ClinVar Miner

List of variants in gene TTN reported as uncertain significance by CeGaT Praxis fuer Humangenetik Tuebingen

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 638
Download table as spreadsheet
HGVS dbSNP
NM_001256850.1(TTN):c.32389+5A>C rs373367032
NM_001256850.1(TTN):c.83383+8T>C rs369690199
NM_001267550.1(TTN):c.45599C>G rs201057307
NM_001267550.2(TTN):c.100244C>T (p.Pro33415Leu) rs72648282
NM_001267550.2(TTN):c.100508G>T (p.Arg33503Ile) rs1333857764
NM_001267550.2(TTN):c.100561G>A (p.Gly33521Ser) rs1159933027
NM_001267550.2(TTN):c.100696A>G (p.Thr33566Ala) rs878854282
NM_001267550.2(TTN):c.100826G>A (p.Arg33609Gln) rs771243505
NM_001267550.2(TTN):c.101244C>T (p.Thr33748=) rs765149703
NM_001267550.2(TTN):c.101588A>G (p.Glu33863Gly) rs1575288057
NM_001267550.2(TTN):c.101756A>T (p.Tyr33919Phe) rs1575285823
NM_001267550.2(TTN):c.102437T>C (p.Val34146Ala)
NM_001267550.2(TTN):c.102561C>T (p.Tyr34187=) rs375625664
NM_001267550.2(TTN):c.102713G>A (p.Arg34238His) rs767961553
NM_001267550.2(TTN):c.102736C>T (p.Arg34246Cys) rs879047941
NM_001267550.2(TTN):c.102751A>G (p.Met34251Val) rs56173891
NM_001267550.2(TTN):c.102984C>T (p.Asp34328=) rs541125667
NM_001267550.2(TTN):c.103302T>C (p.Tyr34434=) rs773408387
NM_001267550.2(TTN):c.103412G>A (p.Arg34471Gln) rs149391616
NM_001267550.2(TTN):c.103416C>G (p.His34472Gln) rs770574446
NM_001267550.2(TTN):c.103688T>C (p.Val34563Ala) rs55945684
NM_001267550.2(TTN):c.103870C>G (p.Leu34624Val) rs1575253647
NM_001267550.2(TTN):c.104005G>A (p.Asp34669Asn) rs1430662349
NM_001267550.2(TTN):c.104324G>A (p.Arg34775His)
NM_001267550.2(TTN):c.104414G>A (p.Arg34805Gln) rs115150240
NM_001267550.2(TTN):c.104448G>C (p.Glu34816Asp) rs1575243618
NM_001267550.2(TTN):c.104703G>C (p.Arg34901Ser) rs1575238986
NM_001267550.2(TTN):c.104774A>C (p.Glu34925Ala) rs201218828
NM_001267550.2(TTN):c.104978C>A (p.Thr34993Lys) rs368945564
NM_001267550.2(TTN):c.105064G>A (p.Glu35022Lys) rs727504977
NM_001267550.2(TTN):c.105134A>T (p.Asp35045Val) rs1001393566
NM_001267550.2(TTN):c.105203A>G (p.Lys35068Arg) rs1387560309
NM_001267550.2(TTN):c.105391A>G (p.Ile35131Val) rs779464128
NM_001267550.2(TTN):c.105424G>A (p.Glu35142Lys) rs765274398
NM_001267550.2(TTN):c.105429C>T (p.Gly35143=) rs368591364
NM_001267550.2(TTN):c.105491G>A (p.Arg35164His) rs768358201
NM_001267550.2(TTN):c.105707C>T (p.Ser35236Phe) rs1575223142
NM_001267550.2(TTN):c.106121T>A (p.Phe35374Tyr) rs727504609
NM_001267550.2(TTN):c.106376C>T (p.Ala35459Val) rs879170800
NM_001267550.2(TTN):c.106511G>C (p.Ser35504Thr) rs575070622
NM_001267550.2(TTN):c.106575_106576insGTAATTTCT (p.Ser35526_Glu35527insValIleSer) rs768256269
NM_001267550.2(TTN):c.106675G>C (p.Glu35559Gln) rs199632397
NM_001267550.2(TTN):c.106820C>T (p.Ala35607Val) rs377337528
NM_001267550.2(TTN):c.107056G>A (p.Val35686Ile) rs751581732
NM_001267550.2(TTN):c.107387A>C (p.Glu35796Ala) rs1553478042
NM_001267550.2(TTN):c.107576T>C (p.Met35859Thr) rs72629793
NM_001267550.2(TTN):c.107956A>G (p.Ile35986Val) rs1064797273
NM_001267550.2(TTN):c.11311+2601C>A rs1482705228
NM_001267550.2(TTN):c.11312-5447A>C rs560037336
NM_001267550.2(TTN):c.11567A>G (p.Asn3856Ser) rs765523683
NM_001267550.2(TTN):c.11672C>T (p.Thr3891Ile) rs148164929
NM_001267550.2(TTN):c.1168G>A (p.Gly390Ser) rs794729412
NM_001267550.2(TTN):c.11756C>A (p.Thr3919Asn) rs727503661
NM_001267550.2(TTN):c.11996A>G (p.Asn3999Ser) rs199844346
NM_001267550.2(TTN):c.12048G>A (p.Met4016Ile) rs528996964
NM_001267550.2(TTN):c.12145C>T (p.Pro4049Ser) rs201888760
NM_001267550.2(TTN):c.12181G>A (p.Ala4061Thr) rs397517829
NM_001267550.2(TTN):c.12195T>C (p.Leu4065=) rs201129413
NM_001267550.2(TTN):c.12234C>G (p.Thr4078=) rs192857526
NM_001267550.2(TTN):c.12364A>G (p.Lys4122Glu) rs1574085972
NM_001267550.2(TTN):c.12549A>C (p.Lys4183Asn) rs1574083204
NM_001267550.2(TTN):c.12593C>T (p.Thr4198Ile) rs1574082410
NM_001267550.2(TTN):c.12748G>A (p.Val4250Met) rs201437752
NM_001267550.2(TTN):c.12837T>C (p.Asp4279=) rs762681376
NM_001267550.2(TTN):c.13262A>G (p.Asn4421Ser) rs72648922
NM_001267550.2(TTN):c.13520T>C (p.Met4507Thr) rs191968963
NM_001267550.2(TTN):c.13702G>A (p.Glu4568Lys) rs757204949
NM_001267550.2(TTN):c.14089A>G (p.Arg4697Gly) rs1392705551
NM_001267550.2(TTN):c.14476_14508dup (p.Thr4826_Ser4836dup) rs1578232541
NM_001267550.2(TTN):c.14486A>C (p.Gln4829Pro) rs375177753
NM_001267550.2(TTN):c.14698G>A (p.Ala4900Thr) rs72648923
NM_001267550.2(TTN):c.14870C>G (p.Thr4957Ser) rs72648925
NM_001267550.2(TTN):c.14930T>G (p.Val4977Gly) rs1578225578
NM_001267550.2(TTN):c.14931C>T (p.Val4977=) rs1447072234
