ClinVar Miner

List of variants in gene USH1C

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 324
Download table as spreadsheet
HGVS dbSNP
NC_000011.10:g.17494423G>A
NC_000011.10:g.17495647G>T
NC_000011.10:g.17509365G>T
NC_000011.10:g.17509369G>A
NC_000011.10:g.17509602G>A
NC_000011.10:g.17509666G>A
NC_000011.10:g.17510555C>T
NC_000011.10:g.17527190C=
NC_000011.10:g.17533367G>C
NC_000011.10:g.17533369C>A
NC_000011.10:g.17544490A>C
NM_005709.3(USH1C):c.1284+5351delG rs1554957912
NM_005709.3(USH1C):c.1284+6880delG rs745622612
NM_005709.3(USH1C):c.1284+6881_1284+6882ins14 rs781176348
NM_005709.3(USH1C):c.1285-7433_1285-7432delCA rs766725582
NM_005709.3(USH1C):c.1285-7549delC rs1554956916
NM_005709.3(USH1C):c.1285-7583delC rs765346539
NM_005709.3(USH1C):c.1590+1delG rs1366154374
NM_005709.3(USH1C):c.238dupC (p.Arg80Profs) rs397515359
NM_005709.3(USH1C):c.674+1delG rs1554961872
NM_005709.4(USH1C):c.1020-7G>A rs1554960567
NM_005709.4(USH1C):c.1039C>T (p.Gln347Ter) rs762551629
NM_005709.4(USH1C):c.1146dup (p.Gln383fs) rs1554960388
NM_005709.4(USH1C):c.1199G>A (p.Arg400His) rs750721690
NM_005709.4(USH1C):c.1326+2T>C rs1554954858
NM_005709.4(USH1C):c.1365C>T (p.Leu455=) rs151251262
NM_005709.4(USH1C):c.1426dup (p.Ile476fs) rs758555088
NM_005709.4(USH1C):c.1480+1G>C rs1060499916
NM_005709.4(USH1C):c.1491G>A (p.Val497=) rs375973884
NM_005709.4(USH1C):c.1628dup (p.Glu544fs) rs1554953360
NM_005709.4(USH1C):c.513C>T (p.Pro171=) rs199739341
NM_005709.4(USH1C):c.701C>T (p.Pro234Leu) rs1554961433
NM_005709.4(USH1C):c.841_848del (p.Ser281fs) rs1064797153
NM_153676.3(USH1C):c.1806dup (p.Ile603Hisfs) rs765346539
NM_153676.3(USH1C):c.496+33A>G rs12795083
NM_153676.3(USH1C):c.496+59_479-35GAGCAGGGCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGG[7]GAGCAGGTCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGG[2] rs55983148
NM_153676.4(USH1C):c.*140C>T rs886048058
NM_153676.4(USH1C):c.*186C>T rs1055577
NM_153676.4(USH1C):c.*211A>G rs1055581
NM_153676.4(USH1C):c.*376A>C rs886048057
NM_153676.4(USH1C):c.*405C>G rs11827649
NM_153676.4(USH1C):c.*419_*420insAACA rs10626485
NM_153676.4(USH1C):c.*42C>T rs16934270
NM_153676.4(USH1C):c.*46T>C rs1055574
NM_153676.4(USH1C):c.*95C>T rs552838747
NM_153676.4(USH1C):c.-15G>C rs1554965975
NM_153676.4(USH1C):c.-60T>C rs371444878
NM_153676.4(USH1C):c.-71T>G rs571065113
NM_153676.4(USH1C):c.1013A>C (p.Glu338Ala) rs876658109
NM_153676.4(USH1C):c.1016G>A (p.Arg339Gln) rs765571023
NM_153676.4(USH1C):c.1019+52G>A
NM_153676.4(USH1C):c.101A>G (p.His34Arg) rs75157409
