_001267550.2(TTN):c.44481_44483AGA[1] (p.Glu14828del) rs727505315
NM_001267550.2(TTN):c.44492G>A (p.Gly14831Glu) rs751929345
NM_001267550.2(TTN):c.44494del (p.Glu14832fs) rs1553725355
NM_001267550.2(TTN):c.44525C>T (p.Thr14842Ile) rs370782364
NM_001267550.2(TTN):c.44530G>A (p.Ala14844Thr) rs772053966
NM_001267550.2(TTN):c.44542G>A (p.Val14848Met) rs759373140
NM_001267550.2(TTN):c.44580G>C (p.Glu14860Asp) rs1060500475
NM_001267550.2(TTN):c.44736T>A (p.His14912Gln) rs762830792
NM_001267550.2(TTN):c.44743A>G (p.Thr14915Ala) rs878854310
NM_001267550.2(TTN):c.44848G>A (p.Asp14950Asn) rs571524382
NM_001267550.2(TTN):c.44850C>A (p.Asp14950Glu) rs371376631
NM_001267550.2(TTN):c.44899C>T (p.Arg14967Ter) rs727505350
NM_001267550.2(TTN):c.44900G>A (p.Arg14967Gln) rs752671402
NM_001267550.2(TTN):c.44913+1G>T rs1553721106
NM_001267550.2(TTN):c.44913G>C (p.Lys14971Asn)
NM_001267550.2(TTN):c.44978G>A (p.Gly14993Glu) rs200931793
NM_001267550.2(TTN):c.44987G>A (p.Arg14996His) rs762128685
NM_001267550.2(TTN):c.44993T>C (p.Leu14998Pro) rs1553719829
NM_001267550.2(TTN):c.44998A>G (p.Ile15000Val) rs775264673
NM_001267550.2(TTN):c.45001A>C (p.Asn15001His) rs373109469
NM_001267550.2(TTN):c.45014T>C (p.Leu15005Pro) rs369992659
NM_001267550.2(TTN):c.45052G>C (p.Ala15018Pro) rs1060500472
NM_001267550.2(TTN):c.45128G>A (p.Ser15043Asn) rs376144178
NM_001267550.2(TTN):c.45156T>A (p.Cys15052Ter) rs1060500487
NM_001267550.2(TTN):c.45212T>C (p.Ile15071Thr) rs184078045
NM_001267550.2(TTN):c.45307C>T (p.Arg15103Ter) rs397517580
NM_001267550.2(TTN):c.45322C>T (p.Arg15108Ter) rs1060500405
NM_001267550.2(TTN):c.45349+3A>G rs1553718424
NM_001267550.2(TTN):c.45449T>G (p.Val15150Gly) rs1060500496
NM_001267550.2(TTN):c.45505G>A (p.Ala15169Thr) rs759247684
NM_001267550.2(TTN):c.45535A>T (p.Lys15179Ter) rs1559877046
NM_001267550.2(TTN):c.45589A>G (p.Arg15197Gly) rs748906368
NM_001267550.2(TTN):c.45601C>G (p.His15201Asp) rs794729438
NM_001267550.2(TTN):c.45652C>T (p.Arg15218Trp) rs371621174
NM_001267550.2(TTN):c.45725G>A (p.Arg15242Lys) rs140795503
NM_001267550.2(TTN):c.45737C>T (p.Ala15246Val) rs370233278
NM_001267550.2(TTN):c.45760A>T (p.Ile15254Phe) rs72677226
NM_001267550.2(TTN):c.45814del (p.Asp15272fs)
NM_001267550.2(TTN):c.45895+5G>C rs1206842325
NM_001267550.2(TTN):c.45916G>A (p.Glu15306Lys) rs774339883
NM_001267550.2(TTN):c.45940A>T (p.Met15314Leu) rs1391292606
NM_001267550.2(TTN):c.45979C>T (p.Arg15327Cys) rs367774903
NM_001267550.2(TTN):c.45989dup (p.Thr15331fs) rs1553715911
NM_001267550.2(TTN):c.46037G>A (p.Arg15346His) rs367996763
NM_001267550.2(TTN):c.46061A>G (p.Tyr15354Cys) rs886038861
NM_001267550.2(TTN):c.46078_46092del (p.Ile15360_Gly15364del) rs727505075
NM_001267550.2(TTN):c.46160T>C (p.Ile15387Thr) rs397517585
NM_001267550.2(TTN):c.46169C>T (p.Pro15390Leu) rs879113967
NM_001267550.2(TTN):c.46211A>G (p.Glu15404Gly) rs878854311
NM_001267550.2(TTN):c.46222G>A (p.Ala15408Thr) rs730880239
NM_001267550.2(TTN):c.46285G>T (p.Glu15429Ter)
NM_001267550.2(TTN):c.46305-1G>C rs1553714845
NM_001267550.2(TTN):c.46363G>A (p.Asp15455Asn) rs370813526
NM_001267550.2(TTN):c.46369G>A (p.Glu15457Lys) rs753664074
NM_001267550.2(TTN):c.46371G>C (p.Glu15457Asp) rs764100235
NM_001267550.2(TTN):c.46399dup (p.Arg15467fs) rs1060500443
NM_001267550.2(TTN):c.46451G>A (p.Arg15484Lys) rs72677229
NM_001267550.2(TTN):c.46521G>C (p.Lys15507Asn) rs781291079
NM_001267550.2(TTN):c.46550T>C (p.Met15517Thr) rs1349699547
NM_001267550.2(TTN):c.46569T>A (p.Asp15523Glu) rs1553713980
NM_001267550.2(TTN):c.46591G>A (p.Gly15531Arg) rs761815745
NM_001267550.2(TTN):c.46696+4A>G rs1553713646
NM_001267550.2(TTN):c.46702C>T (p.Pro15568Ser) rs561728671
NM_001267550.2(TTN):c.46732G>C (p.Val15578Leu) rs1553712552
NM_001267550.2(TTN):c.46803G>A (p.Trp15601Ter)
NM_001267550.2(TTN):c.46895_46898del (p.Lys15632fs) rs1553712148
NM_001267550.2(TTN):c.46928A>G (p.His15643Arg) rs368502650
NM_001267550.2(TTN):c.46943G>A (p.Gly15648Glu) rs1060500413
NM_001267550.2(TTN):c.46966G>A (p.Asp15656Asn) rs727504572
NM_001267550.2(TTN):c.47089C>T (p.Arg15697Cys) rs780334981
NM_001267550.2(TTN):c.47123C>G (p.Thr15708Arg) rs1553711574
NM_001267550.2(TTN):c.47177T>C (p.Val15726Ala) rs1553711371
NM_001267550.2(TTN):c.47258G>A (p.Arg15753Lys) rs577133803
NM_001267550.2(TTN):c.47289G>T (p.Leu15763Phe) rs1553710788
NM_001267550.2(TTN):c.47296A>T (p.Thr15766Ser) rs878854312
NM_001267550.2(TTN):c.47380G>A (p.Val15794Ile) rs727504878
NM_001267550.2(TTN):c.47394_47411del (p.Asp15799_Arg15804del) rs398124453
NM_001267550.2(TTN):c.47498T>A (p.Val15833Glu) rs758495958
NM_001267550.2(TTN):c.47513G>A (p.Arg15838Gln) rs199640194
NM_001267550.2(TTN):c.47515A>G (p.Ile15839Val) rs1553710021
NM_001267550.2(TTN):c.47516T>C (p.Ile15839Thr) rs764388462
NM_001267550.2(TTN):c.47530C>G (p.Pro15844Ala) rs760956511
NM_001267550.2(TTN):c.47537C>T (p.Ala15846Val) rs1183139911
NM_001267550.2(TTN):c.47626G>A (p.Val15876Ile) rs766025438
NM_001267550.2(TTN):c.47687T>C (p.Ile15896Thr) rs1411457226
NM_001267550.2(TTN):c.47693G>A (p.Arg15898Gln) rs376278449
NM_001267550.2(TTN):c.47698G>A (p.Glu15900Lys) rs772625773
NM_001267550.2(TTN):c.47705G>A (p.Gly15902Glu) rs561284948
NM_001267550.2(TTN):c.47740G>C (p.Val15914Leu) rs764059405
NM_001267550.2(TTN):c.47757C>T (p.Tyr15919=) rs1060500551
NM_001267550.2(TTN):c.47758A>C (p.Lys15920Gln) rs775513269
NM_001267550.2(TTN):c.47767G>A (p.Gly15923Arg) rs371943746
NM_001267550.2(TTN):c.47866G>A (p.Asp15956Asn) rs372881122
NM_001267550.2(TTN):c.47875+4_47875+7del rs753206674
NM_001267550.2(TTN):c.47875+6T>C rs780524253
NM_001267550.2(TTN):c.47875+9A>G rs1553708222
NM_001267550.2(TTN):c.47900C>A (p.Ala15967Glu) rs1553707943
NM_001267550.2(TTN):c.47936C>T (p.Pro15979Leu) rs184815126
NM_001267550.2(TTN):c.47938A>G (p.Ile15980Val) rs780634456
NM_001267550.2(TTN):c.47978C>A (p.Thr15993Asn) rs727503622
NM_001267550.2(TTN):c.48023G>A (p.Arg16008Gln) rs771224957
NM_001267550.2(TTN):c.48052G>A (p.Ala16018Thr) rs1451009964
NM_001267550.2(TTN):c.48079C>T (p.Arg16027Cys) rs765032242
NM_001267550.2(TTN):c.48106A>C (p.Lys16036Gln) rs886055271
NM_001267550.2(TTN):c.48119G>A (p.Arg16040His) rs956699957
NM_001267550.2(TTN):c.48152A>G (p.Asn16051Ser) rs534426018
NM_001267550.2(TTN):c.48160G>A (p.Ala16054Thr)
NM_001267550.2(TTN):c.48164G>A (p.Arg16055His) rs72677238
NM_001267550.2(TTN):c.48296G>A (p.Arg16099Gln) rs376747673
NM_001267550.2(TTN):c.48311A>C (p.Lys16104Thr) rs1060500396
NM_001267550.2(TTN):c.48312+3G>T rs368650224
NM_001267550.2(TTN):c.48331G>A (p.Asp16111Asn) rs769898196
NM_001267550.2(TTN):c.48337G>A (p.Glu16113Lys) rs548275593
NM_001267550.2(TTN):c.48359T>C (p.Val16120Ala) rs745999025
NM_001267550.2(TTN):c.48378_48380del (p.Leu16126del) rs561618839
NM_001267550.2(TTN):c.48394C>T (p.Arg16132Cys) rs2303830
NM_001267550.2(TTN):c.48399C>A (p.Asn16133Lys) rs1060500470
NM_001267550.2(TTN):c.48409C>T (p.Pro16137Ser) rs879009898
NM_001267550.2(TTN):c.48461C>T (p.Thr16154Met) rs771120250
NM_001267550.2(TTN):c.48498T>G (p.Asp16166Glu) rs1429263816
NM_001267550.2(TTN):c.48509A>G (p.Asn16170Ser) rs370809363
NM_001267550.2(TTN):c.48545A>C (p.Asp16182Ala) rs762913484
NM_001267550.2(TTN):c.48556C>T (p.Arg16186Cys) rs377563403
NM_001267550.2(TTN):c.48557G>A (p.Arg16186His) rs769784536
NM_001267550.2(TTN):c.48557G>T (p.Arg16186Leu) rs769784536
NM_001267550.2(TTN):c.48560T>G (p.Ile16187Ser) rs777279411
NM_001267550.2(TTN):c.48589C>T (p.Arg16197Cys) rs748917057
NM_001267550.2(TTN):c.48590G>A (p.Arg16197His) rs369826752
NM_001267550.2(TTN):c.485T>A (p.Leu162Gln) rs145438758
NM_001267550.2(TTN):c.48639-3C>A rs923663993
NM_001267550.2(TTN):c.48668A>C (p.Lys16223Thr) rs1553704101
NM_001267550.2(TTN):c.48683G>A (p.Arg16228His) rs368806005
NM_001267550.2(TTN):c.48727C>A (p.Pro16243Thr) rs72677242
NM_001267550.2(TTN):c.48751G>A (p.Asp16251Asn) rs199954570
NM_001267550.2(TTN):c.48838G>A (p.Ala16280Thr) rs372911542
NM_001267550.2(TTN):c.48842C>T (p.Thr16281Ile) rs1553703631
NM_001267550.2(TTN):c.48850G>A (p.Gly16284Arg) rs368527534
NM_001267550.2(TTN):c.48862C>T (p.Pro16288Ser) rs894986526
NM_001267550.2(TTN):c.48891G>A (p.Met16297Ile) rs754110019
NM_001267550.2(TTN):c.48971G>T (p.Ser16324Ile) rs878948684
NM_001267550.2(TTN):c.48983C>T (p.Thr16328Ile) rs770839243
NM_001267550.2(TTN):c.49000G>A (p.Val16334Met) rs541384076
NM_001267550.2(TTN):c.49015C>T (p.Arg16339Trp) rs201793958
NM_001267550.2(TTN):c.49016G>A (p.Arg16339Gln) rs558487304
NM_001267550.2(TTN):c.49048+4A>G rs766931932
NM_001267550.2(TTN):c.49070C>T (p.Ala16357Val) rs199768159
NM_001267550.2(TTN):c.49129G>A (p.Asp16377Asn) rs757542062
NM_001267550.2(TTN):c.49172G>A (p.Arg16391Gln) rs200944827
NM_001267550.2(TTN):c.49174G>A (p.Ala16392Thr) rs794729446
NM_001267550.2(TTN):c.49175C>A (p.Ala16392Glu) rs750310775
NM_001267550.2(TTN):c.49241A>G (p.Lys16414Arg) rs1329659749
NM_001267550.2(TTN):c.49258G>A (p.Glu16420Lys) rs764682084
NM_001267550.2(TTN):c.49363A>G (p.Thr16455Ala) rs374543277
NM_001267550.2(TTN):c.49388C>A (p.Thr16463Asn) rs541307234
NM_001267550.2(TTN):c.49413G>T (p.Trp16471Cys) rs202094100
NM_001267550.2(TTN):c.49488A>G (p.Lys16496=) rs1553701108
NM_001267550.2(TTN):c.49560A>T (p.Lys16520Asn) rs779658426
NM_001267550.2(TTN):c.49698A>G (p.Thr16566=) rs778112130
NM_001267550.2(TTN):c.49707G>T (p.Arg16569Ser) rs879180534
NM_001267550.2(TTN):c.49801G>T (p.Val16601Leu) rs773271774