NM_001267550.2(TTN):c.15178G>C (p.Val5060Leu) rs72648929
NM_001267550.2(TTN):c.15496+1G>T rs397517481
NM_001267550.2(TTN):c.15499C>A (p.Pro5167Thr) rs1031284707
NM_001267550.2(TTN):c.15563A>C (p.Gln5188Pro) rs72648930
NM_001267550.2(TTN):c.15986G>A (p.Gly5329Asp) rs202234492
NM_001267550.2(TTN):c.16096G>A (p.Val5366Met) rs372176136
NM_001267550.2(TTN):c.16113T>C (p.Asn5371=) rs143845692
NM_001267550.2(TTN):c.16313A>G (p.Lys5438Arg) rs190636272
NM_001267550.2(TTN):c.16581C>T (p.Val5527=) rs373179717
NM_001267550.2(TTN):c.17048A>G (p.Tyr5683Cys) rs72648942
NM_001267550.2(TTN):c.17184A>G (p.Glu5728=) rs200984007
NM_001267550.2(TTN):c.17224C>T (p.Leu5742Phe) rs72648943
NM_001267550.2(TTN):c.17464C>T (p.Pro5822Ser)
NM_001267550.2(TTN):c.17843T>C (p.Ile5948Thr)
NM_001267550.2(TTN):c.17846G>A (p.Ser5949Asn) rs1578154475
NM_001267550.2(TTN):c.17871A>T (p.Gln5957His) rs181067357
NM_001267550.2(TTN):c.18068T>C (p.Val6023Ala) rs1037108046
NM_001267550.2(TTN):c.18407G>A (p.Arg6136Gln) rs117551279
NM_001267550.2(TTN):c.18542G>A (p.Arg6181Gln)
NM_001267550.2(TTN):c.18550G>A (p.Ala6184Thr) rs72648947
NM_001267550.2(TTN):c.18586A>G (p.Lys6196Glu) rs756791385
NM_001267550.2(TTN):c.18646G>A (p.Val6216Met) rs369242073
NM_001267550.2(TTN):c.18663A>C (p.Glu6221Asp) rs369544339
NM_001267550.2(TTN):c.18745G>A (p.Asp6249Asn) rs201263441
NM_001267550.2(TTN):c.18776C>G (p.Thr6259Ser) rs72648949
NM_001267550.2(TTN):c.19121G>A (p.Arg6374Lys) rs1578129064
NM_001267550.2(TTN):c.19150C>A (p.Pro6384Thr) rs72648953
NM_001267550.2(TTN):c.19190C>T (p.Thr6397Met) rs199564845
NM_001267550.2(TTN):c.19356C>T (p.Ser6452=) rs369275615
NM_001267550.2(TTN):c.19426+7A>G rs756760290
NM_001267550.2(TTN):c.20335A>T (p.Ser6779Cys) rs149470241
NM_001267550.2(TTN):c.20341G>A (p.Glu6781Lys) rs72648958
NM_001267550.2(TTN):c.20395C>T (p.Arg6799Trp) rs751534449
NM_001267550.2(TTN):c.20798G>C (p.Gly6933Ala) rs200118743
NM_001267550.2(TTN):c.21364G>A (p.Ala7122Thr) rs201394117
NM_001267550.2(TTN):c.21404-4A>G rs72648965
NM_001267550.2(TTN):c.21404-8C>G rs761542135
NM_001267550.2(TTN):c.21548G>A (p.Cys7183Tyr) rs189951108
NM_001267550.2(TTN):c.21557A>G (p.Tyr7186Cys) rs560240166
NM_001267550.2(TTN):c.21656C>T (p.Ser7219Phe) rs201029552
NM_001267550.2(TTN):c.21668G>A (p.Arg7223His) rs138853909
NM_001267550.2(TTN):c.21740T>C (p.Ile7247Thr) rs1578040309
NM_001267550.2(TTN):c.21981G>A (p.Thr7327=)
NM_001267550.2(TTN):c.22135A>C (p.Thr7379Pro) rs1578031917
NM_001267550.2(TTN):c.22266A>C (p.Ala7422=) rs1578027180
NM_001267550.2(TTN):c.22930C>T (p.Arg7644Ter)
NM_001267550.2(TTN):c.23455G>C (p.Glu7819Gln) rs201420077
NM_001267550.2(TTN):c.24156A>G (p.Thr8052=) rs749823104
NM_001267550.2(TTN):c.24157G>A (p.Gly8053Ser) rs374167223
NM_001267550.2(TTN):c.24443A>G (p.Tyr8148Cys) rs1236449802
NM_001267550.2(TTN):c.24820G>A (p.Glu8274Lys) rs72648981
NM_001267550.2(TTN):c.24952G>A (p.Val8318Ile) rs200103997
NM_001267550.2(TTN):c.24964G>T (p.Val8322Leu) rs201571580
NM_001267550.2(TTN):c.25640-8T>C rs1184501172
NM_001267550.2(TTN):c.25704G>A (p.Arg8568=) rs150544093
NM_001267550.2(TTN):c.26008C>G (p.Pro8670Ala) rs1577904664
NM_001267550.2(TTN):c.26305T>G (p.Trp8769Gly) rs779847107
NM_001267550.2(TTN):c.26494A>G (p.Ile8832Val) rs72648989
NM_001267550.2(TTN):c.26505G>T (p.Lys8835Asn) rs1577886254
NM_001267550.2(TTN):c.26643C>G (p.Phe8881Leu) rs982955034
NM_001267550.2(TTN):c.26672A>G (p.Asn8891Ser) rs146057575
NM_001267550.2(TTN):c.26684G>A (p.Ser8895Asn) rs752659193
NM_001267550.2(TTN):c.27223G>A (p.Glu9075Lys) rs1560584120
NM_001267550.2(TTN):c.28137A>G (p.Ile9379Met) rs1060500516
NM_001267550.2(TTN):c.28262C>T (p.Thr9421Met) rs375209383
NM_001267550.2(TTN):c.28507G>A (p.Val9503Ile) rs202160275
NM_001267550.2(TTN):c.28628C>T (p.Thr9543Ile) rs752853962
NM_001267550.2(TTN):c.28849G>A (p.Glu9617Lys) rs144025230
NM_001267550.2(TTN):c.28966G>A (p.Asp9656Asn) rs1064797277
NM_001267550.2(TTN):c.29127C>G (p.Val9709=) rs769063245
NM_001267550.2(TTN):c.29689A>G (p.Thr9897Ala) rs1051001950
NM_001267550.2(TTN):c.29944G>A (p.Ala9982Thr) rs200745162
NM_001267550.2(TTN):c.29977C>T (p.Arg9993Trp) rs375415014
NM_001267550.2(TTN):c.30220G>A (p.Glu10074Lys) rs794729402
NM_001267550.2(TTN):c.30485C>T (p.Thr10162Met) rs200593368
NM_001267550.2(TTN):c.30492G>T (p.Glu10164Asp) rs1064797276
NM_001267550.2(TTN):c.30608C>G (p.Pro10203Arg) rs1344215902
NM_001267550.2(TTN):c.30694G>C (p.Ala10232Pro) rs747294929
NM_001267550.2(TTN):c.30718G>T (p.Val10240Phe) rs111671438
NM_001267550.2(TTN):c.30803-4T>C rs1577563976
NM_001267550.2(TTN):c.31072G>A (p.Glu10358Lys) rs778628814
NM_001267550.2(TTN):c.31114G>C (p.Glu10372Gln) rs200831060