NM_153676.4(USH1C):c.1020-2A>C rs147956944
NM_153676.4(USH1C):c.104+1G>A rs1287021691
NM_153676.4(USH1C):c.105-16C>T rs2041027
NM_153676.4(USH1C):c.105-4A>G rs201374986
NM_153676.4(USH1C):c.105G>C (p.Gln35His)
NM_153676.4(USH1C):c.1069C>T (p.Arg357Trp) rs140934960
NM_153676.4(USH1C):c.1085+21C>G rs2240488
NM_153676.4(USH1C):c.1086-108A>G
NM_153676.4(USH1C):c.1086-12G>A rs11024318
NM_153676.4(USH1C):c.1086-13G>T rs200490320
NM_153676.4(USH1C):c.1086-42G>A
NM_153676.4(USH1C):c.1086-45A>G
NM_153676.4(USH1C):c.1134G>A (p.Trp378Ter)
NM_153676.4(USH1C):c.1136G>A (p.Gly379Asp) rs202174251
NM_153676.4(USH1C):c.1139del (p.Gly379_Ser380insTer) rs1554960390
NM_153676.4(USH1C):c.114C>T (p.Asp38=) rs137962152
NM_153676.4(USH1C):c.1188A>G (p.Pro396=) rs2240487
NM_153676.4(USH1C):c.1210+5G>A rs372285784
NM_153676.4(USH1C):c.1211-1107C>T rs727504667
NM_153676.4(USH1C):c.1211-1125G>T
NM_153676.4(USH1C):c.1211-1129G>A rs35188020
NM_153676.4(USH1C):c.1211-1134G>A rs115931035
NM_153676.4(USH1C):c.1211-1152G>A rs116996553
NM_153676.4(USH1C):c.1211-1175G>A rs143923730
NM_153676.4(USH1C):c.1211-1175del rs1207247951
NM_153676.4(USH1C):c.1211-1188G>A rs199972595
NM_153676.4(USH1C):c.1211-1418G>A
NM_153676.4(USH1C):c.1216G>T (p.Gly406Ter) rs1554959148
NM_153676.4(USH1C):c.1233C>T (p.Tyr411=) rs377439949
NM_153676.4(USH1C):c.1234G>A (p.Asp412Asn) rs727503712
NM_153676.4(USH1C):c.1260+7C>T rs978889964
NM_153676.4(USH1C):c.1261-34C>T
NM_153676.4(USH1C):c.127G>A (p.Val43Met) rs145500807
NM_153676.4(USH1C):c.1290T>G (p.Tyr430Ter) rs1406224812
NM_153676.4(USH1C):c.1292G>T (p.Gly431Val) rs751388655
NM_153676.4(USH1C):c.1351_1356AAAGAG[1] (p.451_452KE[1]) rs1554957867
NM_153676.4(USH1C):c.1363G>T (p.Glu455Ter) rs148115969
NM_153676.4(USH1C):c.1413+13C>T rs876657623
NM_153676.4(USH1C):c.1413+2T>C rs1344670523
NM_153676.4(USH1C):c.1414-2_1414-1insCTG rs769675063
NM_153676.4(USH1C):c.1414-34G>A rs2237964
NM_153676.4(USH1C):c.1430G>A (p.Arg477Gln) rs146333270
NM_153676.4(USH1C):c.1449G>A (p.Ser483=) rs142669563
NM_153676.4(USH1C):c.1476G>T (p.Arg492Ser) rs765918184
NM_153676.4(USH1C):c.1512T>C (p.Ala504=) rs886043309
NM_153676.4(USH1C):c.1516A>G (p.Asn506Asp) rs868001349
NM_153676.4(USH1C):c.152A>G (p.Asn51Ser) rs775363189
NM_153676.4(USH1C):c.1531-11A>G rs397517872
NM_153676.4(USH1C):c.1531-64C>A
NM_153676.4(USH1C):c.1531A>C (p.Met511Leu) rs886044610
NM_153676.4(USH1C):c.1543_1551CCCCCGCCT[3] (p.Pro518_Pro520dup) rs777764626
NM_153676.4(USH1C):c.1548G>A (p.Pro516=) rs780428813