NM_001267550.2(TTN):c.4981A>G (p.Ile1661Val) rs749438439
NM_001267550.2(TTN):c.49834C>T (p.Leu16612Phe) rs750840061
NM_001267550.2(TTN):c.49837C>G (p.Pro16613Ala) rs1468557688
NM_001267550.2(TTN):c.49871G>A (p.Arg16624Gln) rs367566671
NM_001267550.2(TTN):c.4990C>T (p.Arg1664Trp) rs147695336
NM_001267550.2(TTN):c.49937G>A (p.Arg16646Gln) rs746384579
NM_001267550.2(TTN):c.49978G>A (p.Val16660Ile) rs757016105
NM_001267550.2(TTN):c.5000A>G (p.Tyr1667Cys) rs140494897
NM_001267550.2(TTN):c.5003G>A (p.Arg1668Lys) rs1554008153
NM_001267550.2(TTN):c.50077G>A (p.Val16693Ile) rs377141765
NM_001267550.2(TTN):c.50084G>A (p.Arg16695Gln) rs794729451
NM_001267550.2(TTN):c.50148T>A (p.Thr16716=) rs374138859
NM_001267550.2(TTN):c.50151G>C (p.Glu16717Asp) rs369623681
NM_001267550.2(TTN):c.50189C>T (p.Ala16730Val) rs763483590
NM_001267550.2(TTN):c.50212G>A (p.Glu16738Lys) rs148018042
NM_001267550.2(TTN):c.50297G>A (p.Arg16766Gln) rs747224934
NM_001267550.2(TTN):c.50348T>C (p.Ile16783Thr) rs950940404
NM_001267550.2(TTN):c.50390G>A (p.Arg16797His) rs200835354
NM_001267550.2(TTN):c.50400A>T (p.Lys16800Asn) rs794729239
NM_001267550.2(TTN):c.50441C>G (p.Thr16814Ser) rs1559783698
NM_001267550.2(TTN):c.50480G>A (p.Arg16827Gln) rs138896856
NM_001267550.2(TTN):c.5048G>A (p.Arg1683Gln) rs368122582
NM_001267550.2(TTN):c.50549_50551+5dup rs1060500453
NM_001267550.2(TTN):c.50554C>T (p.Pro16852Ser) rs752660748
NM_001267550.2(TTN):c.50597G>A (p.Arg16866Lys) rs774137928
NM_001267550.2(TTN):c.50648C>A (p.Pro16883His) rs758756600
NM_001267550.2(TTN):c.50714G>A (p.Arg16905His) rs191539637
NM_001267550.2(TTN):c.50719A>G (p.Ile16907Val) rs750610895
NM_001267550.2(TTN):c.50749G>A (p.Gly16917Ser) rs1553696081
NM_001267550.2(TTN):c.50774T>C (p.Val16925Ala) rs370067597
NM_001267550.2(TTN):c.5080C>T (p.Leu1694Phe) rs769798880
NM_001267550.2(TTN):c.50811C>T (p.Ser16937=)
NM_001267550.2(TTN):c.50850C>A (p.Asp16950Glu) rs200700386
NM_001267550.2(TTN):c.50858-10T>C
NM_001267550.2(TTN):c.50858-3C>T rs587782987
NM_001267550.2(TTN):c.50869A>G (p.Ile16957Val) rs372013419
NM_001267550.2(TTN):c.50905G>C (p.Gly16969Arg) rs878854314
NM_001267550.2(TTN):c.50954C>T (p.Thr16985Ile) rs116765281
NM_001267550.2(TTN):c.51012G>T (p.Lys17004Asn) rs755153359
NM_001267550.2(TTN):c.51055C>T (p.Arg17019Cys) rs773394284
NM_001267550.2(TTN):c.51065C>T (p.Ala17022Val) rs372419267
NM_001267550.2(TTN):c.51079A>T (p.Ile17027Phe) rs770809063
NM_001267550.2(TTN):c.51175A>G (p.Ile17059Val) rs188395969
NM_001267550.2(TTN):c.51247G>T (p.Val17083Phe) rs746817480
NM_001267550.2(TTN):c.5132C>T (p.Ser1711Phe) rs397517641
NM_001267550.2(TTN):c.51337C>T (p.Pro17113Ser) rs768641489
NM_001267550.2(TTN):c.51338C>A (p.Pro17113Gln) rs763635220
NM_001267550.2(TTN):c.51355T>G (p.Phe17119Val) rs370696020
NM_001267550.2(TTN):c.51366A>T (p.Lys17122Asn) rs1553693116
NM_001267550.2(TTN):c.51377A>G (p.Lys17126Arg) rs757728544
NM_001267550.2(TTN):c.51449C>T (p.Pro17150Leu) rs764792715
NM_001267550.2(TTN):c.51454G>A (p.Val17152Ile) rs1553692607
NM_001267550.2(TTN):c.51593A>G (p.Asn17198Ser) rs766535854
NM_001267550.2(TTN):c.51633A>T (p.Gly17211=)
NM_001267550.2(TTN):c.51634C>T (p.Leu17212Phe) rs1473716049
NM_001267550.2(TTN):c.51642G>C (p.Glu17214Asp) rs372443762
NM_001267550.2(TTN):c.51649G>A (p.Glu17217Lys) rs1060500503
NM_001267550.2(TTN):c.51668G>A (p.Arg17223Gln) rs142395261
NM_001267550.2(TTN):c.51683C>T (p.Ala17228Val) rs370644359
NM_001267550.2(TTN):c.51782G>A (p.Arg17261Gln) rs201825412
NM_001267550.2(TTN):c.51809G>T (p.Ser17270Ile) rs200650668
NM_001267550.2(TTN):c.51823C>T (p.Pro17275Ser) rs752852690
NM_001267550.2(TTN):c.51841T>C (p.Trp17281Arg) rs368846015
NM_001267550.2(TTN):c.51896C>T (p.Pro17299Leu) rs369648778
NM_001267550.2(TTN):c.51928_51930GAA[2] (p.Glu17312del) rs780745206
NM_001267550.2(TTN):c.51938C>A (p.Pro17313Gln) rs372927085
NM_001267550.2(TTN):c.51947T>G (p.Leu17316Arg) rs368529230
NM_001267550.2(TTN):c.51986A>T (p.Lys17329Met) rs1060500490
NM_001267550.2(TTN):c.52010G>A (p.Arg17337Gln) rs775700218
NM_001267550.2(TTN):c.52052T>C (p.Val17351Ala) rs565423253
NM_001267550.2(TTN):c.52067G>A (p.Gly17356Asp) rs759091835
NM_001267550.2(TTN):c.52085G>A (p.Cys17362Tyr) rs1553690569
NM_001267550.2(TTN):c.52112G>A (p.Gly17371Glu) rs794729455
NM_001267550.2(TTN):c.52135G>C (p.Glu17379Gln) rs770795675
NM_001267550.2(TTN):c.52139A>T (p.Asp17380Val) rs373305248
NM_001267550.2(TTN):c.52199A>C (p.Glu17400Ala) rs773027240
NM_001267550.2(TTN):c.52243G>A (p.Asp17415Asn) rs397517609
NM_001267550.2(TTN):c.52304T>A (p.Leu17435Gln) rs1060500542
NM_001267550.2(TTN):c.52313G>A (p.Gly17438Glu) rs1356720044
NM_001267550.2(TTN):c.52373T>C (p.Val17458Ala) rs760430370
NM_001267550.2(TTN):c.52385T>A (p.Leu17462His) rs1216814159
NM_001267550.2(TTN):c.52409C>A (p.Pro17470Gln) rs372618781
NM_001267550.2(TTN):c.52524A>T (p.Lys17508Asn) rs1060500466
NM_001267550.2(TTN):c.52530_52535del (p.Glu17510_Asn17512delinsAsp) rs1553688489
NM_001267550.2(TTN):c.52536C>G (p.Asn17512Lys) rs199615557
NM_001267550.2(TTN):c.52589A>G (p.Asn17530Ser) rs762214300
NM_001267550.2(TTN):c.52595A>G (p.Asp17532Gly) rs1401966542
NM_001267550.2(TTN):c.52607_52609del (p.Glu17536del) rs755947249
NM_001267550.2(TTN):c.5260A>G (p.Ile1754Val) rs780379544
NM_001267550.2(TTN):c.52629A>G (p.Arg17543=) rs748001472
NM_001267550.2(TTN):c.5264A>G (p.Asn1755Ser) rs201904897
NM_001267550.2(TTN):c.52702A>G (p.Ile17568Val) rs377571654
NM_001267550.2(TTN):c.52706C>A (p.Ser17569Tyr) rs756689649
NM_001267550.2(TTN):c.52826A>T (p.Gln17609Leu) rs368820294
NM_001267550.2(TTN):c.52853G>A (p.Arg17618His) rs371538664
NM_001267550.2(TTN):c.52859C>G (p.Thr17620Arg) rs1559743128
NM_001267550.2(TTN):c.52880G>A (p.Arg17627His) rs536494011
NM_001267550.2(TTN):c.53002+4C>G rs947716496
NM_001267550.2(TTN):c.53012C>T (p.Ala17671Val) rs549478203
NM_001267550.2(TTN):c.53060G>A (p.Gly17687Glu) rs780672348
NM_001267550.2(TTN):c.53069T>C (p.Leu17690Pro) rs370469461
NM_001267550.2(TTN):c.5309G>A (p.Arg1770Lys) rs1554007509
NM_001267550.2(TTN):c.53122_53123delinsGT (p.Lys17708Val) rs886042743
NM_001267550.2(TTN):c.5314A>G (p.Ser1772Gly) rs150725992
NM_001267550.2(TTN):c.53159T>C (p.Ile17720Thr) rs201358641
NM_001267550.2(TTN):c.53213A>T (p.Asp17738Val) rs773447539
NM_001267550.2(TTN):c.53246G>C (p.Ser17749Thr) rs1553686153
NM_001267550.2(TTN):c.53357C>A (p.Ser17786Tyr) rs1060500485
NM_001267550.2(TTN):c.53402T>C (p.Ile17801Thr) rs370929667
NM_001267550.2(TTN):c.53561T>A (p.Ile17854Asn) rs375796420
NM_001267550.2(TTN):c.53590A>G (p.Thr17864Ala) rs375309278
NM_001267550.2(TTN):c.53609C>T (p.Thr17870Ile) rs1553683359
NM_001267550.2(TTN):c.53641C>G (p.Leu17881Val) rs771801125
NM_001267550.2(TTN):c.53641C>T (p.Leu17881Phe) rs771801125
NM_001267550.2(TTN):c.53659C>T (p.Arg17887Cys) rs771307468
NM_001267550.2(TTN):c.53663G>C (p.Ser17888Thr) rs778009539
NM_001267550.2(TTN):c.53708G>A (p.Arg17903His) rs755252821
NM_001267550.2(TTN):c.53744G>A (p.Arg17915Gln) rs758896047
NM_001267550.2(TTN):c.53769G>A (p.Leu17923=) rs1439566303
NM_001267550.2(TTN):c.53780T>C (p.Leu17927Pro) rs369678018
NM_001267550.2(TTN):c.53785G>A (p.Glu17929Lys) rs201052994
NM_001267550.2(TTN):c.53791C>G (p.Gln17931Glu) rs759208053
NM_001267550.2(TTN):c.53807G>A (p.Arg17936His) rs727503604
NM_001267550.2(TTN):c.53839G>A (p.Glu17947Lys) rs1445321949
NM_001267550.2(TTN):c.53881+4C>T rs187632918
NM_001267550.2(TTN):c.53881+6G>A rs1553682704
NM_001267550.2(TTN):c.53899T>A (p.Leu17967Met) rs761733751
NM_001267550.2(TTN):c.538A>C (p.Asn180His) rs864622712
NM_001267550.2(TTN):c.53903G>A (p.Arg17968His) rs200100660
NM_001267550.2(TTN):c.53903G>C (p.Arg17968Pro) rs200100660
NM_001267550.2(TTN):c.53965G>A (p.Asp17989Asn) rs1060500481
NM_001267550.2(TTN):c.54053A>T (p.Lys18018Met) rs368425364
NM_001267550.2(TTN):c.54068G>A (p.Arg18023Gln) rs727503603
NM_001267550.2(TTN):c.54091A>G (p.Ser18031Gly) rs397517615
NM_001267550.2(TTN):c.54109C>T (p.Arg18037Trp) rs201623791
NM_001267550.2(TTN):c.54115G>A (p.Asp18039Asn) rs765148928
NM_001267550.2(TTN):c.54142T>C (p.Ser18048Pro) rs878999356
NM_001267550.2(TTN):c.54148C>G (p.Arg18050Gly) rs55734111
NM_001267550.2(TTN):c.54160G>C (p.Val18054Leu) rs200968679
NM_001267550.2(TTN):c.54167G>A (p.Arg18056Gln) rs376932266
NM_001267550.2(TTN):c.54178G>A (p.Val18060Ile) rs190574498
NM_001267550.2(TTN):c.54194G>A (p.Arg18065His) rs375895183
NM_001267550.2(TTN):c.54290T>C (p.Ile18097Thr) rs1553681465
NM_001267550.2(TTN):c.54314G>A (p.Arg18105His) rs760383112
NM_001267550.2(TTN):c.54490T>C (p.Tyr18164His) rs370135374
NM_001267550.2(TTN):c.54518C>A (p.Pro18173Gln) rs794729458
NM_001267550.2(TTN):c.54532C>T (p.Arg18178Cys) rs554701601
NM_001267550.2(TTN):c.54578A>G (p.Asn18193Ser) rs777505893
NM_001267550.2(TTN):c.54581G>A (p.Gly18194Asp) rs201802447
NM_001267550.2(TTN):c.54685G>A (p.Val18229Met) rs116142642
NM_001267550.2(TTN):c.5468C>T (p.Ala1823Val) rs1554007106
NM_001267550.2(TTN):c.54697G>A (p.Val18233Ile) rs374996996
NM_001267550.2(TTN):c.54698T>A (p.Val18233Asp) rs1060500469
NM_001267550.2(TTN):c.54700C>A (p.Pro18234Thr) rs1060500416
NM_001267550.2(TTN):c.54710T>C (p.Leu18237Pro) rs201412693
NM_001267550.2(TTN):c.54718G>A (p.Val18240Ile) rs375141729
NM_001267550.2(TTN):c.54727C>G (p.Gln18243Glu) rs372447571
NM_001267550.2(TTN):c.54796G>T (p.Ala18266Ser) rs199837769
NM_001267550.2(TTN):c.54813T>G (p.Phe18271Leu) rs370583314
NM_001267550.2(TTN):c.54819G>A (p.Pro18273=) rs373624715