NM_001267550.2(TTN):c.31426+1G>T rs6749719
NM_001267550.2(TTN):c.31456A>T (p.Ile10486Phe) rs772882862
NM_001267550.2(TTN):c.31594G>A (p.Val10532Ile) rs763955552
NM_001267550.2(TTN):c.31757C>A (p.Pro10586Gln) rs200459347
NM_001267550.2(TTN):c.31762+5_31762+7del rs397517538
NM_001267550.2(TTN):c.31763-1G>A rs202234172
NM_001267550.2(TTN):c.31821G>T (p.Lys10607Asn) rs746722623
NM_001267550.2(TTN):c.31837C>G (p.Pro10613Ala) rs200213832
NM_001267550.2(TTN):c.31885A>G (p.Ile10629Val) rs753824961
NM_001267550.2(TTN):c.32539G>A (p.Val10847Met) rs973448572
NM_001267550.2(TTN):c.32554+5_32554+6del rs771419718
NM_001267550.2(TTN):c.32557C>T (p.Pro10853Ser) rs201738153
NM_001267550.2(TTN):c.32624C>T (p.Pro10875Leu) rs72650031
NM_001267550.2(TTN):c.32731G>A (p.Glu10911Lys) rs199620003
NM_001267550.2(TTN):c.32837A>T (p.Glu10946Val) rs763205133
NM_001267550.2(TTN):c.32970_32987del (p.10987_10989EEY[1]) rs766756026
NM_001267550.2(TTN):c.33059A>G (p.Tyr11020Cys) rs72650035
NM_001267550.2(TTN):c.33064C>T (p.Arg11022Ter)
NM_001267550.2(TTN):c.33164C>A (p.Pro11055Gln)
NM_001267550.2(TTN):c.33416G>C (p.Arg11139Thr) rs72650040
NM_001267550.2(TTN):c.33501_33503AGA[4] (p.Glu11172del) rs368327166
NM_001267550.2(TTN):c.33502_33503insGAG (p.Glu11168_Glu11169insGly) rs1577324835
NM_001267550.2(TTN):c.33666G>T (p.Val11222=) rs767867884
NM_001267550.2(TTN):c.33856G>A (p.Glu11286Lys) rs376874956
NM_001267550.2(TTN):c.33965C>T (p.Pro11322Leu) rs539800132
NM_001267550.2(TTN):c.34098_34118GGAAGAGGAAGTTCTACCTGA[1] (p.11363_11369VLPEEEE[3]) rs397517548
NM_001267550.2(TTN):c.34098_34118GGAAGAGGAAGTTCTACCTGA[3] (p.11363_11369VLPEEEE[5]) rs397517548
NM_001267550.2(TTN):c.34119G>A (p.Glu11373=) rs548399416
NM_001267550.2(TTN):c.34140A>G (p.Glu11380=) rs147418835
NM_001267550.2(TTN):c.34283C>T (p.Pro11428Leu) rs1577290900
NM_001267550.2(TTN):c.34408A>G (p.Lys11470Glu) rs113942943
NM_001267550.2(TTN):c.34474C>A (p.Pro11492Thr) rs182428755
NM_001267550.2(TTN):c.34636C>A (p.Pro11546Thr) rs376366803
NM_001267550.2(TTN):c.34845C>T (p.Pro11615=) rs368781863
NM_001267550.2(TTN):c.35350C>T (p.Arg11784Cys) rs778615023
NM_001267550.2(TTN):c.35387C>A (p.Ala11796Glu) rs200321949
NM_001267550.2(TTN):c.35554G>A (p.Ala11852Thr) rs1350016572
NM_001267550.2(TTN):c.35875+8T>G rs192408585
NM_001267550.2(TTN):c.36144C>A (p.Val12048=) rs879247400
NM_001267550.2(TTN):c.36267_36280+16del rs745871962
NM_001267550.2(TTN):c.36281-8C>A rs752208578
NM_001267550.2(TTN):c.36405G>A (p.Val12135=) rs373815877
NM_001267550.2(TTN):c.36509A>T (p.Glu12170Val) rs200840285
NM_001267550.2(TTN):c.36949G>A (p.Ala12317Thr) rs1405466072
NM_001267550.2(TTN):c.37408G>T (p.Val12470Leu) rs398124448
NM_001267550.2(TTN):c.37525G>A (p.Glu12509Lys) rs201797790
NM_001267550.2(TTN):c.37583C>T (p.Ala12528Val) rs1288395279
NM_001267550.2(TTN):c.37873G>A (p.Val12625Met) rs1336768417
NM_001267550.2(TTN):c.37876C>A (p.Pro12626Thr) rs762460746
NM_001267550.2(TTN):c.38181C>T (p.Pro12727=) rs1378163913
NM_001267550.2(TTN):c.38311A>G (p.Lys12771Glu) rs551811137
NM_001267550.2(TTN):c.38336T>C (p.Val12779Ala) rs2099130
NM_001267550.2(TTN):c.38506G>A (p.Val12836Met) rs779238709
NM_001267550.2(TTN):c.39104A>C (p.Lys13035Thr)
NM_001267550.2(TTN):c.39211+6C>T rs187365142
NM_001267550.2(TTN):c.39277G>A (p.Glu13093Lys)
NM_001267550.2(TTN):c.39300C>G (p.Phe13100Leu) rs569579388
NM_001267550.2(TTN):c.39463+2T>C rs1576956162
NM_001267550.2(TTN):c.39464-3T>C rs1228301728
NM_001267550.2(TTN):c.39466C>A (p.Pro13156Thr) rs72650064
NM_001267550.2(TTN):c.39625+1G>T
NM_001267550.2(TTN):c.40408+8del rs727504922
NM_001267550.2(TTN):c.40498G>T (p.Val13500Phe) rs201944202
NM_001267550.2(TTN):c.40780G>A (p.Glu13594Lys) rs1183604013
NM_001267550.2(TTN):c.40915G>C (p.Gly13639Arg) rs1343417772
NM_001267550.2(TTN):c.41006C>T (p.Pro13669Leu) rs1164930705
NM_001267550.2(TTN):c.41144C>A (p.Ala13715Glu)
NM_001267550.2(TTN):c.41330-7T>A rs373636988
NM_001267550.2(TTN):c.41521G>A (p.Asp13841Asn) rs201257644
NM_001267550.2(TTN):c.42023C>T (p.Pro14008Leu) rs751709914
NM_001267550.2(TTN):c.42484G>C (p.Val14162Leu) rs1576712276
NM_001267550.2(TTN):c.42687C>T (p.Ala14229=) rs775889693
NM_001267550.2(TTN):c.43185C>A (p.Ala14395=) rs1057519234
NM_001267550.2(TTN):c.43326A>G (p.Lys14442=) rs878977270
NM_001267550.2(TTN):c.43478A>G (p.Glu14493Gly) rs1316766072
NM_001267550.2(TTN):c.43507C>T (p.Leu14503Phe) rs1576686860
NM_001267550.2(TTN):c.43963T>C (p.Tyr14655His)
NM_001267550.2(TTN):c.44035C>A (p.Arg14679=) rs776970935
NM_001267550.2(TTN):c.44409_44411del (p.Glu14804del) rs1559930666
