ClinVar Miner

List of variants in gene USH1C studied for Usher syndrome, type 1

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 6
Download table as spreadsheet
HGVS dbSNP
NM_001297764.1(USH1C):c.92G>A (p.Arg31Gln) rs776511246
NM_005709.3(USH1C):c.216G>A (p.Val72=) rs151045328
NM_005709.3(USH1C):c.238dupC (p.Arg80Profs) rs397515359
NM_153676.3(USH1C):c.308G>A (p.Arg103His) rs397514500
NM_153676.3(USH1C):c.496+59_479-35GAGCAGGGCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGG[7]GAGCAGGTCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGG[2] rs55983148
NP_005700.2(USH1C):p.Arg357Trp

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.