NM_001267550.2(TTN):c.54935_54937AAG[2] (p.Glu18314del) rs1553675991
NM_001267550.2(TTN):c.54976G>C (p.Asp18326His) rs1553675887
NM_001267550.2(TTN):c.54999A>T (p.Glu18333Asp) rs764950995
NM_001267550.2(TTN):c.55058A>G (p.Asn18353Ser) rs747601378
NM_001267550.2(TTN):c.55139T>C (p.Ile18380Thr) rs72646819
NM_001267550.2(TTN):c.55195C>T (p.Pro18399Ser) rs774591174
NM_001267550.2(TTN):c.55205T>G (p.Ile18402Ser) rs776899398
NM_001267550.2(TTN):c.55228T>C (p.Ser18410Pro) rs778636992
NM_001267550.2(TTN):c.55269G>C (p.Lys18423Asn) rs367799017
NM_001267550.2(TTN):c.55271A>G (p.Asp18424Gly) rs1553674352
NM_001267550.2(TTN):c.55306G>A (p.Glu18436Lys) rs201510986
NM_001267550.2(TTN):c.55354T>C (p.Ser18452Pro) rs372541479
NM_001267550.2(TTN):c.55374C>G (p.Ser18458Arg) rs200550947
NM_001267550.2(TTN):c.55378A>G (p.Thr18460Ala) rs727503600
NM_001267550.2(TTN):c.55396G>A (p.Gly18466Arg) rs772677752
NM_001267550.2(TTN):c.5539C>T (p.Pro1847Ser) rs138778559
NM_001267550.2(TTN):c.55405A>C (p.Thr18469Pro) rs1044328956
NM_001267550.2(TTN):c.55433-4A>G rs1451088765
NM_001267550.2(TTN):c.55485T>G (p.Ser18495Arg) rs1213190093
NM_001267550.2(TTN):c.55516G>A (p.Asp18506Asn) rs757839460
NM_001267550.2(TTN):c.55522G>A (p.Gly18508Arg) rs1060500511
NM_001267550.2(TTN):c.55610C>T (p.Thr18537Ile) rs1027035888
NM_001267550.2(TTN):c.55615G>A (p.Val18539Ile) rs1060500557
NM_001267550.2(TTN):c.55655G>A (p.Arg18552His) rs201774108
NM_001267550.2(TTN):c.55673G>A (p.Arg18558His) rs115867512
NM_001267550.2(TTN):c.55745C>T (p.Pro18582Leu) rs201194435
NM_001267550.2(TTN):c.5577G>T (p.Arg1859Ser) rs551538420
NM_001267550.2(TTN):c.55784C>G (p.Thr18595Arg) rs770499179
NM_001267550.2(TTN):c.55808C>T (p.Pro18603Leu) rs531760043
NM_001267550.2(TTN):c.5581C>T (p.Arg1861Cys) rs532733393
NM_001267550.2(TTN):c.5582G>A (p.Arg1861His) rs140914855
NM_001267550.2(TTN):c.55851G>C (p.Glu18617Asp) rs878854316
NM_001267550.2(TTN):c.55909C>A (p.Arg18637Ser) rs374151130
NM_001267550.2(TTN):c.55910G>A (p.Arg18637His) rs758627195
NM_001267550.2(TTN):c.55988A>G (p.Asn18663Ser) rs368350844
NM_001267550.2(TTN):c.56050T>C (p.Cys18684Arg) rs761599633
NM_001267550.2(TTN):c.56051G>A (p.Cys18684Tyr) rs1025426023
NM_001267550.2(TTN):c.56067T>A (p.Asp18689Glu) rs1553667022
NM_001267550.2(TTN):c.56096G>A (p.Gly18699Glu) rs1060500533
NM_001267550.2(TTN):c.56171A>G (p.Lys18724Arg) rs201091423
NM_001267550.2(TTN):c.56191C>A (p.Pro18731Thr) rs751457168
NM_001267550.2(TTN):c.56191C>T (p.Pro18731Ser) rs751457168
NM_001267550.2(TTN):c.56207C>A (p.Thr18736Asn) rs1455791430
NM_001267550.2(TTN):c.56213T>G (p.Val18738Gly) rs777956655
NM_001267550.2(TTN):c.56255C>T (p.Pro18752Leu) rs200132226
NM_001267550.2(TTN):c.5630A>T (p.Asn1877Ile) rs1554006798
NM_001267550.2(TTN):c.56314A>G (p.Thr18772Ala) rs964263107
NM_001267550.2(TTN):c.56315C>T (p.Thr18772Ile) rs370118111
NM_001267550.2(TTN):c.5633G>A (p.Gly1878Glu) rs745311218
NM_001267550.2(TTN):c.56351G>A (p.Arg18784His) rs771284532
NM_001267550.2(TTN):c.56453C>A (p.Thr18818Lys) rs945270235
NM_001267550.2(TTN):c.56533A>C (p.Thr18845Pro) rs375000725
NM_001267550.2(TTN):c.56534C>T (p.Thr18845Met) rs371571153
NM_001267550.2(TTN):c.56549T>A (p.Leu18850Gln) rs878854317
NM_001267550.2(TTN):c.56557C>T (p.His18853Tyr) rs397517623
NM_001267550.2(TTN):c.56573G>A (p.Arg18858Gln) rs755848019
NM_001267550.2(TTN):c.56581G>A (p.Ala18861Thr) rs368419410
NM_001267550.2(TTN):c.56640C>A (p.Asn18880Lys) rs200544272
NM_001267550.2(TTN):c.56653C>T (p.Pro18885Ser) rs747971851
NM_001267550.2(TTN):c.56674A>C (p.Thr18892Pro) rs780258242
NM_001267550.2(TTN):c.56693G>A (p.Arg18898His) rs572453785
NM_001267550.2(TTN):c.5672A>G (p.Tyr1891Cys) rs547305291
NM_001267550.2(TTN):c.56822C>T (p.Ala18941Val) rs754264431
NM_001267550.2(TTN):c.5683C>T (p.His1895Tyr) rs794729577
NM_001267550.2(TTN):c.56872G>A (p.Asp18958Asn) rs576158850
NM_001267550.2(TTN):c.56884C>T (p.Arg18962Trp) rs556286196
NM_001267550.2(TTN):c.56911G>A (p.Val18971Met) rs373153121
NM_001267550.2(TTN):c.56947G>A (p.Ala18983Thr) rs377000174
NM_001267550.2(TTN):c.56960T>C (p.Ile18987Thr) rs373351577
NM_001267550.2(TTN):c.56963-3C>T rs375979145
NM_001267550.2(TTN):c.57070A>G (p.Ile19024Val) rs876658068
NM_001267550.2(TTN):c.570A>T (p.Glu190Asp) rs753196873
NM_001267550.2(TTN):c.5713T>C (p.Tyr1905His) rs1477069650
NM_001267550.2(TTN):c.57212T>C (p.Ile19071Thr) rs200001206
NM_001267550.2(TTN):c.5722G>A (p.Gly1908Ser) rs964474432
NM_001267550.2(TTN):c.57242T>C (p.Ile19081Thr) rs78509062
NM_001267550.2(TTN):c.57262G>A (p.Val19088Ile)
NM_001267550.2(TTN):c.57263-6T>G rs562237741
NM_001267550.2(TTN):c.57305T>C (p.Ile19102Thr) rs878854319
NM_001267550.2(TTN):c.57323G>A (p.Gly19108Glu) rs774910035
NM_001267550.2(TTN):c.57325G>A (p.Val19109Met) rs945083650
NM_001267550.2(TTN):c.57367A>G (p.Thr19123Ala) rs587782985
NM_001267550.2(TTN):c.57370G>A (p.Val19124Ile) rs142841000
NM_001267550.2(TTN):c.57382A>G (p.Met19128Val) rs138367112
NM_001267550.2(TTN):c.57387T>A (p.Asn19129Lys) rs375305621
NM_001267550.2(TTN):c.57442A>G (p.Met19148Val) rs188185141
NM_001267550.2(TTN):c.57477C>T (p.Gly19159=) rs777480811
NM_001267550.2(TTN):c.57478G>C (p.Val19160Leu) rs200778464
NM_001267550.2(TTN):c.57491T>C (p.Leu19164Pro) rs1553659364
NM_001267550.2(TTN):c.57508G>A (p.Gly19170Arg) rs750947988
NM_001267550.2(TTN):c.57544+7dup rs750881309
NM_001267550.2(TTN):c.57559G>A (p.Val19187Ile) rs764203267
NM_001267550.2(TTN):c.57586C>G (p.Leu19196Val) rs397517630
NM_001267550.2(TTN):c.57593A>G (p.Asn19198Ser) rs199787097
NM_001267550.2(TTN):c.57617T>A (p.Phe19206Tyr) rs1060500418
NM_001267550.2(TTN):c.5761A>G (p.Ile1921Val) rs879100565
NM_001267550.2(TTN):c.57635G>A (p.Gly19212Glu) rs761511119
NM_001267550.2(TTN):c.57656A>T (p.Tyr19219Phe) rs201541213
NM_001267550.2(TTN):c.5770A>T (p.Lys1924Ter)
NM_001267550.2(TTN):c.57742C>A (p.Leu19248Ile) rs1553655240
NM_001267550.2(TTN):c.57777G>A (p.Ala19259=) rs376930907
NM_001267550.2(TTN):c.5779C>T (p.Leu1927Phe) rs1370515925
NM_001267550.2(TTN):c.57808G>C (p.Val19270Leu) rs369440319
NM_001267550.2(TTN):c.57833T>C (p.Ile19278Thr) rs1060500546
NM_001267550.2(TTN):c.57847+5_57847+8del rs587782988
NM_001267550.2(TTN):c.5785A>T (p.Ile1929Phe) rs748917796
NM_001267550.2(TTN):c.57860G>A (p.Arg19287His) rs371422299
NM_001267550.2(TTN):c.58009G>A (p.Asp19337Asn) rs1239348052
NM_001267550.2(TTN):c.58037T>C (p.Val19346Ala) rs754793079
NM_001267550.2(TTN):c.58049_58051AAG[1] (p.Glu19351del) rs397517634
NM_001267550.2(TTN):c.58072C>T (p.Arg19358Cys) rs371973579
NM_001267550.2(TTN):c.58084G>T (p.Val19362Phe) rs878854321
NM_001267550.2(TTN):c.58137C>T (p.Cys19379=) rs376310289
NM_001267550.2(TTN):c.58141G>A (p.Asp19381Asn) rs1325584288
NM_001267550.2(TTN):c.58190C>T (p.Thr19397Met) rs373527448
NM_001267550.2(TTN):c.58295G>A (p.Arg19432His) rs745631866
NM_001267550.2(TTN):c.58303A>G (p.Ile19435Val) rs749402480
NM_001267550.2(TTN):c.58342A>G (p.Lys19448Glu) rs900082928
NM_001267550.2(TTN):c.58363G>A (p.Gly19455Ser) rs191927501
NM_001267550.2(TTN):c.58374T>G (p.Cys19458Trp) rs777855018
NM_001267550.2(TTN):c.58381G>A (p.Val19461Met) rs368431326
NM_001267550.2(TTN):c.58399T>A (p.Ser19467Thr) rs920055688
NM_001267550.2(TTN):c.58445C>T (p.Pro19482Leu) rs746380279
NM_001267550.2(TTN):c.58447C>G (p.Pro19483Ala) rs367624056
NM_001267550.2(TTN):c.58470T>A (p.Asp19490Glu) rs374118468
NM_001267550.2(TTN):c.5855A>G (p.His1952Arg) rs572691153
NM_001267550.2(TTN):c.58561G>A (p.Glu19521Lys) rs746319976
NM_001267550.2(TTN):c.58576G>A (p.Val19526Ile) rs377682563
NM_001267550.2(TTN):c.58609A>T (p.Thr19537Ser) rs750320421
NM_001267550.2(TTN):c.58616G>T (p.Cys19539Phe) rs539868284
NM_001267550.2(TTN):c.58658G>A (p.Arg19553Gln)
NM_001267550.2(TTN):c.5867A>G (p.Lys1956Arg) rs1554006239
NM_001267550.2(TTN):c.5867del (p.Lys1956fs) rs1554006249
NM_001267550.2(TTN):c.58684A>G (p.Ile19562Val) rs397517637
NM_001267550.2(TTN):c.58720A>G (p.Lys19574Glu) rs1032128606
NM_001267550.2(TTN):c.58727G>A (p.Arg19576His) rs771668359
NM_001267550.2(TTN):c.58796C>T (p.Thr19599Ile) rs367816473
NM_001267550.2(TTN):c.587_589AAG[2] (p.Glu198del) rs771898264
NM_001267550.2(TTN):c.58857A>C (p.Glu19619Asp) rs368026488
NM_001267550.2(TTN):c.58876G>A (p.Ala19626Thr) rs371278320
NM_001267550.2(TTN):c.58882G>A (p.Val19628Ile) rs772550095
NM_001267550.2(TTN):c.58958G>A (p.Arg19653Gln) rs1398360418
NM_001267550.2(TTN):c.58971A>C (p.Glu19657Asp) rs200728232
NM_001267550.2(TTN):c.58982G>A (p.Gly19661Asp) rs397517640
NM_001267550.2(TTN):c.59026G>T (p.Asp19676Tyr) rs186215280
NM_001267550.2(TTN):c.59035+6_59035+8del rs1553648631
NM_001267550.2(TTN):c.59036C>T (p.Ala19679Val) rs1238012891
NM_001267550.2(TTN):c.59074A>G (p.Thr19692Ala) rs771977738
NM_001267550.2(TTN):c.59081G>A (p.Cys19694Tyr) rs727505276
NM_001267550.2(TTN):c.59113C>T (p.Arg19705Cys) rs72646839
NM_001267550.2(TTN):c.5912C>G (p.Thr1971Ser) rs778898929
NM_001267550.2(TTN):c.59147T>C (p.Ile19716Thr) rs763636451
NM_001267550.2(TTN):c.59173G>A (p.Glu19725Lys) rs767601396
NM_001267550.2(TTN):c.59243G>A (p.Arg19748Gln) rs142791877
NM_001267550.2(TTN):c.59248G>A (p.Gly19750Ser) rs200732032
NM_001267550.2(TTN):c.59294A>T (p.Glu19765Val) rs766141647
NM_001267550.2(TTN):c.59340G>C (p.Arg19780Ser) rs1327554085
NM_001267550.2(TTN):c.59359A>C (p.Ile19787Leu) rs771610118
NM_001267550.2(TTN):c.59381G>C (p.Arg19794Thr) rs1553647309