NM_001267550.2(TTN):c.44418C>T (p.Ser14806=) rs368005198
NM_001267550.2(TTN):c.45980G>A (p.Arg15327His) rs374697274
NM_001267550.2(TTN):c.46265A>G (p.Lys15422Arg) rs1576543824
NM_001267550.2(TTN):c.46409G>A (p.Arg15470His) rs769044716
NM_001267550.2(TTN):c.46441G>A (p.Glu15481Lys) rs1576538146
NM_001267550.2(TTN):c.46451G>A (p.Arg15484Lys) rs72677229
NM_001267550.2(TTN):c.46702C>T (p.Pro15568Ser) rs561728671
NM_001267550.2(TTN):c.47077G>A (p.Val15693Ile) rs201717871
NM_001267550.2(TTN):c.47191C>T (p.Arg15731Cys) rs72677231
NM_001267550.2(TTN):c.47248G>A (p.Val15750Ile) rs72677232
NM_001267550.2(TTN):c.47315G>A (p.Arg15772Gln) rs72677233
NM_001267550.2(TTN):c.47507A>G (p.Gln15836Arg) rs1309017744
NM_001267550.2(TTN):c.47513G>A (p.Arg15838Gln) rs199640194
NM_001267550.2(TTN):c.47572+6C>G
NM_001267550.2(TTN):c.47759A>G (p.Lys15920Arg) rs1223537376
NM_001267550.2(TTN):c.47794T>C (p.Tyr15932His) rs780464378
NM_001267550.2(TTN):c.47936C>T (p.Pro15979Leu) rs184815126
NM_001267550.2(TTN):c.48008T>C (p.Leu16003Pro) rs1576494100
NM_001267550.2(TTN):c.48395G>A (p.Arg16132His) rs397517593
NM_001267550.2(TTN):c.48727C>T (p.Pro16243Ser) rs72677242
NM_001267550.2(TTN):c.48751G>A (p.Asp16251Asn) rs199954570
NM_001267550.2(TTN):c.49162G>A (p.Val16388Met)
NM_001267550.2(TTN):c.49413G>T (p.Trp16471Cys) rs202094100
NM_001267550.2(TTN):c.49757A>T (p.Tyr16586Phe) rs1576439970
NM_001267550.2(TTN):c.50714G>A (p.Arg16905His) rs191539637
NM_001267550.2(TTN):c.50858-3C>T rs587782987
NM_001267550.2(TTN):c.50925T>C (p.Pro16975=) rs1576415390
NM_001267550.2(TTN):c.50944C>T (p.Pro16982Ser) rs1178993608
NM_001267550.2(TTN):c.51617C>A (p.Thr17206Asn) rs1305177155
NM_001267550.2(TTN):c.51668G>A (p.Arg17223Gln) rs142395261
NM_001267550.2(TTN):c.51683C>T (p.Ala17228Val) rs370644359
NM_001267550.2(TTN):c.51809G>T (p.Ser17270Ile) rs200650668
NM_001267550.2(TTN):c.51896C>T (p.Pro17299Leu) rs369648778
NM_001267550.2(TTN):c.52139A>T (p.Asp17380Val) rs373305248
NM_001267550.2(TTN):c.52543C>T (p.His17515Tyr) rs1576373600
NM_001267550.2(TTN):c.52706C>A (p.Ser17569Tyr) rs756689649
NM_001267550.2(TTN):c.52852C>T (p.Arg17618Cys) rs201213901
NM_001267550.2(TTN):c.52853G>A (p.Arg17618His) rs371538664
NM_001267550.2(TTN):c.52973C>T (p.Thr17658Ile) rs1576367047
NM_001267550.2(TTN):c.53096G>A (p.Arg17699His) rs72646808
NM_001267550.2(TTN):c.53122A>G (p.Lys17708Glu) rs185913848
NM_001267550.2(TTN):c.54053A>T (p.Lys18018Met) rs368425364
NM_001267550.2(TTN):c.54104C>T (p.Ala18035Val) rs182445366
NM_001267550.2(TTN):c.54160G>C (p.Val18054Leu) rs200968679
NM_001267550.2(TTN):c.54401A>G (p.Asn18134Ser) rs971483896
NM_001267550.2(TTN):c.55046T>G (p.Val18349Gly) rs772880269
NM_001267550.2(TTN):c.55139T>C (p.Ile18380Thr) rs72646819
NM_001267550.2(TTN):c.55374C>G (p.Ser18458Arg) rs200550947
NM_001267550.2(TTN):c.55426G>C (p.Val18476Leu) rs780649835
NM_001267550.2(TTN):c.55553A>G (p.Lys18518Arg) rs72646823
NM_001267550.2(TTN):c.55661G>A (p.Arg18554Gln) rs202126861
NM_001267550.2(TTN):c.55673G>A (p.Arg18558His) rs115867512
NM_001267550.2(TTN):c.55745C>T (p.Pro18582Leu) rs201194435
NM_001267550.2(TTN):c.55925T>A (p.Leu18642Gln) rs140714512
NM_001267550.2(TTN):c.55973G>A (p.Arg18658Gln) rs370888932
NM_001267550.2(TTN):c.56255C>T (p.Pro18752Leu) rs200132226
NM_001267550.2(TTN):c.56383G>C (p.Glu18795Gln) rs1576248690
NM_001267550.2(TTN):c.56535G>A (p.Thr18845=) rs529480368
NM_001267550.2(TTN):c.56854G>C (p.Gly18952Arg) rs766126662
NM_001267550.2(TTN):c.57092G>A (p.Gly19031Glu) rs1064797275
NM_001267550.2(TTN):c.57212T>C (p.Ile19071Thr) rs200001206
NM_001267550.2(TTN):c.57232A>G (p.Thr19078Ala) rs727503593
NM_001267550.2(TTN):c.57442A>G (p.Met19148Val) rs188185141
NM_001267550.2(TTN):c.57578C>G (p.Ala19193Gly) rs1576186111
NM_001267550.2(TTN):c.57646A>G (p.Ile19216Val) rs374058726
NM_001267550.2(TTN):c.57746T>C (p.Ile19249Thr)
NM_001267550.2(TTN):c.57826C>T (p.Leu19276Phe) rs756493505
NM_001267550.2(TTN):c.58069T>C (p.Tyr19357His) rs1576161852
NM_001267550.2(TTN):c.58419A>G (p.Gln19473=) rs186563991
NM_001267550.2(TTN):c.58732+6C>T rs778350235
NM_001267550.2(TTN):c.59092G>T (p.Asp19698Tyr) rs397517642
NM_001267550.2(TTN):c.59318A>G (p.Glu19773Gly) rs371719028
NM_001267550.2(TTN):c.59418T>C (p.Leu19806=) rs1576125620
NM_001267550.2(TTN):c.59943C>G (p.Pro19981=) rs202017608
NM_001267550.2(TTN):c.60128G>T (p.Gly20043Val) rs1576110000
NM_001267550.2(TTN):c.60175G>C (p.Gly20059Arg) rs778467153
NM_001267550.2(TTN):c.60364G>A (p.Asp20122Asn) rs776191153
NM_001267550.2(TTN):c.60472G>A (p.Gly20158Ser) rs375009570
NM_001267550.2(TTN):c.60721G>C (p.Glu20241Gln) rs200212521
