ClinVar Miner

List of variants in gene TTN reported by Genomic Research Center,Shahid Beheshti University of Medical Sciences

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 22
Download table as spreadsheet
HGVS dbSNP
NM_001267550.2(TTN):c.106925G>A (p.Gly35642Asp) rs1553480410
NM_001267550.2(TTN):c.107635C>T (p.Gln35879Ter) rs757082154
NM_001267550.2(TTN):c.11311+1740T>A rs762962308
NM_001267550.2(TTN):c.11311+5023dup
NM_001267550.2(TTN):c.1771C>T (p.Gln591Ter) rs747286444
NM_001267550.2(TTN):c.2283_2288del (p.Lys762_Ala763del) rs727503701
NM_001267550.2(TTN):c.23633A>T (p.Glu7878Val) rs1553906392
NM_001267550.2(TTN):c.26528C>T (p.Thr8843Met) rs72648990
NM_001267550.2(TTN):c.31643C>T (p.Pro10548Leu) rs753460621
NM_001267550.2(TTN):c.33826+1G>A rs1389908421
NM_001267550.2(TTN):c.34098_34118GGAAGAGGAAGTTCTACCTGA[3] (p.11363_11369VLPEEEE[5]) rs397517548
NM_001267550.2(TTN):c.3487G>A (p.Gly1163Arg) rs1554015228
NM_001267550.2(TTN):c.34922del (p.Pro11641fs) rs1553809971
NM_001267550.2(TTN):c.39379+2T>G rs1560102141
NM_001267550.2(TTN):c.42851G>A (p.Arg14284His) rs368572799
NM_001267550.2(TTN):c.46771T>C (p.Tyr15591His) rs775496863
NM_001267550.2(TTN):c.57970C>T (p.Arg19324Trp) rs1203435642
NM_001267550.2(TTN):c.69328T>C (p.Tyr23110His) rs1553616495
NM_001267550.2(TTN):c.70876G>T (p.Glu23626Ter) rs1559446852
NM_001267550.2(TTN):c.91363G>A (p.Val30455Met)
NM_001267550.2(TTN):c.94906G>A (p.Asp31636Asn) rs776793953
NM_133379.5(TTN):c.1800+1G>A rs397517497

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.