ClinVar Miner

List of variants in gene USH1C studied for Usher syndrome, type 1C

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 137
Download table as spreadsheet
HGVS dbSNP
NM_005709.3(USH1C):c.238dupC (p.Arg80Profs) rs397515359
NM_153676.4(USH1C):c.*110C>G
NM_153676.4(USH1C):c.*117C>G
NM_153676.4(USH1C):c.*131G>C
NM_153676.4(USH1C):c.*140C>T rs886048058
NM_153676.4(USH1C):c.*186C>T rs1055577
NM_153676.4(USH1C):c.*211A>G rs1055581
NM_153676.4(USH1C):c.*241C>G
NM_153676.4(USH1C):c.*376A>C rs886048057
NM_153676.4(USH1C):c.*405C>G rs11827649
NM_153676.4(USH1C):c.*427T>C
NM_153676.4(USH1C):c.*42C>T rs16934270
NM_153676.4(USH1C):c.*46T>C rs1055574
NM_153676.4(USH1C):c.*95C>T rs552838747
NM_153676.4(USH1C):c.-109A>T
NM_153676.4(USH1C):c.-60T>C rs371444878
NM_153676.4(USH1C):c.-60T>G
NM_153676.4(USH1C):c.-71T>G rs571065113
NM_153676.4(USH1C):c.101A>G (p.His34Arg) rs75157409
NM_153676.4(USH1C):c.1020-2A>C rs147956944
NM_153676.4(USH1C):c.1039C>T (p.Gln347Ter) rs762551629
NM_153676.4(USH1C):c.105-4A>G rs201374986
NM_153676.4(USH1C):c.1064G>T (p.Arg355Ile)
NM_153676.4(USH1C):c.1085+7A>G
NM_153676.4(USH1C):c.1086-12G>A rs11024318
NM_153676.4(USH1C):c.1086-13G>T rs200490320
NM_153676.4(USH1C):c.1101A>G (p.Glu367=) rs764975771
NM_153676.4(USH1C):c.1136G>A (p.Gly379Asp) rs202174251
NM_153676.4(USH1C):c.114C>T (p.Asp38=) rs137962152
NM_153676.4(USH1C):c.1183C>T (p.His395Tyr)
NM_153676.4(USH1C):c.1188A>G (p.Pro396=) rs2240487
NM_153676.4(USH1C):c.1211-1106G>A
NM_153676.4(USH1C):c.1211-1129G>A rs35188020
NM_153676.4(USH1C):c.1211-1134G>A rs115931035
NM_153676.4(USH1C):c.1211-1140G>A
NM_153676.4(USH1C):c.1211-1152G>A rs116996553
NM_153676.4(USH1C):c.1211-1175G>A rs143923730
NM_153676.4(USH1C):c.1211-1175G>C
NM_153676.4(USH1C):c.1211-1177G>T
NM_153676.4(USH1C):c.127G>A (p.Val43Met) rs145500807
NM_153676.4(USH1C):c.135C>T (p.Asp45=) rs140319839
NM_153676.4(USH1C):c.164G>A (p.Arg55His) rs1042393529
NM_153676.4(USH1C):c.1822C>T (p.Pro608Ser) rs727505247
NM_153676.4(USH1C):c.1823C>G (p.Pro608Arg) rs41282932
NM_153676.4(USH1C):c.186T>C (p.Ile62=) rs200239508
NM_153676.4(USH1C):c.192G>A (p.Pro64=) rs1040470628
NM_153676.4(USH1C):c.200C>T (p.Pro67Leu)
NM_153676.4(USH1C):c.2167C>T (p.Gln723Ter) rs146451547
NM_153676.4(USH1C):c.216G>A (p.Val72=) rs151045328
NM_153676.4(USH1C):c.2191C>T (p.Arg731Trp) rs397517874
NM_153676.4(USH1C):c.2192G>A (p.Arg731Gln) rs371626423
NM_153676.4(USH1C):c.2226+12C>T rs17703528
NM_153676.4(USH1C):c.2227-1G>A rs778110397
NM_153676.4(USH1C):c.2240A>G (p.Gln747Arg) rs201600193
NM_153676.4(USH1C):c.2253G>A (p.Lys751=)
NM_153676.4(USH1C):c.225T>C (p.Asp75=) rs111033279
NM_153676.4(USH1C):c.2260C>T (p.Arg754Trp)
NM_153676.4(USH1C):c.2265C>G (p.Leu755=) rs151251262
NM_153676.4(USH1C):c.2270G>A (p.Arg757His)
NM_153676.4(USH1C):c.2280+15G>A rs886048059
NM_153676.4(USH1C):c.2281G>A (p.Glu761Lys)
NM_153676.4(USH1C):c.2321C>T (p.Ser774Phe)
NM_153676.4(USH1C):c.2327T>A (p.Ile776Asn)
NM_153676.4(USH1C):c.2340C>T (p.Val780=) rs10832796
NM_153676.4(USH1C):c.2341G>A (p.Val781Ile) rs397517875
NM_153676.4(USH1C):c.2362G>A (p.Gly788Arg)
NM_153676.4(USH1C):c.2374C>A (p.Arg792=) rs200428926
NM_153676.4(USH1C):c.2374C>T (p.Arg792Trp)
NM_153676.4(USH1C):c.2378A>G (p.His793Arg) rs868121889
NM_153676.4(USH1C):c.2381-10C>T rs765925104