NM_001267550.2(TTN):c.60815C>T (p.Pro20272Leu) rs760277470
NM_001267550.2(TTN):c.60928C>T (p.Arg20310Cys) rs200898955
NM_001267550.2(TTN):c.61549T>A (p.Leu20517Met) rs1576082826
NM_001267550.2(TTN):c.61922G>A (p.Arg20641Gln) rs199895260
NM_001267550.2(TTN):c.62468G>A (p.Arg20823His) rs758019778
NM_001267550.2(TTN):c.62572A>G (p.Thr20858Ala) rs200689750
NM_001267550.2(TTN):c.62681G>T (p.Cys20894Phe) rs370080086
NM_001267550.2(TTN):c.62723G>A (p.Arg20908Gln) rs377203669
NM_001267550.2(TTN):c.63109C>T (p.Arg21037Cys) rs191549948
NM_001267550.2(TTN):c.63178G>C (p.Asp21060His) rs1576054413
NM_001267550.2(TTN):c.63329C>T (p.Ala21110Val) rs370687831
NM_001267550.2(TTN):c.63352C>T (p.Arg21118Trp) rs200726948
NM_001267550.2(TTN):c.63439G>A (p.Ala21147Thr) rs72646853
NM_001267550.2(TTN):c.63577C>T (p.Arg21193Cys) rs376800688
NM_001267550.2(TTN):c.63589A>G (p.Ile21197Val) rs72646855
NM_001267550.2(TTN):c.63626G>A (p.Arg21209Gln) rs148684589
NM_001267550.2(TTN):c.63888C>A (p.Ser21296Arg) rs750950584
NM_001267550.2(TTN):c.64174C>T (p.Arg21392Cys) rs72646859
NM_001267550.2(TTN):c.64652A>T (p.Lys21551Ile) rs1575987523
NM_001267550.2(TTN):c.64675G>A (p.Ala21559Thr) rs1182073050
NM_001267550.2(TTN):c.64814G>A (p.Gly21605Asp) rs1553632971
NM_001267550.2(TTN):c.64884G>C (p.Gln21628His) rs772347925
NM_001267550.2(TTN):c.65144G>A (p.Arg21715Gln) rs368450785
NM_001267550.2(TTN):c.65287A>G (p.Lys21763Glu)
NM_001267550.2(TTN):c.65459C>T (p.Thr21820Ile) rs56130023
NM_001267550.2(TTN):c.65534C>T (p.Pro21845Leu) rs201662134
NM_001267550.2(TTN):c.65937G>A (p.Pro21979=) rs765734959
NM_001267550.2(TTN):c.66187G>C (p.Val22063Leu) rs768057735
NM_001267550.2(TTN):c.66295G>T (p.Ala22099Ser) rs1575927891
NM_001267550.2(TTN):c.66391A>G (p.Thr22131Ala) rs140842479
NM_001267550.2(TTN):c.66550G>A (p.Gly22184Ser) rs1262240030
NM_001267550.2(TTN):c.66590G>A (p.Arg22197Gln) rs374656017
NM_001267550.2(TTN):c.66815T>C (p.Ile22272Thr) rs773998250
NM_001267550.2(TTN):c.67099T>C (p.Ser22367Pro) rs72646873
NM_001267550.2(TTN):c.67146C>T (p.Gly22382=) rs770418172
NM_001267550.2(TTN):c.67262G>A (p.Gly22421Glu) rs1575882357
NM_001267550.2(TTN):c.67706G>A (p.Arg22569Gln) rs185620750
NM_001267550.2(TTN):c.68082C>T (p.Cys22694=) rs79406408
NM_001267550.2(TTN):c.68083G>A (p.Ala22695Thr) rs767279296
NM_001267550.2(TTN):c.68165A>G (p.Asn22722Ser) rs200493270
NM_001267550.2(TTN):c.68298C>A (p.Asp22766Glu) rs534340303
NM_001267550.2(TTN):c.68437G>A (p.Glu22813Lys) rs200797552
NM_001267550.2(TTN):c.68629A>G (p.Ile22877Val) rs879104670
NM_001267550.2(TTN):c.68824G>A (p.Glu22942Lys) rs199506676
NM_001267550.2(TTN):c.68864G>C (p.Gly22955Ala) rs201381085
NM_001267550.2(TTN):c.68904C>T (p.Ala22968=) rs927987931
NM_001267550.2(TTN):c.69029C>A (p.Ala23010Asp) rs1575830557
NM_001267550.2(TTN):c.69821G>A (p.Gly23274Asp) rs201043950
NM_001267550.2(TTN):c.70013G>A (p.Arg23338Gln) rs78916558
NM_001267550.2(TTN):c.70102A>G (p.Ile23368Val) rs367914610
NM_001267550.2(TTN):c.70179T>G (p.Asn23393Lys) rs1040909022
NM_001267550.2(TTN):c.70181C>T (p.Thr23394Met) rs397517683
NM_001267550.2(TTN):c.70677T>C (p.Asp23559=) rs72646890
NM_001267550.2(TTN):c.70906C>G (p.Arg23636Gly) rs189208539
NM_001267550.2(TTN):c.70982C>T (p.Pro23661Leu) rs1060500459
NM_001267550.2(TTN):c.71036G>A (p.Arg23679Lys) rs200144345
NM_001267550.2(TTN):c.71075A>G (p.Asn23692Ser) rs1575796679
NM_001267550.2(TTN):c.71161A>G (p.Ile23721Val)
NM_001267550.2(TTN):c.71234C>T (p.Thr23745Ile) rs767956788
NM_001267550.2(TTN):c.71307T>G (p.Thr23769=) rs1575793682
NM_001267550.2(TTN):c.71426T>C (p.Val23809Ala) rs1575791772
NM_001267550.2(TTN):c.71452A>G (p.Ile23818Val) rs776911847
NM_001267550.2(TTN):c.71537G>A (p.Ser23846Asn) rs760506346
NM_001267550.2(TTN):c.71704A>G (p.Ile23902Val) rs1160675688
NM_001267550.2(TTN):c.71705T>C (p.Ile23902Thr) rs55837610
NM_001267550.2(TTN):c.71882_71884del (p.Val23961del) rs1575785560
NM_001267550.2(TTN):c.71944A>G (p.Asn23982Asp) rs199755820
NM_001267550.2(TTN):c.72146T>C (p.Leu24049Pro) rs56399205
NM_001267550.2(TTN):c.72231A>G (p.Glu24077=) rs1423712037
NM_001267550.2(TTN):c.72317A>C (p.Asn24106Thr) rs1386956312
NM_001267550.2(TTN):c.72379G>A (p.Glu24127Lys) rs149763294
NM_001267550.2(TTN):c.72766A>G (p.Asn24256Asp) rs187868672
NM_001267550.2(TTN):c.72772A>G (p.Ile24258Val) rs763561377
NM_001267550.2(TTN):c.72785G>A (p.Arg24262His) rs372390659
NM_001267550.2(TTN):c.73604C>A (p.Ser24535Tyr) rs201804005
NM_001267550.2(TTN):c.73705G>C (p.Val24569Leu) rs755676676
NM_001267550.2(TTN):c.73825G>C (p.Glu24609Gln) rs55762754
NM_001267550.2(TTN):c.74468C>T (p.Ala24823Val) rs368071644