NM_001267550.2(TTN):c.59402G>A (p.Gly19801Asp) rs202206216
NM_001267550.2(TTN):c.59451A>C (p.Lys19817Asn) rs1553647180
NM_001267550.2(TTN):c.59474G>C (p.Arg19825Thr) rs376465623
NM_001267550.2(TTN):c.59489A>G (p.Lys19830Arg) rs764259290
NM_001267550.2(TTN):c.5953A>G (p.Ile1985Val) rs886055303
NM_001267550.2(TTN):c.59626G>A (p.Asp19876Asn)
NM_001267550.2(TTN):c.59647G>T (p.Asp19883Tyr) rs1060500395
NM_001267550.2(TTN):c.59657T>G (p.Val19886Gly) rs755949982
NM_001267550.2(TTN):c.59707G>C (p.Asp19903His) rs374163882
NM_001267550.2(TTN):c.59711A>G (p.Asp19904Gly) rs1016296280
NM_001267550.2(TTN):c.59725A>G (p.Ile19909Val) rs1060500484
NM_001267550.2(TTN):c.59729C>T (p.Thr19910Ile) rs369476725
NM_001267550.2(TTN):c.59813C>T (p.Ala19938Val) rs1187337182
NM_001267550.2(TTN):c.5981C>A (p.Ser1994Ter)
NM_001267550.2(TTN):c.59827G>A (p.Glu19943Lys) rs751863629
NM_001267550.2(TTN):c.59849G>A (p.Arg19950Gln) rs374914334
NM_001267550.2(TTN):c.59858C>T (p.Ala19953Val) rs754149259
NM_001267550.2(TTN):c.59888T>C (p.Val19963Ala) rs1553645836
NM_001267550.2(TTN):c.59916G>C (p.Leu19972Phe) rs1553645773
NM_001267550.2(TTN):c.59917G>A (p.Asp19973Asn) rs148353350
NM_001267550.2(TTN):c.59926C>T (p.His19976Tyr) rs727503588
NM_001267550.2(TTN):c.59927-16CTT[2] rs1338225091
NM_001267550.2(TTN):c.59965G>C (p.Val19989Leu) rs1021499065
NM_001267550.2(TTN):c.60002C>T (p.Pro20001Leu) rs727505345
NM_001267550.2(TTN):c.60008G>A (p.Arg20003His) rs756091180
NM_001267550.2(TTN):c.60062C>T (p.Thr20021Ile) rs760706351
NM_001267550.2(TTN):c.60097T>G (p.Leu20033Val) rs878993043
NM_001267550.2(TTN):c.60104G>T (p.Cys20035Phe) rs774488793
NM_001267550.2(TTN):c.60121_60123CAA[1] (p.Gln20042del) rs761360903
NM_001267550.2(TTN):c.60140G>A (p.Arg20047Lys) rs371060708
NM_001267550.2(TTN):c.60146G>A (p.Arg20049His) rs200455644
NM_001267550.2(TTN):c.60197C>T (p.Pro20066Leu) rs750217838
NM_001267550.2(TTN):c.60298G>A (p.Ala20100Thr) rs748929812
NM_001267550.2(TTN):c.60305T>G (p.Ile20102Arg) rs998020901
NM_001267550.2(TTN):c.60399A>G (p.Ser20133=) rs1553644118
NM_001267550.2(TTN):c.6039T>G (p.Ile2013Met) rs727504208
NM_001267550.2(TTN):c.60407T>A (p.Leu20136His) rs1060500492
NM_001267550.2(TTN):c.6043G>A (p.Ala2015Thr) rs776534823
NM_001267550.2(TTN):c.60472G>A (p.Gly20158Ser) rs375009570
NM_001267550.2(TTN):c.60490G>A (p.Val20164Ile) rs72646843
NM_001267550.2(TTN):c.60524C>T (p.Pro20175Leu) rs771358314
NM_001267550.2(TTN):c.60653C>T (p.Thr20218Met) rs375155937
NM_001267550.2(TTN):c.60707T>G (p.Leu20236Arg) rs778953994
NM_001267550.2(TTN):c.60734G>A (p.Arg20245Gln) rs575837567
NM_001267550.2(TTN):c.60755T>C (p.Ile20252Thr) rs752999797
NM_001267550.2(TTN):c.60869T>C (p.Val20290Ala) rs550655820
NM_001267550.2(TTN):c.60871T>G (p.Ser20291Ala) rs1553643238
NM_001267550.2(TTN):c.60920A>T (p.Tyr20307Phe) rs1553643111
NM_001267550.2(TTN):c.60932G>A (p.Arg20311Gln) rs373062007
NM_001267550.2(TTN):c.60934G>A (p.Glu20312Lys) rs759127797
NM_001267550.2(TTN):c.60944G>A (p.Gly20315Asp) rs765839032
NM_001267550.2(TTN):c.60968C>T (p.Thr20323Ile) rs1060500415
NM_001267550.2(TTN):c.61073C>T (p.Pro20358Leu) rs751194376
NM_001267550.2(TTN):c.61075A>G (p.Ser20359Gly) rs762408700
NM_001267550.2(TTN):c.61099C>T (p.Arg20367Trp) rs727504479
NM_001267550.2(TTN):c.61276C>T (p.Leu20426Phe) rs377529060
NM_001267550.2(TTN):c.61289G>A (p.Cys20430Tyr) rs527704660
NM_001267550.2(TTN):c.61337G>A (p.Arg20446His) rs368278158
NM_001267550.2(TTN):c.61366G>A (p.Gly20456Ser) rs756873840
NM_001267550.2(TTN):c.61409T>C (p.Ile20470Thr) rs202012910
NM_001267550.2(TTN):c.61484G>A (p.Arg20495His) rs775137607
NM_001267550.2(TTN):c.61592G>A (p.Arg20531His) rs370887455
NM_001267550.2(TTN):c.61645A>G (p.Ile20549Val) rs750680415
NM_001267550.2(TTN):c.61670A>G (p.His20557Arg) rs1472565206
NM_001267550.2(TTN):c.61696G>A (p.Val20566Ile) rs764777213
NM_001267550.2(TTN):c.61706G>A (p.Arg20569Lys) rs371014957
NM_001267550.2(TTN):c.61709C>G (p.Pro20570Arg) rs1559576730
NM_001267550.2(TTN):c.617C>A (p.Thr206Lys) rs768427369
NM_001267550.2(TTN):c.61814T>C (p.Ile20605Thr) rs140252432
NM_001267550.2(TTN):c.61815A>G (p.Ile20605Met) rs761374262
NM_001267550.2(TTN):c.61915T>C (p.Tyr20639His) rs727503587
NM_001267550.2(TTN):c.61916A>G (p.Tyr20639Cys) rs756303390
NM_001267550.2(TTN):c.6192T>G (p.Phe2064Leu) rs759437501
NM_001267550.2(TTN):c.61992C>G (p.Asn20664Lys) rs376455983
NM_001267550.2(TTN):c.62005C>T (p.Pro20669Ser) rs1553641246
NM_001267550.2(TTN):c.62008G>C (p.Gly20670Arg) rs774150150
NM_001267550.2(TTN):c.62057A>G (p.Tyr20686Cys) rs755470129
NM_001267550.2(TTN):c.62137G>T (p.Asp20713Tyr) rs1177521349
NM_001267550.2(TTN):c.62214T>G (p.Ile20738Met) rs1388003753
NM_001267550.2(TTN):c.62222T>G (p.Phe20741Cys) rs1553640801
NM_001267550.2(TTN):c.62262G>C (p.Trp20754Cys) rs1060500414
NM_001267550.2(TTN):c.62289_62291AGA[1] (p.Glu20764del) rs751783806
NM_001267550.2(TTN):c.62290G>C (p.Glu20764Gln) rs397517651
NM_001267550.2(TTN):c.62299C>G (p.Gln20767Glu) rs1553640642
NM_001267550.2(TTN):c.62317C>A (p.Leu20773Met) rs375173874
NM_001267550.2(TTN):c.62411C>A (p.Thr20804Asn) rs1218971734
NM_001267550.2(TTN):c.62425G>A (p.Ala20809Thr) rs532844402
NM_001267550.2(TTN):c.62467C>T (p.Arg20823Cys) rs779686013
NM_001267550.2(TTN):c.62468G>A (p.Arg20823His) rs758019778
NM_001267550.2(TTN):c.62479T>C (p.Ser20827Pro) rs1001628726
NM_001267550.2(TTN):c.62486T>G (p.Phe20829Cys) rs878916429
NM_001267550.2(TTN):c.62507G>A (p.Arg20836Gln) rs201693851
NM_001267550.2(TTN):c.62537C>T (p.Ala20846Val) rs1060500518
NM_001267550.2(TTN):c.62546C>T (p.Thr20849Met) rs372685222
NM_001267550.2(TTN):c.62567A>G (p.Tyr20856Cys) rs373867080
NM_001267550.2(TTN):c.62572A>G (p.Thr20858Ala) rs200689750
NM_001267550.2(TTN):c.62602G>A (p.Val20868Met) rs371004819
NM_001267550.2(TTN):c.62618T>C (p.Ile20873Thr) rs1060500438
NM_001267550.2(TTN):c.62644A>G (p.Thr20882Ala) rs538308579
NM_001267550.2(TTN):c.62678_62679delinsTT (p.Gly20893Val) rs1060500476
NM_001267550.2(TTN):c.62681G>A (p.Cys20894Tyr) rs370080086
NM_001267550.2(TTN):c.62696A>G (p.Tyr20899Cys) rs564111693
NM_001267550.2(TTN):c.62699T>C (p.Ile20900Thr) rs770522021
NM_001267550.2(TTN):c.62732G>C (p.Trp20911Ser) rs1243863753
NM_001267550.2(TTN):c.62779C>T (p.Arg20927Cys) rs547604540
NM_001267550.2(TTN):c.62816G>A (p.Arg20939His) rs777095470
NM_001267550.2(TTN):c.62848A>G (p.Thr20950Ala) rs748774963
NM_001267550.2(TTN):c.62896C>T (p.Arg20966Cys) rs767887086
NM_001267550.2(TTN):c.62897G>A (p.Arg20966His) rs1174185176
NM_001267550.2(TTN):c.62931_62933AGA[1] (p.Glu20979del) rs727505236
NM_001267550.2(TTN):c.62939T>C (p.Met20980Thr) rs757789191
NM_001267550.2(TTN):c.63032T>A (p.Val21011Asp) rs1553639384
NM_001267550.2(TTN):c.63047G>C (p.Ser21016Thr) rs1169239147
NM_001267550.2(TTN):c.6304G>T (p.Val2102Leu) rs767322897
NM_001267550.2(TTN):c.63064C>T (p.Arg21022Cys) rs779112015
NM_001267550.2(TTN):c.63069G>C (p.Met21023Ile) rs1060500596
NM_001267550.2(TTN):c.63109C>T (p.Arg21037Cys) rs191549948
NM_001267550.2(TTN):c.63110G>A (p.Arg21037His) rs775651612
NM_001267550.2(TTN):c.63227C>T (p.Thr21076Ile) rs972090108
NM_001267550.2(TTN):c.63250G>A (p.Gly21084Arg) rs1559557623
NM_001267550.2(TTN):c.63298G>A (p.Val21100Ile) rs774240012
NM_001267550.2(TTN):c.63329C>T (p.Ala21110Val) rs370687831
NM_001267550.2(TTN):c.63332C>T (p.Ser21111Phe) rs547033801
NM_001267550.2(TTN):c.63343G>A (p.Gly21115Ser) rs1559556478
NM_001267550.2(TTN):c.63375T>G (p.Leu21125=) rs1451470128
NM_001267550.2(TTN):c.63380G>A (p.Arg21127His) rs201226615
NM_001267550.2(TTN):c.63446A>C (p.Asn21149Thr) rs1060500527
NM_001267550.2(TTN):c.63458T>C (p.Ile21153Thr) rs772411127
NM_001267550.2(TTN):c.63463C>T (p.Arg21155Cys) rs374727686
NM_001267550.2(TTN):c.63521T>C (p.Ile21174Thr) rs1319446307
NM_001267550.2(TTN):c.63559A>G (p.Arg21187Gly) rs368288863
NM_001267550.2(TTN):c.63577C>T (p.Arg21193Cys) rs376800688
NM_001267550.2(TTN):c.63578G>A (p.Arg21193His) rs372267046
NM_001267550.2(TTN):c.6358C>T (p.Arg2120Trp) rs116158152
NM_001267550.2(TTN):c.63665T>C (p.Val21222Ala) rs183595734
NM_001267550.2(TTN):c.63674T>C (p.Val21225Ala) rs1396646735
NM_001267550.2(TTN):c.6378G>A (p.Trp2126Ter)
NM_001267550.2(TTN):c.63793+4G>C rs777513250
NM_001267550.2(TTN):c.63793G>A (p.Asp21265Asn) rs794729474
NM_001267550.2(TTN):c.63877G>A (p.Asp21293Asn) rs199505416
NM_001267550.2(TTN):c.63896C>T (p.Thr21299Ile) rs1031526299
NM_001267550.2(TTN):c.63907G>A (p.Val21303Met) rs372812312
NM_001267550.2(TTN):c.63941C>T (p.Ser21314Leu) rs776468606
NM_001267550.2(TTN):c.64001A>G (p.Asn21334Ser) rs753121509
NM_001267550.2(TTN):c.64088C>G (p.Pro21363Arg) rs781561933
NM_001267550.2(TTN):c.64111A>G (p.Arg21371Gly)
NM_001267550.2(TTN):c.64123G>C (p.Val21375Leu) rs371670651
NM_001267550.2(TTN):c.64175G>A (p.Arg21392His) rs777176324
NM_001267550.2(TTN):c.6420T>A (p.Asp2140Glu) rs777009984
NM_001267550.2(TTN):c.64411C>T (p.Leu21471Phe) rs774609456
NM_001267550.2(TTN):c.64475G>A (p.Gly21492Glu) rs879135883
NM_001267550.2(TTN):c.64541C>T (p.Ala21514Val) rs1060500520
NM_001267550.2(TTN):c.64615C>T (p.Leu21539Phe) rs1060500431
NM_001267550.2(TTN):c.64681G>A (p.Gly21561Ser) rs200355808
NM_001267550.2(TTN):c.64732T>G (p.Ser21578Ala) rs1553633161
NM_001267550.2(TTN):c.64753C>A (p.Leu21585Met) rs772957708
NM_001267550.2(TTN):c.64781A>C (p.Asn21594Thr) rs1060500570
NM_001267550.2(TTN):c.6478A>G (p.Thr2160Ala) rs397517693
NM_001267550.2(TTN):c.64811G>A (p.Arg21604Gln) rs188996850