NM_153676.4(USH1C):c.1548G>C (p.Pro516=) rs780428813
NM_153676.4(USH1C):c.1556C>T (p.Pro519Leu) rs778703128
NM_153676.4(USH1C):c.1559dup (p.Ser521fs) rs1554957167
NM_153676.4(USH1C):c.1570C>T (p.Pro524Ser)
NM_153676.4(USH1C):c.1574T>C (p.Leu525Pro) rs727504790
NM_153676.4(USH1C):c.1576G>A (p.Ala526Thr) rs727503711
NM_153676.4(USH1C):c.1597G>A (p.Ala533Thr) rs201104489
NM_153676.4(USH1C):c.1632C>T (p.Asp544=) rs142545736
NM_153676.4(USH1C):c.164G>A (p.Arg55His) rs1042393529
NM_153676.4(USH1C):c.1654_1660del (p.Tyr552fs) rs758580540
NM_153676.4(USH1C):c.1678G>C (p.Ala560Pro) rs367952604
NM_153676.4(USH1C):c.1699C>T (p.Pro567Ser) rs549628785
NM_153676.4(USH1C):c.1712_1716dup (p.Pro573fs) rs1554957020
NM_153676.4(USH1C):c.1731G>A (p.Pro577=) rs199572804
NM_153676.4(USH1C):c.1739_1744del (p.Pro580_Val581del) rs1175090344
NM_153676.4(USH1C):c.1740T>C (p.Pro580=) rs200085788
NM_153676.4(USH1C):c.1770C>T (p.Ala590=) rs17776775
NM_153676.4(USH1C):c.1792C>T (p.Arg598Cys) rs111033520
NM_153676.4(USH1C):c.1801C>A (p.Pro601Thr) rs727503710
NM_153676.4(USH1C):c.1807dup (p.Ile603fs) rs1554956941
NM_153676.4(USH1C):c.1822C>T (p.Pro608Ser) rs727505247
NM_153676.4(USH1C):c.1823C>G (p.Pro608Arg) rs41282932
NM_153676.4(USH1C):c.1824G>C (p.Pro608=) rs201101932
NM_153676.4(USH1C):c.1824del (p.Pro609fs) rs1389725640
NM_153676.4(USH1C):c.1840C>T (p.Gln614Ter) rs1554956913
NM_153676.4(USH1C):c.1858C>T (p.Arg620Cys)
NM_153676.4(USH1C):c.1859G>T (p.Arg620Leu) rs139996942
NM_153676.4(USH1C):c.186T>C (p.Ile62=) rs200239508
NM_153676.4(USH1C):c.1871C>A (p.Ser624Ter) rs778700091
NM_153676.4(USH1C):c.1872G>A (p.Ser624=) rs80124409
NM_153676.4(USH1C):c.1874C>T (p.Ala625Val) rs727505187
NM_153676.4(USH1C):c.187C>T (p.Arg63Trp) rs375741564
NM_153676.4(USH1C):c.1889T>C (p.Leu630Pro) rs377002861
NM_153676.4(USH1C):c.188G>A (p.Arg63Gln) rs372497947
NM_153676.4(USH1C):c.1906C>T (p.Arg636Cys) rs149510892
NM_153676.4(USH1C):c.1907G>A (p.Arg636His) rs138017852
NM_153676.4(USH1C):c.1942G>A (p.Glu648Lys) rs368729447
NM_153676.4(USH1C):c.1A>G (p.Met1Val) rs1554965967
NM_153676.4(USH1C):c.2006_2010del (p.Thr669fs) rs1554956821
NM_153676.4(USH1C):c.2013+5T>C rs371038786
NM_153676.4(USH1C):c.2014-1G>A rs150567427
NM_153676.4(USH1C):c.2041C>T (p.Arg681Ter) rs369369849
NM_153676.4(USH1C):c.2046C>T (p.Gly682=) rs1554955894
NM_153676.4(USH1C):c.2047C>T (p.Pro683Ser) rs397517873
NM_153676.4(USH1C):c.2089G>T (p.Glu697Ter) rs139116036
NM_153676.4(USH1C):c.2112A>G (p.Pro704=) rs199532754