NM_001267550.2(TTN):c.74597_74599CAA[1] (p.Thr24867del) rs543318580
NM_001267550.2(TTN):c.74602A>G (p.Ile24868Val) rs72646898
NM_001267550.2(TTN):c.75034C>T (p.Arg25012Trp) rs368914555
NM_001267550.2(TTN):c.75099C>T (p.Asp25033=) rs370272814
NM_001267550.2(TTN):c.75497C>T (p.Ala25166Val) rs753641145
NM_001267550.2(TTN):c.75527G>A (p.Arg25176His) rs375693396
NM_001267550.2(TTN):c.75703A>C (p.Ser25235Arg) rs372834784
NM_001267550.2(TTN):c.76085T>G (p.Leu25362Trp) rs1575729215
NM_001267550.2(TTN):c.76483G>A (p.Val25495Ile) rs773127796
NM_001267550.2(TTN):c.76778T>A (p.Phe25593Tyr) rs547186080
NM_001267550.2(TTN):c.77205G>A (p.Val25735=) rs55857909
NM_001267550.2(TTN):c.77412C>G (p.Phe25804Leu)
NM_001267550.2(TTN):c.77716G>A (p.Glu25906Lys) rs56341835
NM_001267550.2(TTN):c.77813G>C (p.Trp25938Ser) rs186681106
NM_001267550.2(TTN):c.78719G>A (p.Cys26240Tyr) rs1575695077
NM_001267550.2(TTN):c.78742A>C (p.Lys26248Gln)
NM_001267550.2(TTN):c.78892G>A (p.Gly26298Arg) rs72648205
NM_001267550.2(TTN):c.79073T>C (p.Val26358Ala) rs1575691219
NM_001267550.2(TTN):c.79226G>A (p.Arg26409His) rs72648206
NM_001267550.2(TTN):c.79344G>T (p.Val26448=) rs369875680
NM_001267550.2(TTN):c.79538A>G (p.Tyr26513Cys) rs1575685631
NM_001267550.2(TTN):c.79863G>A (p.Thr26621=) rs186402008
NM_001267550.2(TTN):c.80167C>T (p.Arg26723Cys)
NM_001267550.2(TTN):c.80541A>G (p.Gln26847=) rs1575673279
NM_001267550.2(TTN):c.80586C>T (p.Ser26862=) rs748292845
NM_001267550.2(TTN):c.80666A>G (p.Tyr26889Cys) rs571328201
NM_001267550.2(TTN):c.80707G>A (p.Val26903Ile) rs1559341049
NM_001267550.2(TTN):c.80722A>C (p.Arg26908=) rs573877174
NM_001267550.2(TTN):c.81029T>C (p.Val27010Ala)
NM_001267550.2(TTN):c.81407G>C (p.Gly27136Ala) rs879200560
NM_001267550.2(TTN):c.81464T>C (p.Ile27155Thr) rs397517720
NM_001267550.2(TTN):c.81539T>C (p.Ile27180Thr) rs182126530
NM_001267550.2(TTN):c.81558T>C (p.Asn27186=) rs56181243
NM_001267550.2(TTN):c.81826T>C (p.Ser27276Pro) rs1575657783
NM_001267550.2(TTN):c.81869G>C (p.Gly27290Ala) rs200240728
NM_001267550.2(TTN):c.81892G>A (p.Asp27298Asn) rs200697681
NM_001267550.2(TTN):c.81899G>A (p.Arg27300His) rs55850344
NM_001267550.2(TTN):c.82300C>T (p.Leu27434Phe) rs777655678
NM_001267550.2(TTN):c.82402A>C (p.Lys27468Gln) rs201958805
NM_001267550.2(TTN):c.82489G>A (p.Gly27497Arg) rs201158906
NM_001267550.2(TTN):c.82561A>G (p.Lys27521Glu) rs1060500417
NM_001267550.2(TTN):c.82583G>A (p.Arg27528Gln) rs765230578
NM_001267550.2(TTN):c.82691C>T (p.Ala27564Val) rs55634791
NM_001267550.2(TTN):c.82810G>A (p.Gly27604Ser) rs199929362
NM_001267550.2(TTN):c.82825G>C (p.Val27609Leu) rs767367789
NM_001267550.2(TTN):c.82919C>G (p.Thr27640Ser) rs1553571185
NM_001267550.2(TTN):c.82934G>A (p.Arg27645His) rs766522109
NM_001267550.2(TTN):c.82964G>A (p.Gly27655Asp) rs373745130
NM_001267550.2(TTN):c.83171T>G (p.Val27724Gly) rs201896662
NM_001267550.2(TTN):c.83516G>A (p.Arg27839Gln) rs376820301
NM_001267550.2(TTN):c.83545G>C (p.Gly27849Arg)
NM_001267550.2(TTN):c.83600C>G (p.Pro27867Arg)
NM_001267550.2(TTN):c.83618T>C (p.Val27873Ala) rs200775919
NM_001267550.2(TTN):c.83870G>C (p.Arg27957Thr) rs148067743
NM_001267550.2(TTN):c.84263G>A (p.Ser28088Asn) rs200450022
NM_001267550.2(TTN):c.84640A>G (p.Met28214Val) rs72648221
NM_001267550.2(TTN):c.84681T>C (p.Tyr28227=) rs373268234
NM_001267550.2(TTN):c.84871C>T (p.Arg28291Cys) rs192152102
NM_001267550.2(TTN):c.84872G>A (p.Arg28291His) rs774924903
NM_001267550.2(TTN):c.84965G>A (p.Arg28322His) rs373532064
NM_001267550.2(TTN):c.84976C>T (p.Arg28326Trp) rs749633038
NM_001267550.2(TTN):c.85406C>G (p.Ser28469Cys) rs202040332
NM_001267550.2(TTN):c.85746A>C (p.Ile28582=) rs771116739
NM_001267550.2(TTN):c.85976A>C (p.Lys28659Thr) rs200724395
NM_001267550.2(TTN):c.86055A>T (p.Gly28685=) rs1575609289
NM_001267550.2(TTN):c.86458T>G (p.Ser28820Ala)
NM_001267550.2(TTN):c.86471C>T (p.Thr28824Ile) rs200709344
NM_001267550.2(TTN):c.86729_86731AAG[1] (p.Glu28911del) rs727504797
NM_001267550.2(TTN):c.86867_86868del (p.Lys28956fs) rs1575594208
NM_001267550.2(TTN):c.86949A>G (p.Glu28983=) rs375565646
NM_001267550.2(TTN):c.87412C>A (p.Pro29138Thr) rs72648227
NM_001267550.2(TTN):c.87623A>T (p.Tyr29208Phe) rs201831707
NM_001267550.2(TTN):c.87707-4G>T rs201770959
NM_001267550.2(TTN):c.88037A>T (p.Asp29346Val) rs374741129
NM_001267550.2(TTN):c.88354T>C (p.Tyr29452His) rs763288364
NM_001267550.2(TTN):c.88394C>T (p.Ser29465Phe) rs146181116
NM_001267550.2(TTN):c.88459G>A (p.Val29487Met) rs200899806
NM_001267550.2(TTN):c.88478C>T (p.Thr29493Met) rs955762474
NM_001267550.2(TTN):c.88721G>A (p.Arg29574His) rs111727915