NM_001267550.2(TTN):c.64816G>C (p.Asp21606His) rs751046367
NM_001267550.2(TTN):c.64860G>C (p.Arg21620Ser) rs373713828
NM_001267550.2(TTN):c.64887G>C (p.Glu21629Asp) rs779232091
NM_001267550.2(TTN):c.64897C>T (p.Arg21633Trp) rs749576292
NM_001267550.2(TTN):c.64916G>A (p.Arg21639Gln) rs373282633
NM_001267550.2(TTN):c.64933C>T (p.Pro21645Ser) rs1553632774
NM_001267550.2(TTN):c.64937T>C (p.Leu21646Pro) rs1060500539
NM_001267550.2(TTN):c.65024G>A (p.Cys21675Tyr) rs1060500571
NM_001267550.2(TTN):c.65048C>A (p.Pro21683Gln) rs1328998714
NM_001267550.2(TTN):c.65072T>C (p.Ile21691Thr) rs1060500388
NM_001267550.2(TTN):c.65093G>A (p.Arg21698His) rs371581072
NM_001267550.2(TTN):c.65093G>T (p.Arg21698Leu) rs371581072
NM_001267550.2(TTN):c.65144G>T (p.Arg21715Leu) rs368450785
NM_001267550.2(TTN):c.65159C>T (p.Pro21720Leu) rs878854325
NM_001267550.2(TTN):c.65179G>A (p.Gly21727Ser) rs756099303
NM_001267550.2(TTN):c.65206G>T (p.Ala21736Ser) rs1320436212
NM_001267550.2(TTN):c.6520A>G (p.Ile2174Val) rs1171508892
NM_001267550.2(TTN):c.65369T>C (p.Ile21790Thr) rs727503580
NM_001267550.2(TTN):c.65410T>C (p.Trp21804Arg) rs745626132
NM_001267550.2(TTN):c.65486A>G (p.Gln21829Arg) rs886038921
NM_001267550.2(TTN):c.65515G>A (p.Ala21839Thr) rs56378177
NM_001267550.2(TTN):c.65534C>T (p.Pro21845Leu) rs201662134
NM_001267550.2(TTN):c.65546C>T (p.Ser21849Phe) rs1060500465
NM_001267550.2(TTN):c.6555_6556insTGTAAGGAAACAGACA (p.Lys2186fs) rs587780494
NM_001267550.2(TTN):c.65566G>A (p.Ala21856Thr) rs752176305
NM_001267550.2(TTN):c.65574T>C (p.Asn21858=) rs374858668
NM_001267550.2(TTN):c.65590G>C (p.Asp21864His) rs375149365
NM_001267550.2(TTN):c.65715A>C (p.Lys21905Asn) rs574615636
NM_001267550.2(TTN):c.65727C>T (p.Gly21909=) rs1246746665
NM_001267550.2(TTN):c.65731A>G (p.Lys21911Glu) rs372565084
NM_001267550.2(TTN):c.65746C>T (p.Arg21916Trp) rs200155485
NM_001267550.2(TTN):c.65782C>T (p.Arg21928Trp) rs371856109
NM_001267550.2(TTN):c.65794G>A (p.Gly21932Arg) rs373636513
NM_001267550.2(TTN):c.6584A>G (p.Glu2195Gly) rs202032875
NM_001267550.2(TTN):c.65863G>A (p.Asp21955Asn) rs1428859947
NM_001267550.2(TTN):c.6587G>A (p.Cys2196Tyr) rs878854326
NM_001267550.2(TTN):c.65915G>A (p.Arg21972His) rs200217934
NM_001267550.2(TTN):c.65986C>T (p.Arg21996Cys) rs577114038
NM_001267550.2(TTN):c.66067G>A (p.Gly22023Ser) rs1060500452
NM_001267550.2(TTN):c.66085C>T (p.Arg22029Cys) rs769739080
NM_001267550.2(TTN):c.66086G>A (p.Arg22029His) rs72646868
NM_001267550.2(TTN):c.66099A>C (p.Glu22033Asp) rs768277403
NM_001267550.2(TTN):c.66105A>T (p.Lys22035Asn) rs373681189
NM_001267550.2(TTN):c.6612A>T (p.Lys2204Asn) rs1060500448
NM_001267550.2(TTN):c.66172C>T (p.Arg22058Cys) rs199643269
NM_001267550.2(TTN):c.66187G>C (p.Val22063Leu) rs768057735
NM_001267550.2(TTN):c.66200T>C (p.Ile22067Thr) rs368042545
NM_001267550.2(TTN):c.66256C>T (p.Pro22086Ser) rs1060500491
NM_001267550.2(TTN):c.66283C>T (p.Arg22095Trp) rs571093313
NM_001267550.2(TTN):c.662T>C (p.Ile221Thr) rs781543487
NM_001267550.2(TTN):c.66430G>A (p.Ala22144Thr) rs183276016
NM_001267550.2(TTN):c.66430G>T (p.Ala22144Ser) rs183276016
NM_001267550.2(TTN):c.66452G>A (p.Arg22151Gln) rs781750042
NM_001267550.2(TTN):c.66491A>T (p.Lys22164Ile) rs371081043
NM_001267550.2(TTN):c.66527C>T (p.Ser22176Phe) rs779303152
NM_001267550.2(TTN):c.66544T>G (p.Tyr22182Asp) rs878854327
NM_001267550.2(TTN):c.66545A>G (p.Tyr22182Cys) rs879016147
NM_001267550.2(TTN):c.66568G>C (p.Gly22190Arg) rs757537780
NM_001267550.2(TTN):c.66578T>C (p.Val22193Ala) rs775454536
NM_001267550.2(TTN):c.66601G>A (p.Asp22201Asn) rs368924655
NM_001267550.2(TTN):c.66628C>A (p.Gln22210Lys) rs757047748
NM_001267550.2(TTN):c.66650T>G (p.Phe22217Cys) rs764330098
NM_001267550.2(TTN):c.66668T>C (p.Met22223Thr) rs752794705
NM_001267550.2(TTN):c.66673G>A (p.Asp22225Asn) rs72646870
NM_001267550.2(TTN):c.6668A>T (p.His2223Leu) rs372979075
NM_001267550.2(TTN):c.66691C>T (p.Arg22231Cys) rs760026147
NM_001267550.2(TTN):c.66703G>A (p.Val22235Ile) rs751354601
NM_001267550.2(TTN):c.66723T>G (p.Ser22241Arg) rs778956602
NM_001267550.2(TTN):c.66736G>A (p.Val22246Met) rs1393150545
NM_001267550.2(TTN):c.6675C>G (p.Asp2225Glu) rs1002616301
NM_001267550.2(TTN):c.66778G>C (p.Glu22260Gln) rs553988103
NM_001267550.2(TTN):c.66780G>C (p.Glu22260Asp) rs574543857
NM_001267550.2(TTN):c.66786A>T (p.Glu22262Asp) rs1022562370
NM_001267550.2(TTN):c.66820C>T (p.Arg22274Cys) rs770627108
NM_001267550.2(TTN):c.66844T>C (p.Tyr22282His) rs745992545
NM_001267550.2(TTN):c.66863G>A (p.Arg22288His) rs537871205
NM_001267550.2(TTN):c.6688T>C (p.Phe2230Leu) rs1060500424
NM_001267550.2(TTN):c.66926A>T (p.Asp22309Val) rs1481781346
NM_001267550.2(TTN):c.66940G>T (p.Asp22314Tyr) rs768380109
NM_001267550.2(TTN):c.66958C>T (p.Arg22320Cys) rs772361876
NM_001267550.2(TTN):c.67001T>C (p.Leu22334Ser) rs758106978
NM_001267550.2(TTN):c.67048A>C (p.Lys22350Gln) rs1370592733
NM_001267550.2(TTN):c.67118T>A (p.Val22373Asp) rs774568339
NM_001267550.2(TTN):c.6713C>G (p.Thr2238Arg) rs201284459
NM_001267550.2(TTN):c.6713C>T (p.Thr2238Met) rs201284459
NM_001267550.2(TTN):c.67147G>A (p.Gly22383Arg) rs372388682
NM_001267550.2(TTN):c.67153C>T (p.Pro22385Ser) rs781562260
NM_001267550.2(TTN):c.67195A>G (p.Lys22399Glu) rs1060500421
NM_001267550.2(TTN):c.67208C>T (p.Thr22403Ile) rs767363142
NM_001267550.2(TTN):c.67210G>A (p.Val22404Met) rs369257896
NM_001267550.2(TTN):c.67229A>C (p.Lys22410Thr) rs1559493839
NM_001267550.2(TTN):c.67300T>A (p.Tyr22434Asn) rs1553623044
NM_001267550.2(TTN):c.67322A>G (p.Glu22441Gly) rs201223583
NM_001267550.2(TTN):c.67445G>A (p.Arg22482Gln) rs200146608
NM_001267550.2(TTN):c.67541_67542delinsTG (p.Thr22514Met) rs1553622336
NM_001267550.2(TTN):c.67604G>A (p.Ser22535Asn) rs375676529
NM_001267550.2(TTN):c.67616T>C (p.Val22539Ala) rs1553622176
NM_001267550.2(TTN):c.67685C>A (p.Ala22562Asp) rs776797528
NM_001267550.2(TTN):c.67706G>A (p.Arg22569Gln) rs185620750
NM_001267550.2(TTN):c.6773C>T (p.Ala2258Val) rs72647881
NM_001267550.2(TTN):c.67792A>C (p.Ser22598Arg) rs775579156
NM_001267550.2(TTN):c.67804T>C (p.Ser22602Pro) rs780276317
NM_001267550.2(TTN):c.67808C>T (p.Ala22603Val) rs199583938
NM_001267550.2(TTN):c.67817C>T (p.Thr22606Ile) rs1254285646
NM_001267550.2(TTN):c.67882G>A (p.Val22628Ile) rs775731759
NM_001267550.2(TTN):c.67919T>C (p.Val22640Ala) rs1060500506
NM_001267550.2(TTN):c.67989A>T (p.Leu22663Phe) rs1485610846
NM_001267550.2(TTN):c.68007G>A (p.Lys22669=) rs755897447
NM_001267550.2(TTN):c.68066A>G (p.Asn22689Ser) rs375397094
NM_001267550.2(TTN):c.68078C>T (p.Thr22693Met) rs758700425
NM_001267550.2(TTN):c.68097G>C (p.Gln22699His) rs727504520
NM_001267550.2(TTN):c.68161G>A (p.Glu22721Lys) rs374492812
NM_001267550.2(TTN):c.68165A>G (p.Asn22722Ser) rs200493270
NM_001267550.2(TTN):c.6816A>T (p.Glu2272Asp) rs1554002953
NM_001267550.2(TTN):c.68176G>A (p.Val22726Ile) rs1553620392
NM_001267550.2(TTN):c.68195C>T (p.Ser22732Leu) rs727505352
NM_001267550.2(TTN):c.6820C>G (p.Gln2274Glu) rs145649088
NM_001267550.2(TTN):c.68218C>T (p.Pro22740Ser) rs886039082
NM_001267550.2(TTN):c.68224+3A>G rs1006017098
NM_001267550.2(TTN):c.68248C>T (p.Pro22750Ser) rs764562311
NM_001267550.2(TTN):c.68252A>G (p.Asn22751Ser) rs761226149
NM_001267550.2(TTN):c.68298C>A (p.Asp22766Glu) rs534340303
NM_001267550.2(TTN):c.68303A>G (p.Lys22768Arg) rs761210578
NM_001267550.2(TTN):c.68341G>A (p.Glu22781Lys) rs760286642
NM_001267550.2(TTN):c.6835C>G (p.Pro2279Ala) rs143679901
NM_001267550.2(TTN):c.68432G>T (p.Gly22811Val) rs78806155
NM_001267550.2(TTN):c.68437G>A (p.Glu22813Lys) rs200797552
NM_001267550.2(TTN):c.68449C>A (p.Arg22817=) rs371678190
NM_001267550.2(TTN):c.6845A>C (p.Tyr2282Ser) rs754307416
NM_001267550.2(TTN):c.68513C>T (p.Ala22838Val) rs372075439
NM_001267550.2(TTN):c.68599T>C (p.Tyr22867His) rs368484355
NM_001267550.2(TTN):c.68728G>A (p.Gly22910Arg) rs794729245
NM_001267550.2(TTN):c.68824G>A (p.Glu22942Lys) rs199506676
NM_001267550.2(TTN):c.68848C>A (p.Pro22950Thr) rs770007899
NM_001267550.2(TTN):c.68864G>C (p.Gly22955Ala) rs201381085
NM_001267550.2(TTN):c.68921A>G (p.Lys22974Arg) rs1559471235
NM_001267550.2(TTN):c.68981C>T (p.Thr22994Ile) rs183056142
NM_001267550.2(TTN):c.68984A>C (p.Gln22995Pro) rs879410317
NM_001267550.2(TTN):c.68990C>A (p.Thr22997Asn) rs886043272
NM_001267550.2(TTN):c.6899A>G (p.Tyr2300Cys) rs772093035
NM_001267550.2(TTN):c.69044C>T (p.Ala23015Val) rs771710562
NM_001267550.2(TTN):c.69103G>A (p.Val23035Ile) rs200878877
NM_001267550.2(TTN):c.69172A>T (p.Thr23058Ser) rs752304059
NM_001267550.2(TTN):c.69175C>T (p.Leu23059Phe) rs1394979272
NM_001267550.2(TTN):c.69212C>T (p.Pro23071Leu) rs367664195
NM_001267550.2(TTN):c.69251G>A (p.Arg23084Gln) rs200191748
NM_001267550.2(TTN):c.6927T>A (p.Asn2309Lys) rs147580120
NM_001267550.2(TTN):c.69338G>A (p.Arg23113Gln) rs370890454
NM_001267550.2(TTN):c.69376G>C (p.Val23126Leu) rs756671149
NM_001267550.2(TTN):c.69379C>G (p.Gln23127Glu) rs953796748
NM_001267550.2(TTN):c.69506G>T (p.Ser23169Ile) rs879245080
NM_001267550.2(TTN):c.6950G>A (p.Arg2317His) rs764882950
NM_001267550.2(TTN):c.69515C>T (p.Thr23172Ile) rs752643010
NM_001267550.2(TTN):c.69517G>A (p.Gly23173Arg) rs773592810
NM_001267550.2(TTN):c.6959G>A (p.Arg2320His) rs374615369
NM_001267550.2(TTN):c.69638G>A (p.Arg23213His) rs374883884
NM_001267550.2(TTN):c.69715+5G>C rs1553615539
NM_001267550.2(TTN):c.69731C>T (p.Pro23244Leu) rs879056292