NM_153676.4(USH1C):c.2410G>A (p.Ala804Thr) rs150593932
NM_153676.4(USH1C):c.2419G>A (p.Gly807Ser) rs142652588
NM_153676.4(USH1C):c.241C>T (p.Arg81Cys) rs876658111
NM_153676.4(USH1C):c.2437T>G (p.Tyr813Asp)
NM_153676.4(USH1C):c.2441C>A (p.Thr814Asn) rs397517877
NM_153676.4(USH1C):c.2457G>C (p.Glu819Asp) rs1064074
NM_153676.4(USH1C):c.2487C>T (p.Gly829=) rs142801489
NM_153676.4(USH1C):c.2490+12G>C rs2072232
NM_153676.4(USH1C):c.2490+6A>C
NM_153676.4(USH1C):c.2499C>T (p.Ile833=) rs34581703
NM_153676.4(USH1C):c.2541T>C (p.Asp847=)
NM_153676.4(USH1C):c.266G>A (p.Arg89His) rs749647539
NM_153676.4(USH1C):c.294C>T (p.Leu98=) rs34055234
NM_153676.4(USH1C):c.308G>A (p.Arg103His) rs397514500
NM_153676.4(USH1C):c.324T>C (p.Phe108=) rs549758189
NM_153676.4(USH1C):c.341T>C (p.Ile114Thr)
NM_153676.4(USH1C):c.36+1G>T rs1403777293
NM_153676.4(USH1C):c.360C>T (p.Gly120=) rs140869579
NM_153676.4(USH1C):c.381G>T (p.Gly127=) rs41282942
NM_153676.4(USH1C):c.388G>A (p.Val130Ile) rs55843567
NM_153676.4(USH1C):c.403G>A (p.Val135Ile) rs145013633
NM_153676.4(USH1C):c.405C>G (p.Val135=)
NM_153676.4(USH1C):c.406C>T (p.Arg136Trp) rs368903400
NM_153676.4(USH1C):c.412A>G (p.Asn138Asp)
NM_153676.4(USH1C):c.442G>A (p.Glu148Lys)
NM_153676.4(USH1C):c.463C>T (p.Arg155Ter) rs377145777
NM_153676.4(USH1C):c.464G>C (p.Arg155Pro) rs142730611
NM_153676.4(USH1C):c.496+1G>A rs138138689
NM_153676.4(USH1C):c.496+21GCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGGGAGCAGG[9] rs55983148
NM_153676.4(USH1C):c.496C>T (p.His166Tyr) rs367996370
NM_153676.4(USH1C):c.497-2del rs1480243085
NM_153676.4(USH1C):c.497-4G>A rs397517881
NM_153676.4(USH1C):c.501C>T (p.Ile167=)
NM_153676.4(USH1C):c.513C>T (p.Pro171=) rs199739341
NM_153676.4(USH1C):c.514G>T (p.Val172Leu)
NM_153676.4(USH1C):c.540C>T (p.Leu180=) rs145510974
NM_153676.4(USH1C):c.567G>T (p.Val189=)
NM_153676.4(USH1C):c.569C>G (p.Ser190Trp)
NM_153676.4(USH1C):c.570G>A (p.Ser190=) rs756709989
NM_153676.4(USH1C):c.600C>T (p.Gly200=)
NM_153676.4(USH1C):c.634G>A (p.Val212Ile) rs886048060
NM_153676.4(USH1C):c.648G>A (p.Leu216=) rs77137413
NM_153676.4(USH1C):c.651A>G (p.Val217=) rs75977878
NM_153676.4(USH1C):c.669C>A (p.Gly223=) rs144761543
NM_153676.4(USH1C):c.66G>A (p.Glu22=) rs768165881
NM_153676.4(USH1C):c.674+4G>A rs202095395
NM_153676.4(USH1C):c.684C>T (p.Ser228=) rs149172005
NM_153676.4(USH1C):c.759+10G>T rs368528034
NM_153676.4(USH1C):c.776T>G (p.Val259Gly)
NM_153676.4(USH1C):c.789C>G (p.Gly263=) rs376197674
NM_153676.4(USH1C):c.790G>A (p.Val264Ile) rs79875849
NM_153676.4(USH1C):c.7C>T (p.Arg3Ter) rs876657624
NM_153676.4(USH1C):c.819+10G>C rs41282936
NM_153676.4(USH1C):c.845G>A (p.Arg282His) rs779111365
NM_153676.4(USH1C):c.851T>A (p.Leu284Gln) rs756485601
NM_153676.4(USH1C):c.864T>G (p.Ile288Met)
NM_153676.4(USH1C):c.875C>G (p.Ala292Gly)
NM_153676.4(USH1C):c.880C>T (p.Arg294Trp) rs555152976
NM_153676.4(USH1C):c.881G>A (p.Arg294Gln) rs773481791
NM_153676.4(USH1C):c.883G>A (p.Glu295Lys) rs200127622
NM_153676.4(USH1C):c.91C>T (p.Arg31Ter) rs121908370
NM_153676.4(USH1C):c.921G>A (p.Ala307=) rs778447994
NM_153676.4(USH1C):c.923G>A (p.Arg308Gln)
NM_153676.4(USH1C):c.946G>C (p.Glu316Gln) rs35336155
NM_153676.4(USH1C):c.965G>A (p.Arg322Gln) rs140424216
USH1C, 1-BP DEL, 1220G
USH1C, IVS5DS, G-A, +1

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.