NM_001267550.2(TTN):c.89314G>A (p.Glu29772Lys) rs200503016
NM_001267550.2(TTN):c.89386G>A (p.Val29796Met) rs72648237
NM_001267550.2(TTN):c.89426G>A (p.Arg29809Gln) rs72648238
NM_001267550.2(TTN):c.89457A>G (p.Gly29819=) rs1553542686
NM_001267550.2(TTN):c.89710C>T (p.Arg29904Cys) rs1222259013
NM_001267550.2(TTN):c.89742A>G (p.Ile29914Met) rs1230340692
NM_001267550.2(TTN):c.89946C>T (p.Val29982=) rs373311459
NM_001267550.2(TTN):c.90758_90760GAG[2] (p.Gly30255del) rs748912340
NM_001267550.2(TTN):c.90863A>C (p.Asn30288Thr) rs763525672
NM_001267550.2(TTN):c.91601A>T (p.Asp30534Val) rs182549226
NM_001267550.2(TTN):c.91643C>T (p.Ala30548Val) rs553668520
NM_001267550.2(TTN):c.91712T>C (p.Met30571Thr)
NM_001267550.2(TTN):c.91732G>A (p.Val30578Ile) rs727504672
NM_001267550.2(TTN):c.91840G>C (p.Val30614Leu) rs781781702
NM_001267550.2(TTN):c.92455G>A (p.Val30819Ile) rs368511235
NM_001267550.2(TTN):c.92488G>A (p.Val30830Ile) rs376287060
NM_001267550.2(TTN):c.92554G>A (p.Glu30852Lys) rs772252611
NM_001267550.2(TTN):c.92595A>C (p.Leu30865Phe) rs192086736
NM_001267550.2(TTN):c.92684G>A (p.Arg30895Gln) rs200141081
NM_001267550.2(TTN):c.92696T>C (p.Ile30899Thr) rs373727636
NM_001267550.2(TTN):c.92699A>G (p.Asn30900Ser) rs186234393
NM_001267550.2(TTN):c.92780T>A (p.Ile30927Lys) rs531432790
NM_001267550.2(TTN):c.93005G>T (p.Ser31002Ile) rs180975448
NM_001267550.2(TTN):c.93133G>A (p.Gly31045Ser) rs1575474097
NM_001267550.2(TTN):c.93162G>C (p.Glu31054Asp) rs1553530758
NM_001267550.2(TTN):c.93524G>A (p.Arg31175His) rs72648251
NM_001267550.2(TTN):c.93616A>C (p.Ile31206Leu)
NM_001267550.2(TTN):c.93803A>C (p.Lys31268Thr) rs200766837
NM_001267550.2(TTN):c.93968C>T (p.Ala31323Val) rs200345129
NM_001267550.2(TTN):c.94553T>C (p.Val31518Ala) rs377016580
NM_001267550.2(TTN):c.94813T>A (p.Cys31605Ser) rs1308471692
NM_001267550.2(TTN):c.94817G>A (p.Arg31606Gln) rs371840978
NM_001267550.2(TTN):c.94846C>T (p.Leu31616=) rs72648255
NM_001267550.2(TTN):c.94851T>A (p.Asp31617Glu) rs72648256
NM_001267550.2(TTN):c.95242C>T (p.Arg31748Cys) rs142525903
NM_001267550.2(TTN):c.95270T>C (p.Ile31757Thr) rs72648259
NM_001267550.2(TTN):c.95653G>A (p.Ala31885Thr) rs72648263
NM_001267550.2(TTN):c.95962G>A (p.Val31988Met) rs756469423
NM_001267550.2(TTN):c.96011A>G (p.Glu32004Gly) rs1553519065
NM_001267550.2(TTN):c.96017T>C (p.Val32006Ala) rs966964393
NM_001267550.2(TTN):c.96140C>T (p.Thr32047Met) rs375640847
NM_001267550.2(TTN):c.96172C>T (p.Arg32058Trp) rs201463708
NM_001267550.2(TTN):c.96212T>G (p.Ile32071Arg) rs755545981
NM_001267550.2(TTN):c.96434G>A (p.Arg32145His) rs759948951
NM_001267550.2(TTN):c.96684C>T (p.Tyr32228=) rs368423941
NM_001267550.2(TTN):c.97067A>C (p.Glu32356Ala)
NM_001267550.2(TTN):c.97099C>T (p.Arg32367Cys) rs202064385
NM_001267550.2(TTN):c.97282G>A (p.Gly32428Ser)
NM_001267550.2(TTN):c.97442G>A (p.Gly32481Glu) rs201364164
NM_001267550.2(TTN):c.97538G>A (p.Arg32513His) rs201080904
NM_001267550.2(TTN):c.97547T>C (p.Met32516Thr) rs557550837
NM_001267550.2(TTN):c.97568C>G (p.Pro32523Arg) rs1406600321
NM_001267550.2(TTN):c.97612C>T (p.Arg32538Cys) rs761050391
NM_001267550.2(TTN):c.97760G>A (p.Arg32587His) rs55704830
NM_001267550.2(TTN):c.97888T>G (p.Ser32630Ala) rs1553512070
NM_001267550.2(TTN):c.98022C>T (p.Arg32674=) rs372825562
NM_001267550.2(TTN):c.98294C>G (p.Ala32765Gly) rs72648273
NM_001267550.2(TTN):c.98431C>T (p.Arg32811Cys) rs371807358
NM_001267550.2(TTN):c.98458C>T (p.Pro32820Ser) rs769919302
NM_001267550.2(TTN):c.98591T>C (p.Val32864Ala) rs201257063
NM_001267550.2(TTN):c.98716G>A (p.Val32906Ile) rs182683829
NM_001267550.2(TTN):c.98726T>C (p.Val32909Ala) rs368877793
NM_001267550.2(TTN):c.98857A>G (p.Thr32953Ala) rs1179770836
NM_001267550.2(TTN):c.98861C>T (p.Thr32954Ile) rs372126622
NM_001267550.2(TTN):c.98989+1G>C rs112240298
NM_001267550.2(TTN):c.99016G>A (p.Glu33006Lys) rs201931674
NM_001267550.2(TTN):c.99518G>A (p.Cys33173Tyr) rs761362832
NM_001267550.2(TTN):c.99781C>T (p.Arg33261Cys) rs1064797274
NM_001267550.2(TTN):c.99901G>A (p.Glu33301Lys) rs72648278
NM_001267550.2(TTN):c.99922G>A (p.Ala33308Thr) rs201226974
NM_001267550.2(TTN):c.99991T>C (p.Cys33331Arg) rs56061641
NM_001267550.2(TTN):c.99996G>A (p.Glu33332=) rs754693509
NM_133379.5(TTN):c.10115-4G>A rs367648529
NM_133379.5(TTN):c.10188A>G (p.Glu3396=) rs183336802
NM_133379.5(TTN):c.10190A>C (p.Asp3397Ala) rs759238193
NM_133379.5(TTN):c.10303+1146T>G rs753854385
NM_133379.5(TTN):c.10303+1353A>T rs755931621
NM_133379.5(TTN):c.10303+1418G>C rs774004409
NM_133379.5(TTN):c.10303+2220A>G rs769513424
NM_133379.5(TTN):c.10303+2278G>C rs377401997
NM_133379.5(TTN):c.10303+2430T>C rs141027782