NM_001267550.2(TTN):c.69748A>T (p.Thr23250Ser) rs1060500455
NM_001267550.2(TTN):c.6979G>T (p.Asp2327Tyr) rs1554002409
NM_001267550.2(TTN):c.69815T>G (p.Ile23272Ser) rs758398301
NM_001267550.2(TTN):c.69853G>A (p.Glu23285Lys) rs376870149
NM_001267550.2(TTN):c.69883G>A (p.Ala23295Thr) rs746519147
NM_001267550.2(TTN):c.69957C>G (p.Ile23319Met) rs540840413
NM_001267550.2(TTN):c.70045G>A (p.Glu23349Lys) rs397517682
NM_001267550.2(TTN):c.70102A>G (p.Ile23368Val) rs367914610
NM_001267550.2(TTN):c.70112G>C (p.Arg23371Pro) rs767208489
NM_001267550.2(TTN):c.70120C>G (p.Pro23374Ala) rs1553614524
NM_001267550.2(TTN):c.70153C>G (p.Leu23385Val) rs769672151
NM_001267550.2(TTN):c.70163G>A (p.Arg23388Gln) rs55853138
NM_001267550.2(TTN):c.70172T>C (p.Ile23391Thr) rs375202101
NM_001267550.2(TTN):c.70181C>T (p.Thr23394Met) rs397517683
NM_001267550.2(TTN):c.70240G>T (p.Val23414Phe) rs759158138
NM_001267550.2(TTN):c.70243A>C (p.Met23415Leu) rs200029470
NM_001267550.2(TTN):c.70244T>A (p.Met23415Lys) rs765861604
NM_001267550.2(TTN):c.70260G>A (p.Pro23420=) rs72646887
NM_001267550.2(TTN):c.7026del (p.Lys2344fs) rs1211627330
NM_001267550.2(TTN):c.70282G>T (p.Val23428Leu) rs794729486
NM_001267550.2(TTN):c.70324C>A (p.Leu23442Met) rs1553614105
NM_001267550.2(TTN):c.70424G>A (p.Arg23475His) rs370257707
NM_001267550.2(TTN):c.70435C>T (p.Arg23479Trp) rs760509116
NM_001267550.2(TTN):c.70480T>C (p.Tyr23494His) rs72646888
NM_001267550.2(TTN):c.70492G>A (p.Gly23498Ser) rs370771532
NM_001267550.2(TTN):c.70564G>A (p.Glu23522Lys) rs561586925
NM_001267550.2(TTN):c.70570A>G (p.Thr23524Ala) rs369526268
NM_001267550.2(TTN):c.70595C>T (p.Ala23532Val) rs1389381134
NM_001267550.2(TTN):c.7060C>T (p.Arg2354Cys) rs145039979
NM_001267550.2(TTN):c.70645G>A (p.Val23549Ile) rs755669336
NM_001267550.2(TTN):c.70651C>T (p.Leu23551=) rs72646889
NM_001267550.2(TTN):c.70655C>T (p.Ala23552Val)
NM_001267550.2(TTN):c.70748C>A (p.Thr23583Lys) rs397517687
NM_001267550.2(TTN):c.70748C>T (p.Thr23583Ile) rs397517687
NM_001267550.2(TTN):c.70753G>A (p.Val23585Met) rs754040141
NM_001267550.2(TTN):c.70813G>C (p.Val23605Leu) rs368325616
NM_001267550.2(TTN):c.70817T>C (p.Met23606Thr) rs371030086
NM_001267550.2(TTN):c.70830C>A (p.Ser23610Arg) rs12464787
NM_001267550.2(TTN):c.70975G>A (p.Gly23659Ser) rs376256345
NM_001267550.2(TTN):c.70982C>T (p.Pro23661Leu) rs1060500459
NM_001267550.2(TTN):c.71036G>A (p.Arg23679Lys) rs200144345
NM_001267550.2(TTN):c.71132T>C (p.Ile23711Thr) rs752317656
NM_001267550.2(TTN):c.71140G>A (p.Glu23714Lys) rs767016969
NM_001267550.2(TTN):c.71147G>A (p.Gly23716Asp) rs774327480
NM_001267550.2(TTN):c.71149G>T (p.Asp23717Tyr) rs371818894
NM_001267550.2(TTN):c.71155A>G (p.Ile23719Val) rs201818722
NM_001267550.2(TTN):c.71300G>A (p.Arg23767Gln) rs370516890
NM_001267550.2(TTN):c.71305A>T (p.Thr23769Ser) rs776889753
NM_001267550.2(TTN):c.71347C>T (p.Arg23783Cys) rs754516257
NM_001267550.2(TTN):c.71388G>T (p.Glu23796Asp) rs878854330
NM_001267550.2(TTN):c.71399G>A (p.Arg23800His) rs537705563
NM_001267550.2(TTN):c.71408C>T (p.Ala23803Val) rs1553611543
NM_001267550.2(TTN):c.71476G>C (p.Val23826Leu) rs377751708
NM_001267550.2(TTN):c.7148del (p.Ser2383fs) rs1060500437
NM_001267550.2(TTN):c.71568C>A (p.Ser23856Arg) rs1060500519
NM_001267550.2(TTN):c.71608G>A (p.Gly23870Ser) rs727503564
NM_001267550.2(TTN):c.71654T>C (p.Ile23885Thr) rs1488254665
NM_001267550.2(TTN):c.71699G>A (p.Arg23900Gln) rs369292052
NM_001267550.2(TTN):c.71719G>A (p.Ala23907Thr) rs1309139547
NM_001267550.2(TTN):c.71729G>A (p.Ser23910Asn) rs1060500509
NM_001267550.2(TTN):c.71766G>A (p.Leu23922=)
NM_001267550.2(TTN):c.71789A>T (p.Lys23930Ile) rs752648041
NM_001267550.2(TTN):c.71819C>T (p.Thr23940Ile) rs1553610793
NM_001267550.2(TTN):c.71879T>C (p.Ile23960Thr) rs568223521
NM_001267550.2(TTN):c.71891G>A (p.Arg23964Lys) rs770679732
NM_001267550.2(TTN):c.71908C>T (p.Arg23970Trp) rs748041610
NM_001267550.2(TTN):c.72106A>C (p.Lys24036Gln) rs544263357
NM_001267550.2(TTN):c.72106A>G (p.Lys24036Glu)
NM_001267550.2(TTN):c.72166C>T (p.Arg24056Cys) rs372662393
NM_001267550.2(TTN):c.72182T>C (p.Met24061Thr) rs200471370
NM_001267550.2(TTN):c.72231A>C (p.Glu24077Asp) rs1423712037
NM_001267550.2(TTN):c.72232A>G (p.Ile24078Val) rs876658080
NM_001267550.2(TTN):c.7229A>C (p.His2410Pro) rs747828487
NM_001267550.2(TTN):c.72331G>C (p.Ala24111Pro) rs369671334
NM_001267550.2(TTN):c.72358C>T (p.Leu24120Phe) rs372309164
NM_001267550.2(TTN):c.72363C>G (p.Asp24121Glu) rs919790172
NM_001267550.2(TTN):c.7246G>A (p.Asp2416Asn) rs1383990376
NM_001267550.2(TTN):c.72487C>T (p.Arg24163Cys) rs778284888
NM_001267550.2(TTN):c.72488G>A (p.Arg24163His) rs374712231
NM_001267550.2(TTN):c.72528A>C (p.Glu24176Asp) rs878854331
NM_001267550.2(TTN):c.72572A>C (p.Asn24191Thr) rs1479698498
NM_001267550.2(TTN):c.72611G>A (p.Gly24204Glu) rs1553609189
NM_001267550.2(TTN):c.72674C>T (p.Pro24225Leu) rs55992239
NM_001267550.2(TTN):c.72713C>T (p.Ser24238Leu) rs786205303
NM_001267550.2(TTN):c.72716T>C (p.Met24239Thr) rs750298083
NM_001267550.2(TTN):c.72743C>G (p.Ser24248Cys) rs1060500474
NM_001267550.2(TTN):c.72785G>A (p.Arg24262His) rs372390659
NM_001267550.2(TTN):c.72824A>T (p.Lys24275Ile) rs199860952
NM_001267550.2(TTN):c.72826A>T (p.Thr24276Ser) rs373204984
NM_001267550.2(TTN):c.72863C>G (p.Thr24288Arg) rs878997916
NM_001267550.2(TTN):c.72923C>G (p.Pro24308Arg) rs1553608507
NM_001267550.2(TTN):c.73021T>G (p.Ser24341Ala) rs1397935154
NM_001267550.2(TTN):c.73148C>T (p.Ser24383Leu) rs368415251
NM_001267550.2(TTN):c.73169C>A (p.Thr24390Lys) rs1060500583
NM_001267550.2(TTN):c.73258G>A (p.Glu24420Lys) rs1265445775
NM_001267550.2(TTN):c.73292A>T (p.Asp24431Val) rs754343858
NM_001267550.2(TTN):c.73303C>T (p.Arg24435Cys) rs200028088
NM_001267550.2(TTN):c.73319T>C (p.Ile24440Thr) rs370931683
NM_001267550.2(TTN):c.73334C>A (p.Thr24445Asn) rs377334665
NM_001267550.2(TTN):c.73334C>T (p.Thr24445Ile) rs377334665
NM_001267550.2(TTN):c.7339G>A (p.Val2447Met) rs779064962
NM_001267550.2(TTN):c.73568C>A (p.Pro24523Gln) rs753557799
NM_001267550.2(TTN):c.73570C>A (p.Gln24524Lys) rs753429609
NM_001267550.2(TTN):c.73604C>A (p.Ser24535Tyr) rs201804005
NM_001267550.2(TTN):c.73636G>C (p.Asp24546His) rs1051495269
NM_001267550.2(TTN):c.7365T>G (p.Asn2455Lys) rs777738635
NM_001267550.2(TTN):c.73759T>C (p.Cys24587Arg) rs776113871
NM_001267550.2(TTN):c.73822G>A (p.Ala24608Thr) rs750166986
NM_001267550.2(TTN):c.73847G>A (p.Arg24616Gln) rs201694149
NM_001267550.2(TTN):c.73878G>A (p.Met24626Ile) rs1060500561
NM_001267550.2(TTN):c.73896_73897insACT (p.Val24633_Ser24634insThr) rs1060500433
NM_001267550.2(TTN):c.73904T>C (p.Leu24635Pro) rs1553606189
NM_001267550.2(TTN):c.73930G>A (p.Gly24644Arg) rs1553606142
NM_001267550.2(TTN):c.73954A>G (p.Ile24652Val) rs760045336
NM_001267550.2(TTN):c.73975G>A (p.Gly24659Ser) rs776423108
NM_001267550.2(TTN):c.74021C>T (p.Ala24674Val) rs1158950009
NM_001267550.2(TTN):c.74024C>G (p.Thr24675Ser) rs1553606008
NM_001267550.2(TTN):c.74057C>T (p.Ser24686Phe) rs727504921
NM_001267550.2(TTN):c.74144C>T (p.Pro24715Leu) rs55713856
NM_001267550.2(TTN):c.74185G>A (p.Ala24729Thr) rs372007344
NM_001267550.2(TTN):c.74189G>A (p.Gly24730Asp) rs781046518
NM_001267550.2(TTN):c.74224C>T (p.Arg24742Cys) rs369489704
NM_001267550.2(TTN):c.74283A>G (p.Arg24761=) rs1559406924
NM_001267550.2(TTN):c.74305A>G (p.Asn24769Asp) rs372787601
NM_001267550.2(TTN):c.74339G>A (p.Arg24780Gln) rs776673912
NM_001267550.2(TTN):c.74482C>G (p.Leu24828Val) rs375181431
NM_001267550.2(TTN):c.74504A>G (p.Tyr24835Cys) rs201724962
NM_001267550.2(TTN):c.74513G>C (p.Gly24838Ala) rs200723435
NM_001267550.2(TTN):c.74519C>A (p.Ser24840Tyr) rs1060500559
NM_001267550.2(TTN):c.74527A>G (p.Asn24843Asp) rs373527654
NM_001267550.2(TTN):c.74602A>G (p.Ile24868Val) rs72646898
NM_001267550.2(TTN):c.74608G>C (p.Ala24870Pro) rs768892376
NM_001267550.2(TTN):c.74612G>A (p.Cys24871Tyr) rs1553604956
NM_001267550.2(TTN):c.7468C>T (p.Arg2490Cys) rs200131545
NM_001267550.2(TTN):c.7469G>T (p.Arg2490Leu) rs148920986
NM_001267550.2(TTN):c.74704G>A (p.Ala24902Thr) rs1260354990
NM_001267550.2(TTN):c.74814T>A (p.Ser24938Arg) rs747593205
NM_001267550.2(TTN):c.74830C>A (p.His24944Asn) rs779868325
NM_001267550.2(TTN):c.74895A>G (p.Gln24965=) rs201512527
NM_001267550.2(TTN):c.74988A>C (p.Lys24996Asn) rs933609400
NM_001267550.2(TTN):c.7498C>T (p.Gln2500Ter) rs1561253718
NM_001267550.2(TTN):c.75011G>A (p.Arg25004His) rs909041164
NM_001267550.2(TTN):c.75016C>T (p.Pro25006Ser) rs1264279589
NM_001267550.2(TTN):c.7501C>T (p.Arg2501Ter)
NM_001267550.2(TTN):c.7502G>A (p.Arg2501Gln) rs369559000
NM_001267550.2(TTN):c.75127G>T (p.Val25043Phe) rs559907766
NM_001267550.2(TTN):c.75155G>A (p.Arg25052His) rs542720402
NM_001267550.2(TTN):c.75161T>C (p.Met25054Thr) rs1553604004
NM_001267550.2(TTN):c.7516C>G (p.Arg2506Gly) rs780415493
NM_001267550.2(TTN):c.75238C>T (p.Arg25080Trp) rs1370877041
NM_001267550.2(TTN):c.75259G>A (p.Ala25087Thr) rs759110420
NM_001267550.2(TTN):c.75277C>G (p.Pro25093Ala) rs748359400
NM_001267550.2(TTN):c.75325C>T (p.Pro25109Ser) rs1060500498
NM_001267550.2(TTN):c.7534G>A (p.Glu2512Lys) rs116049561
NM_001267550.2(TTN):c.75359C>A (p.Thr25120Lys) rs878854333
NM_001267550.2(TTN):c.75361A>G (p.Ile25121Val) rs199508062
NM_001267550.2(TTN):c.75490G>A (p.Asp25164Asn) rs192468365
NM_001267550.2(TTN):c.75526C>T (p.Arg25176Cys) rs368339903
NM_001267550.2(TTN):c.75527G>A (p.Arg25176His) rs375693396