NM_133379.5(TTN):c.10303+2450T>A rs1574371295
NM_133379.5(TTN):c.10303+2583C>A rs767415803
NM_133379.5(TTN):c.1050C>T (p.Tyr350=) rs375448572
NM_133379.5(TTN):c.1054G>A (p.Ala352Thr) rs113324330
NM_133379.5(TTN):c.10733A>G (p.Tyr3578Cys) rs200420921
NM_133379.5(TTN):c.10844G>A (p.Arg3615Gln) rs747054427
NM_133379.5(TTN):c.10912A>T (p.Thr3638Ser) rs201304715
NM_133379.5(TTN):c.1099T>C (p.Ser367Pro)
NM_133379.5(TTN):c.11087A>G (p.Lys3696Arg) rs541028933
NM_133379.5(TTN):c.11474G>A (p.Gly3825Asp) rs1424099730
NM_133379.5(TTN):c.1176_1184dup (p.390_392GAA[3]) rs1574927808
NM_133379.5(TTN):c.11809A>C (p.Lys3937Gln) rs562658562
NM_133379.5(TTN):c.11849T>C (p.Ile3950Thr) rs72647897
NM_133379.5(TTN):c.1197G>A (p.Ser399=) rs573255254
NM_133379.5(TTN):c.12332C>T (p.Thr4111Ile) rs370317019
NM_133379.5(TTN):c.12524C>A (p.Ser4175Tyr) rs72647899
NM_133379.5(TTN):c.12716C>T (p.Ala4239Val) rs72647901
NM_133379.5(TTN):c.13123G>T (p.Ala4375Ser) rs72647902
NM_133379.5(TTN):c.13364A>G (p.Lys4455Arg) rs142304137
NM_133379.5(TTN):c.13564G>T (p.Glu4522Ter) rs753350460
NM_133379.5(TTN):c.13586C>G (p.Ala4529Gly) rs138927584
NM_133379.5(TTN):c.13619A>T (p.His4540Leu) rs111233204
NM_133379.5(TTN):c.13948C>T (p.Pro4650Ser) rs149748934
NM_133379.5(TTN):c.1399-3C>T rs397517486
NM_133379.5(TTN):c.14078T>C (p.Ile4693Thr) rs139486133
NM_133379.5(TTN):c.14139C>T (p.Asp4713=) rs371388583
NM_133379.5(TTN):c.14791C>T (p.Gln4931Ter)
NM_133379.5(TTN):c.14806A>T (p.Thr4936Ser) rs72648909
NM_133379.5(TTN):c.15130G>A (p.Glu5044Lys) rs201766148
NM_133379.5(TTN):c.15268G>A (p.Glu5090Lys) rs759923770
NM_133379.5(TTN):c.15302A>G (p.Glu5101Gly) rs142973956
NM_133379.5(TTN):c.15575G>A (p.Arg5192Lys) rs62179016
NM_133379.5(TTN):c.15653G>T (p.Arg5218Leu) rs727505032
NM_133379.5(TTN):c.156C>T (p.Pro52=) rs72647842
NM_133379.5(TTN):c.15768T>A (p.His5256Gln) rs138826545
NM_133379.5(TTN):c.1585G>A (p.Ala529Thr) rs143030869
NM_133379.5(TTN):c.15874A>G (p.Met5292Val) rs113170119
NM_133379.5(TTN):c.16016A>G (p.Asp5339Gly) rs372997814
NM_133379.5(TTN):c.16046T>G (p.Val5349Gly) rs755000326
NM_133379.5(TTN):c.16160G>A (p.Cys5387Tyr) rs72648913
NM_133379.5(TTN):c.16228G>A (p.Glu5410Lys) rs1044034258
NM_133379.5(TTN):c.16282G>A (p.Val5428Met) rs199565262
NM_133379.5(TTN):c.16328T>C (p.Val5443Ala) rs145183384
NM_133379.5(TTN):c.16531G>T (p.Glu5511Ter) rs794729307
NM_133379.5(TTN):c.16555G>A (p.Gly5519Ser)
NM_133379.5(TTN):c.177C>A (p.Ser59Arg) rs191057824
NM_133379.5(TTN):c.1943G>C (p.Arg648Thr) rs550441902
NM_133379.5(TTN):c.204C>T (p.Pro68=) rs201089861
NM_133379.5(TTN):c.2054A>G (p.Gln685Arg) rs1574856979
NM_133379.5(TTN):c.2230G>A (p.Ala744Thr) rs144639994
NM_133379.5(TTN):c.2306T>C (p.Ile769Thr) rs979110143
NM_133379.5(TTN):c.2605A>T (p.Thr869Ser) rs370962244
NM_133379.5(TTN):c.266C>G (p.Ala89Gly) rs200165636
NM_133379.5(TTN):c.2686G>A (p.Val896Ile) rs376768790
NM_133379.5(TTN):c.2743C>T (p.Arg915Cys) rs539652641
NM_133379.5(TTN):c.3100G>A (p.Val1034Met) rs142951505
NM_133379.5(TTN):c.3325C>T (p.Pro1109Ser) rs375285782
NM_133379.5(TTN):c.3409G>C (p.Gly1137Arg) rs72647870
NM_133379.5(TTN):c.394A>C (p.Thr132Pro) rs1337018303
NM_133379.5(TTN):c.5264A>G (p.Asn1755Ser) rs201904897
NM_133379.5(TTN):c.543C>T (p.Ser181=) rs758598014
NM_133379.5(TTN):c.5441A>G (p.Gln1814Arg) rs1574658288
NM_133379.5(TTN):c.5645G>A (p.Arg1882His) rs374605213
NM_133379.5(TTN):c.5813T>C (p.Val1938Ala) rs781196395
NM_133379.5(TTN):c.5993G>A (p.Arg1998His) rs144135510
NM_133379.5(TTN):c.656C>T (p.Thr219Ile) rs926062512
NM_133379.5(TTN):c.6584A>G (p.Glu2195Gly) rs202032875
NM_133379.5(TTN):c.661A>T (p.Ile221Phe) rs1574982564
NM_133379.5(TTN):c.6639G>T (p.Glu2213Asp) rs745719077
NM_133379.5(TTN):c.670-2A>G rs1574980606
NM_133379.5(TTN):c.6866T>G (p.Ile2289Ser) rs200440412
NM_133379.5(TTN):c.7271A>G (p.Asn2424Ser) rs927165447
NM_133379.5(TTN):c.7316G>A (p.Arg2439His) rs142129359
NM_133379.5(TTN):c.7330+5G>A rs869025547
NM_133379.5(TTN):c.7523A>G (p.His2508Arg) rs146970027
NM_133379.5(TTN):c.7619G>A (p.Arg2540His) rs397517725
NM_133379.5(TTN):c.7817C>T (p.Ala2606Val) rs370857722
NM_133379.5(TTN):c.8292G>A (p.Leu2764=) rs727503687
NM_133379.5(TTN):c.835C>T (p.Arg279Trp) rs138060032
NM_133379.5(TTN):c.8641A>C (p.Thr2881Pro) rs546667760
NM_133379.5(TTN):c.8993C>G (p.Ser2998Cys)
NM_133379.5(TTN):c.910G>A (p.Val304Ile) rs753009359
NM_133379.5(TTN):c.9139T>A (p.Ser3047Thr) rs946142615
NM_133379.5(TTN):c.9167G>A (p.Arg3056His) rs547301978
NM_133379.5(TTN):c.9305+4A>G rs746628782
NM_133379.5(TTN):c.9576A>G (p.Glu3192=) rs771979221

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.