NM_001267550.2(TTN):c.75554A>C (p.Lys25185Thr) rs371042435
NM_001267550.2(TTN):c.75653C>T (p.Thr25218Ile) rs1060500521
NM_001267550.2(TTN):c.75668C>T (p.Thr25223Ile) rs370070176
NM_001267550.2(TTN):c.75746G>A (p.Arg25249His) rs773286477
NM_001267550.2(TTN):c.75816C>T (p.Gly25272=) rs770708534
NM_001267550.2(TTN):c.75841G>T (p.Ala25281Ser)
NM_001267550.2(TTN):c.75913C>T (p.Pro25305Ser) rs1005621705
NM_001267550.2(TTN):c.75934G>A (p.Glu25312Lys) rs770655678
NM_001267550.2(TTN):c.75952A>G (p.Lys25318Glu) rs878854334
NM_001267550.2(TTN):c.75968T>G (p.Val25323Gly) rs781058398
NM_001267550.2(TTN):c.75982C>A (p.Pro25328Thr) rs201776072
NM_001267550.2(TTN):c.75997G>A (p.Gly25333Ser) rs757343393
NM_001267550.2(TTN):c.7600A>G (p.Lys2534Glu) rs767167863
NM_001267550.2(TTN):c.76030C>T (p.Arg25344Trp) rs371696090
NM_001267550.2(TTN):c.76064A>G (p.His25355Arg) rs1399292028
NM_001267550.2(TTN):c.76069C>T (p.Arg25357Cys) rs145437410
NM_001267550.2(TTN):c.76070G>A (p.Arg25357His) rs397517703
NM_001267550.2(TTN):c.76087C>T (p.Arg25363Cys) rs757511354
NM_001267550.2(TTN):c.76124A>T (p.Tyr25375Phe) rs374494927
NM_001267550.2(TTN):c.76168C>T (p.Pro25390Ser) rs878948198
NM_001267550.2(TTN):c.76187A>G (p.Tyr25396Cys) rs1060500403
NM_001267550.2(TTN):c.7618C>T (p.Arg2540Cys) rs368574470
NM_001267550.2(TTN):c.7619G>A (p.Arg2540His) rs397517725
NM_001267550.2(TTN):c.76238A>G (p.Lys25413Arg) rs367696053
NM_001267550.2(TTN):c.7624C>T (p.Leu2542Phe) rs762722498
NM_001267550.2(TTN):c.7628C>G (p.Thr2543Ser) rs765136135
NM_001267550.2(TTN):c.7628C>T (p.Thr2543Ile) rs765136135
NM_001267550.2(TTN):c.7634C>T (p.Thr2545Ile) rs1016165797
NM_001267550.2(TTN):c.7639del (p.Thr2547fs) rs1060500400
NM_001267550.2(TTN):c.76402G>T (p.Val25468Leu) rs200308639
NM_001267550.2(TTN):c.76492C>A (p.Pro25498Thr) rs377754701
NM_001267550.2(TTN):c.76492C>G (p.Pro25498Ala) rs377754701
NM_001267550.2(TTN):c.76541T>C (p.Leu25514Pro) rs1553601755
NM_001267550.2(TTN):c.76556T>C (p.Ile25519Thr) rs376185524
NM_001267550.2(TTN):c.76566_76568dup (p.Arg25523dup) rs772268958
NM_001267550.2(TTN):c.76577G>A (p.Gly25526Asp) rs369344156
NM_001267550.2(TTN):c.76607G>T (p.Gly25536Val)
NM_001267550.2(TTN):c.76627A>G (p.Lys25543Glu) rs372016541
NM_001267550.2(TTN):c.76645G>A (p.Gly25549Ser) rs181166140
NM_001267550.2(TTN):c.76661C>G (p.Ala25554Gly) rs879087699
NM_001267550.2(TTN):c.76672G>T (p.Asp25558Tyr) rs750336110
NM_001267550.2(TTN):c.76707C>A (p.Asp25569Glu) rs1002726225
NM_001267550.2(TTN):c.76711G>A (p.Val25571Ile) rs760782774
NM_001267550.2(TTN):c.76739C>A (p.Thr25580Lys) rs56372592
NM_001267550.2(TTN):c.76802C>T (p.Thr25601Met) rs374913031
NM_001267550.2(TTN):c.76838T>A (p.Ile25613Asn) rs1553601096
NM_001267550.2(TTN):c.76858A>G (p.Ile25620Val) rs773656560
NM_001267550.2(TTN):c.76889G>T (p.Gly25630Val) rs760386525
NM_001267550.2(TTN):c.76931C>T (p.Thr25644Ile) rs1060500456
NM_001267550.2(TTN):c.76952T>C (p.Val25651Ala) rs370768049
NM_001267550.2(TTN):c.76962C>G (p.Asn25654Lys) rs755800765
NM_001267550.2(TTN):c.76967A>G (p.His25656Arg)
NM_001267550.2(TTN):c.76981A>G (p.Lys25661Glu) rs1553600919
NM_001267550.2(TTN):c.77035A>C (p.Asn25679His) rs770512378
NM_001267550.2(TTN):c.77049T>G (p.Ile25683Met)
NM_001267550.2(TTN):c.7711G>A (p.Glu2571Lys) rs149660690
NM_001267550.2(TTN):c.77182A>G (p.Ser25728Gly) rs1306199809
NM_001267550.2(TTN):c.77188A>G (p.Ile25730Val) rs745981754
NM_001267550.2(TTN):c.77365A>T (p.Ile25789Leu) rs1253687329
NM_001267550.2(TTN):c.7744G>A (p.Ala2582Thr) rs1060500576
NM_001267550.2(TTN):c.77510C>T (p.Pro25837Leu) rs752618930
NM_001267550.2(TTN):c.77540C>T (p.Thr25847Ile) rs917984063
NM_001267550.2(TTN):c.7756dup (p.Ile2586fs) rs1553999983
NM_001267550.2(TTN):c.77623G>A (p.Val25875Ile) rs763284241
NM_001267550.2(TTN):c.77652A>T (p.Glu25884Asp) rs748940985
NM_001267550.2(TTN):c.77654T>C (p.Ile25885Thr) rs199514898
NM_001267550.2(TTN):c.77707G>A (p.Val25903Ile) rs570615498
NM_001267550.2(TTN):c.77749T>C (p.Tyr25917His) rs370137092
NM_001267550.2(TTN):c.77781T>G (p.Ile25927Met) rs1226545466
NM_001267550.2(TTN):c.77816A>C (p.Asp25939Ala) rs397517712
NM_001267550.2(TTN):c.77821G>A (p.Val25941Ile) rs928158833
NM_001267550.2(TTN):c.7789G>T (p.Asp2597Tyr) rs1553999887
NM_001267550.2(TTN):c.78006_78020del (p.Ile26002_Ser26006del) rs1064792913
NM_001267550.2(TTN):c.78064G>A (p.Val26022Ile) rs374764110
NM_001267550.2(TTN):c.78118G>A (p.Val26040Ile) rs576341346
NM_001267550.2(TTN):c.7816G>A (p.Ala2606Thr) rs375286376
NM_001267550.2(TTN):c.7818G>A (p.Ala2606=) rs935809232
NM_001267550.2(TTN):c.78231C>A (p.Ser26077Arg) rs1553596375
NM_001267550.2(TTN):c.78286G>A (p.Glu26096Lys) rs370515843
NM_001267550.2(TTN):c.78323A>G (p.Gln26108Arg) rs370963021
NM_001267550.2(TTN):c.78370A>G (p.Ile26124Val) rs397517713
NM_001267550.2(TTN):c.78371T>A (p.Ile26124Asn) rs778290450
NM_001267550.2(TTN):c.78413C>A (p.Ala26138Asp) rs373587432
NM_001267550.2(TTN):c.78431T>C (p.Ile26144Thr) rs183015944
NM_001267550.2(TTN):c.78446C>G (p.Thr26149Ser) rs191263181
NM_001267550.2(TTN):c.78466G>T (p.Asp26156Tyr) rs1553595170
NM_001267550.2(TTN):c.78541C>T (p.Pro26181Ser) rs1553594900
NM_001267550.2(TTN):c.78577A>C (p.Ile26193Leu) rs727505241
NM_001267550.2(TTN):c.78589C>A (p.Pro26197Thr) rs747052899
NM_001267550.2(TTN):c.78637C>T (p.Leu26213Phe) rs1553594441
NM_001267550.2(TTN):c.78676G>C (p.Glu26226Gln) rs754878387
NM_001267550.2(TTN):c.78707A>T (p.Glu26236Val) rs1559361218
NM_001267550.2(TTN):c.78892G>A (p.Gly26298Arg) rs72648205
NM_001267550.2(TTN):c.78906A>C (p.Glu26302Asp) rs534003014
NM_001267550.2(TTN):c.78914C>G (p.Ser26305Cys) rs199646089
NM_001267550.2(TTN):c.79068A>G (p.Glu26356=) rs375454098
NM_001267550.2(TTN):c.79085T>C (p.Met26362Thr) rs529839486
NM_001267550.2(TTN):c.79105G>A (p.Val26369Ile) rs778729064
NM_001267550.2(TTN):c.79145A>C (p.Asn26382Thr) rs727505049
NM_001267550.2(TTN):c.79213G>A (p.Val26405Ile) rs769972835
NM_001267550.2(TTN):c.79226G>A (p.Arg26409His) rs72648206
NM_001267550.2(TTN):c.79251G>C (p.Glu26417Asp) rs369019463
NM_001267550.2(TTN):c.79264A>C (p.Ile26422Leu) rs1553590996
NM_001267550.2(TTN):c.79264A>G (p.Ile26422Val) rs1553590996
NM_001267550.2(TTN):c.79333C>T (p.Arg26445Cys) rs780658084
NM_001267550.2(TTN):c.79342G>A (p.Val26448Met) rs1380054566
NM_001267550.2(TTN):c.79546G>A (p.Gly26516Ser) rs776256093
NM_001267550.2(TTN):c.7955G>A (p.Trp2652Ter)
NM_001267550.2(TTN):c.79636A>G (p.Thr26546Ala) rs775053902
NM_001267550.2(TTN):c.79640G>A (p.Arg26547Gln) rs771534555
NM_001267550.2(TTN):c.79744A>C (p.Lys26582Gln) rs775918922
NM_001267550.2(TTN):c.79768C>T (p.Pro26590Ser) rs767838835
NM_001267550.2(TTN):c.79861_79862inv (p.Thr26621Val)
NM_001267550.2(TTN):c.79862C>A (p.Thr26621Lys) rs3731746
NM_001267550.2(TTN):c.79883G>C (p.Arg26628Pro) rs201091376
NM_001267550.2(TTN):c.79969G>T (p.Asp26657Tyr) rs781076407
NM_001267550.2(TTN):c.79987_79989del (p.Leu26663del) rs1193943076
NM_001267550.2(TTN):c.80159T>C (p.Ile26720Thr) rs879183549
NM_001267550.2(TTN):c.80168G>A (p.Arg26723His) rs371615296
NM_001267550.2(TTN):c.80170G>A (p.Glu26724Lys)
NM_001267550.2(TTN):c.8018A>G (p.Lys2673Arg) rs1060500389
NM_001267550.2(TTN):c.80228A>C (p.Lys26743Thr) rs368263400
NM_001267550.2(TTN):c.80263T>C (p.Phe26755Leu) rs200181804
NM_001267550.2(TTN):c.80351C>G (p.Pro26784Arg) rs1553584164
NM_001267550.2(TTN):c.80399T>C (p.Met26800Thr) rs761384994
NM_001267550.2(TTN):c.80425G>A (p.Gly26809Ser) rs369941201
NM_001267550.2(TTN):c.80446G>A (p.Val26816Ile) rs774092000
NM_001267550.2(TTN):c.80462C>T (p.Pro26821Leu) rs200489046
NM_001267550.2(TTN):c.80542G>C (p.Glu26848Gln) rs898433512
NM_001267550.2(TTN):c.80553_80554delinsTT (p.Arg26852Cys) rs397517716
NM_001267550.2(TTN):c.80555G>A (p.Arg26852His) rs202149931
NM_001267550.2(TTN):c.80666A>G (p.Tyr26889Cys) rs571328201
NM_001267550.2(TTN):c.80704C>T (p.Pro26902Ser) rs1024262797
NM_001267550.2(TTN):c.80717G>A (p.Arg26906Gln) rs536183519
NM_001267550.2(TTN):c.80726C>T (p.Pro26909Leu) rs1553581878
NM_001267550.2(TTN):c.80782G>A (p.Val26928Ile) rs780885076
NM_001267550.2(TTN):c.80854G>A (p.Val26952Ile) rs371362606
NM_001267550.2(TTN):c.80876G>A (p.Gly26959Asp) rs768259414
NM_001267550.2(TTN):c.80882C>T (p.Ala26961Val) rs749194310
NM_001267550.2(TTN):c.80941C>T (p.Arg26981Trp) rs779878975
NM_001267550.2(TTN):c.80942G>A (p.Arg26981Gln) rs768308408
NM_001267550.2(TTN):c.80950G>A (p.Glu26984Lys) rs1060500562
NM_001267550.2(TTN):c.8095T>G (p.Ser2699Ala) rs373857878
NM_001267550.2(TTN):c.81022T>G (p.Tyr27008Asp) rs72648211
NM_001267550.2(TTN):c.81089_81091CAA[1] (p.Thr27031del) rs1163103954
NM_001267550.2(TTN):c.81094A>G (p.Ile27032Val) rs369908251
NM_001267550.2(TTN):c.81157T>A (p.Tyr27053Asn) rs776943572
NM_001267550.2(TTN):c.81229G>A (p.Gly27077Arg) rs878898668
NM_001267550.2(TTN):c.81233C>A (p.Thr27078Asn) rs1553578982
NM_001267550.2(TTN):c.81247T>C (p.Ser27083Pro) rs186273940
NM_001267550.2(TTN):c.81250A>G (p.Ile27084Val)
NM_001267550.2(TTN):c.81302G>A (p.Gly27101Asp) rs201490050
NM_001267550.2(TTN):c.81347G>A (p.Ser27116Asn) rs1234317183
NM_001267550.2(TTN):c.81389C>T (p.Thr27130Ile) rs757768218
NM_001267550.2(TTN):c.81464T>C (p.Ile27155Thr) rs397517720
NM_001267550.2(TTN):c.81472C>G (p.Pro27158Ala) rs200771189
NM_001267550.2(TTN):c.81509C>T (p.Pro27170Leu) rs774553407
NM_001267550.2(TTN):c.81511T>C (p.Cys27171Arg) rs727504678
NM_001267550.2(TTN):c.81517C>G (p.Pro27173Ala) rs754325718
NM_001267550.2(TTN):c.81527G>T (p.Arg27176Leu) rs199726308
NM_001267550.2(TTN):c.81545T>A (p.Ile27182Asn) rs373448447
NM_001267550.2(TTN):c.81647G>A (p.Arg27216His) rs371910831
NM_001267550.2(TTN):c.81653T>C (p.Met27218Thr) rs1332904652
NM_001267550.2(TTN):c.81671A>G (p.Asn27224Ser) rs368443217
NM_001267550.2(TTN):c.81856G>A (p.Val27286Ile) rs372784067
NM_001267550.2(TTN):c.81869G>C (p.Gly27290Ala) rs200240728
NM_001267550.2(TTN):c.81875C>T (p.Thr27292Ile) rs1060500393
NM_001267550.2(TTN):c.81899G>A (p.Arg27300His) rs55850344
NM_001267550.2(TTN):c.82019T>A (p.Ile27340Lys) rs371592971
NM_001267550.2(TTN):c.82022G>A (p.Arg27341Gln) rs555414240
NM_001267550.2(TTN):c.82060G>A (p.Val27354Ile) rs878854336
NM_001267550.2(TTN):c.82064G>A (p.Gly27355Asp) rs1474733241
NM_001267550.2(TTN):c.82070C>G (p.Thr27357Arg)
NM_001267550.2(TTN):c.82084A>G (p.Ile27362Val) rs886039181
NM_001267550.2(TTN):c.82106G>A (p.Arg27369Lys) rs774715672
NM_001267550.2(TTN):c.82171T>C (p.Trp27391Arg) rs778983249
NM_001267550.2(TTN):c.82193G>A (p.Gly27398Asp) rs1553574305
NM_001267550.2(TTN):c.8220G>A (p.Trp2740Ter) rs1553995639
NM_001267550.2(TTN):c.82303C>A (p.Leu27435Ile) rs1060500432
NM_001267550.2(TTN):c.82386G>A (p.Thr27462=) rs773950138
NM_001267550.2(TTN):c.82402A>C (p.Lys27468Gln) rs201958805
NM_001267550.2(TTN):c.82424C>A (p.Thr27475Lys) rs377169807
NM_001267550.2(TTN):c.82448A>G (p.Lys27483Arg) rs937111656
NM_001267550.2(TTN):c.82457T>C (p.Met27486Thr) rs746435098
NM_001267550.2(TTN):c.82474C>T (p.Arg27492Cys) rs767221784
NM_001267550.2(TTN):c.82539C>T (p.Gly27513=) rs775673876
NM_001267550.2(TTN):c.82561A>G (p.Lys27521Glu) rs1060500417
NM_001267550.2(TTN):c.82582C>T (p.Arg27528Trp) rs749852593
NM_001267550.2(TTN):c.82583G>A (p.Arg27528Gln)
NM_001267550.2(TTN):c.82606G>A (p.Glu27536Lys) rs745974517
NM_001267550.2(TTN):c.82616C>G (p.Ser27539Cys) rs727503556
NM_001267550.2(TTN):c.82684T>C (p.Tyr27562His) rs376616067
NM_001267550.2(TTN):c.82754C>A (p.Ser27585Tyr) rs72648215
NM_001267550.2(TTN):c.82796G>A (p.Gly27599Asp) rs1553571755
NM_001267550.2(TTN):c.82810G>A (p.Gly27604Ser) rs199929362
NM_001267550.2(TTN):c.82810G>C (p.Gly27604Arg) rs199929362
NM_001267550.2(TTN):c.82814A>G (p.Tyr27605Cys) rs753352392
NM_001267550.2(TTN):c.8285A>T (p.Tyr2762Phe) rs1553995474
NM_001267550.2(TTN):c.82919C>G (p.Thr27640Ser) rs1553571185
NM_001267550.2(TTN):c.82934G>A (p.Arg27645His) rs766522109
NM_001267550.2(TTN):c.82981C>T (p.Pro27661Ser) rs201422612
NM_001267550.2(TTN):c.83011G>C (p.Glu27671Gln) rs949881130
NM_001267550.2(TTN):c.83017C>A (p.Pro27673Thr) rs769343491
NM_001267550.2(TTN):c.83032G>A (p.Asp27678Asn) rs781128731
NM_001267550.2(TTN):c.83095A>C (p.Ile27699Leu) rs1553570628
NM_001267550.2(TTN):c.83105G>A (p.Arg27702Gln) rs776136653
NM_001267550.2(TTN):c.8312T>C (p.Ile2771Thr) rs780465670
NM_001267550.2(TTN):c.83171T>G (p.Val27724Gly) rs201896662
NM_001267550.2(TTN):c.83218G>A (p.Asp27740Asn) rs776130801
NM_001267550.2(TTN):c.83227C>T (p.Arg27743Trp) rs1185542536
NM_001267550.2(TTN):c.83228G>A (p.Arg27743Gln) rs768262273
NM_001267550.2(TTN):c.83252A>G (p.Asn27751Ser) rs775527437
NM_001267550.2(TTN):c.83281G>A (p.Val27761Ile) rs371788070
NM_001267550.2(TTN):c.83281G>C (p.Val27761Leu) rs371788070
NM_001267550.2(TTN):c.83317T>G (p.Leu27773Val)
NM_001267550.2(TTN):c.83324T>C (p.Ile27775Thr) rs769577217
NM_001267550.2(TTN):c.83404A>G (p.Ile27802Val) rs727504723
NM_001267550.2(TTN):c.83410G>A (p.Glu27804Lys) rs759095633
NM_001267550.2(TTN):c.83519T>C (p.Val27840Ala) rs752446232
NM_001267550.2(TTN):c.83543T>C (p.Ile27848Thr) rs397517723
NM_001267550.2(TTN):c.83575A>G (p.Lys27859Glu) rs761633407
NM_001267550.2(TTN):c.83590C>T (p.Pro27864Ser) rs1553568366
NM_001267550.2(TTN):c.835C>T (p.Arg279Trp) rs138060032
NM_001267550.2(TTN):c.83618T>C (p.Val27873Ala) rs200775919
NM_001267550.2(TTN):c.83629C>T (p.Arg27877Cys) rs527624888
NM_001267550.2(TTN):c.83630G>A (p.Arg27877His) rs371345921
NM_001267550.2(TTN):c.83649G>C (p.Lys27883Asn) rs878854337
NM_001267550.2(TTN):c.8365A>T (p.Arg2789Ter) rs1553995241
NM_001267550.2(TTN):c.83779A>C (p.Thr27927Pro) rs1164046049
NM_001267550.2(TTN):c.83821G>A (p.Glu27941Lys) rs545954394
NM_001267550.2(TTN):c.83870G>C (p.Arg27957Thr) rs148067743
NM_001267550.2(TTN):c.83939T>C (p.Leu27980Pro) rs1060500536
NM_001267550.2(TTN):c.84004A>C (p.Thr28002Pro) rs369737884
NM_001267550.2(TTN):c.84011A>G (p.Lys28004Arg) rs776987640
NM_001267550.2(TTN):c.84072A>C (p.Glu28024Asp) rs377540780
NM_001267550.2(TTN):c.84148A>G (p.Ile28050Val) rs201348580
NM_001267550.2(TTN):c.84187C>T (p.Arg28063Cys) rs539595292
NM_001267550.2(TTN):c.84188G>A (p.Arg28063His) rs570847832
NM_001267550.2(TTN):c.84203G>C (p.Ser28068Thr) rs72648219
NM_001267550.2(TTN):c.84263G>A (p.Ser28088Asn) rs200450022
NM_001267550.2(TTN):c.84263G>C (p.Ser28088Thr) rs200450022
NM_001267550.2(TTN):c.84304T>C (p.Trp28102Arg) rs1553565393
NM_001267550.2(TTN):c.84332G>A (p.Arg28111Lys) rs1060500463
NM_001267550.2(TTN):c.84335C>T (p.Thr28112Ile) rs1429490203
NM_001267550.2(TTN):c.84338C>T (p.Ser28113Phe) rs753201539
NM_001267550.2(TTN):c.84353G>A (p.Arg28118His) rs72648220
NM_001267550.2(TTN):c.84353G>T (p.Arg28118Leu) rs72648220
NM_001267550.2(TTN):c.84383G>A (p.Arg28128His) rs367596354
NM_001267550.2(TTN):c.84398A>G (p.Asn28133Ser) rs727505053
NM_001267550.2(TTN):c.84497C>T (p.Ala28166Val) rs1553564661
NM_001267550.2(TTN):c.84574G>A (p.Glu28192Lys) rs879123930
NM_001267550.2(TTN):c.84640A>G (p.Met28214Val) rs72648221
NM_001267550.2(TTN):c.84794C>A (p.Thr28265Lys) rs376874908
NM_001267550.2(TTN):c.84797_84799del (p.Arg28266del) rs1553564204
NM_001267550.2(TTN):c.84848A>G (p.Lys28283Arg) rs545841306
NM_001267550.2(TTN):c.84923A>C (p.Gln28308Pro) rs201674674
NM_001267550.2(TTN):c.8494G>C (p.Val2832Leu) rs375549179
NM_001267550.2(TTN):c.84964C>T (p.Arg28322Cys) rs774978209
NM_001267550.2(TTN):c.84965G>A (p.Arg28322His) rs373532064
NM_001267550.2(TTN):c.84968A>G (p.Tyr28323Cys) rs1285180382
NM_001267550.2(TTN):c.84968A>T (p.Tyr28323Phe) rs1285180382
NM_001267550.2(TTN):c.84976C>T (p.Arg28326Trp) rs749633038
NM_001267550.2(TTN):c.84977G>A (p.Arg28326Gln) rs200843338
NM_001267550.2(TTN):c.8497G>T (p.Glu2833Ter) rs1553994874
NM_001267550.2(TTN):c.84998C>T (p.Ala28333Val) rs886042586
NM_001267550.2(TTN):c.85036A>C (p.Ile28346Leu) rs912296403
NM_001267550.2(TTN):c.85040T>C (p.Ile28347Thr) rs397517731
NM_001267550.2(TTN):c.85115G>A (p.Gly28372Glu) rs190721759
NM_001267550.2(TTN):c.85119G>T (p.Glu28373Asp) rs770787056
NM_001267550.2(TTN):c.85204G>A (p.Ala28402Thr) rs1060500439
NM_001267550.2(TTN):c.85301A>C (p.Asn28434Thr) rs758519100
NM_001267550.2(TTN):c.85315C>T (p.Arg28439Trp) rs757653038
NM_001267550.2(TTN):c.85316G>A (p.Arg28439Gln)
NM_001267550.2(TTN):c.85334G>A (p.Cys28445Tyr) rs773226749
NM_001267550.2(TTN):c.85402T>C (p.Cys28468Arg) rs1553563147
NM_001267550.2(TTN):c.85420C>T (p.Arg28474Cys) rs757771061
NM_001267550.2(TTN):c.85428A>G (p.Gln28476=) rs777939514
NM_001267550.2(TTN):c.85450G>A (p.Asp28484Asn) rs56330345
NM_001267550.2(TTN):c.85450G>T (p.Asp28484Tyr) rs56330345
NM_001267550.2(TTN):c.85462G>A (p.Val28488Ile) rs377264123
NM_001267550.2(TTN):c.85472G>A (p.Arg28491His) rs373129706
NM_001267550.2(TTN):c.85624A>G (p.Ile28542Val) rs554841820
NM_001267550.2(TTN):c.85649T>A (p.Val28550Asp) rs727505194
NM_001267550.2(TTN):c.85748C>T (p.Ser28583Phe) rs1553562507
NM_001267550.2(TTN):c.85838C>T (p.Thr28613Ile) rs368615862
NM_001267550.2(TTN):c.85876T>C (p.Tyr28626His) rs1477861188
NM_001267550.2(TTN):c.85976A>C (p.Lys28659Thr) rs200724395
NM_001267550.2(TTN):c.85979T>C (p.Ile28660Thr) rs397517733
NM_001267550.2(TTN):c.86002A>G (p.Ile28668Val) rs72648225
NM_001267550.2(TTN):c.86003T>C (p.Ile28668Thr) rs374022393
NM_001267550.2(TTN):c.86030T>C (p.Phe28677Ser) rs1553561985
NM_001267550.2(TTN):c.86120G>A (p.Gly28707Glu) rs754207859
NM_001267550.2(TTN):c.86140G>A (p.Gly28714Arg) rs532818379
NM_001267550.2(TTN):c.86242A>G (p.Arg28748Gly) rs1553561470
NM_001267550.2(TTN):c.86290T>A (p.Leu28764Met) rs1553561353
NM_001267550.2(TTN):c.86292G>C (p.Leu28764Phe) rs1553561345
NM_001267550.2(TTN):c.86294T>C (p.Ile28765Thr) rs1553561335
NM_001267550.2(TTN):c.86377A>G (p.Thr28793Ala) rs727505234
NM_001267550.2(TTN):c.8640G>A (p.Glu2880=) rs879222360
NM_001267550.2(TTN):c.86417C>T (p.Ser28806Phe) rs1060500445
NM_001267550.2(TTN):c.86419C>T (p.Arg28807Cys) rs765632053
NM_001267550.2(TTN):c.86420G>A (p.Arg28807His) rs375800916
NM_001267550.2(TTN):c.86471C>T (p.Thr28824Ile) rs200709344
NM_001267550.2(TTN):c.8648A>G (p.His2883Arg) rs753833148
NM_001267550.2(TTN):c.86497_86498delinsTT (p.Ala28833Phe) rs794729519
NM_001267550.2(TTN):c.86560G>A (p.Val28854Met) rs769060885
NM_001267550.2(TTN):c.86654G>A (p.Arg28885His) rs371539720
NM_001267550.2(TTN):c.86676G>T (p.Trp28892Cys) rs779407441
NM_001267550.2(TTN):c.86723A>G (p.Asn28908Ser) rs377612718
NM_001267550.2(TTN):c.86729_86731AAG[1] (p.Glu28911del) rs727504797
NM_001267550.2(TTN):c.86762G>A (p.Gly28921Glu) rs1553559912
NM_001267550.2(TTN):c.86836C>G (p.Pro28946Ala) rs748587720
NM_001267550.2(TTN):c.86846T>C (p.Leu28949Pro) rs745542033
NM_001267550.2(TTN):c.86851G>C (p.Val28951Leu) rs878854426
NM_001267550.2(TTN):c.8687C>T (p.Thr2896Ile) rs72647884
NM_001267550.2(TTN):c.86903A>G (p.His28968Arg) rs754679595
NM_001267550.2(TTN):c.86974T>C (p.Cys28992Arg) rs769162510