NM_153676.4(USH1C):c.2124T>C (p.Ser708=) rs369021714
NM_153676.4(USH1C):c.2134-12T>C rs76769358
NM_153676.4(USH1C):c.2138A>G (p.Gln713Arg) rs1554955501
NM_153676.4(USH1C):c.2167C>T (p.Gln723Ter) rs146451547
NM_153676.4(USH1C):c.216G>A (p.Val72=) rs151045328
NM_153676.4(USH1C):c.2184+10T>C rs200889109
NM_153676.4(USH1C):c.2184+12C>T rs138547759
NM_153676.4(USH1C):c.2184+229C>T
NM_153676.4(USH1C):c.2185-2A>G rs1358056232
NM_153676.4(USH1C):c.2191C>T (p.Arg731Trp) rs397517874
NM_153676.4(USH1C):c.2192G>A (p.Arg731Gln) rs371626423
NM_153676.4(USH1C):c.2194A>G (p.Lys732Glu) rs148168494
NM_153676.4(USH1C):c.2226+12C>T rs17703528
NM_153676.4(USH1C):c.2226+197G>A
NM_153676.4(USH1C):c.2227-1G>T rs778110397
NM_153676.4(USH1C):c.2240A>G (p.Gln747Arg) rs201600193
NM_153676.4(USH1C):c.225T>C (p.Asp75=) rs111033279
NM_153676.4(USH1C):c.2265C>G (p.Leu755=) rs151251262
NM_153676.4(USH1C):c.2280+15G>A rs886048059
NM_153676.4(USH1C):c.2280+29C>T
NM_153676.4(USH1C):c.2280+2T>C rs1554954681
NM_153676.4(USH1C):c.2280+6del rs776356060
NM_153676.4(USH1C):c.2281-113A>G
NM_153676.4(USH1C):c.2281-1G>A rs1554954574
NM_153676.4(USH1C):c.2281-2A>G rs921755529
NM_153676.4(USH1C):c.2288C>T (p.Ser763Phe) rs140313023
NM_153676.4(USH1C):c.2302C>A (p.Leu768Met) rs876658110
NM_153676.4(USH1C):c.2311G>A (p.Gly771Ser) rs727505083
NM_153676.4(USH1C):c.2340C>T (p.Val780=) rs10832796
NM_153676.4(USH1C):c.2341G>A (p.Val781Ile) rs397517875
NM_153676.4(USH1C):c.2347G>T (p.Ala783Ser) rs34077456
NM_153676.4(USH1C):c.2350_2351GT[1] (p.Val784_Tyr785insTer)
NM_153676.4(USH1C):c.2378A>G (p.His793Arg) rs868121889
NM_153676.4(USH1C):c.2381-2A>G rs1465352266
NM_153676.4(USH1C):c.2381-46G>A rs2072233
NM_153676.4(USH1C):c.238C>G (p.Arg80Gly) rs774005703
NM_153676.4(USH1C):c.2410G>A (p.Ala804Thr) rs150593932
NM_153676.4(USH1C):c.2418C>A (p.Asn806Lys) rs397517876
NM_153676.4(USH1C):c.2418C>T (p.Asn806=) rs397517876
NM_153676.4(USH1C):c.2419G>A (p.Gly807Ser) rs142652588
NM_153676.4(USH1C):c.241C>T (p.Arg81Cys) rs876658111
NM_153676.4(USH1C):c.2431_2451del (p.Thr811_Glu817del) rs779253356
NM_153676.4(USH1C):c.2441C>A (p.Thr814Asn) rs397517877
NM_153676.4(USH1C):c.2443C>T (p.Leu815=) rs148477093
NM_153676.4(USH1C):c.2457G>C (p.Glu819Asp) rs1064074
NM_153676.4(USH1C):c.2458G>A (p.Ala820Thr) rs397517878
NM_153676.4(USH1C):c.245C>G (p.Ser82Cys) rs769021971
NM_153676.4(USH1C):c.248+1G>A rs1482487617
NM_153676.4(USH1C):c.248+7_248+20del rs749047869
NM_153676.4(USH1C):c.2487C>T (p.Gly829=) rs142801489
NM_153676.4(USH1C):c.2488G>A (p.Gly830Arg) rs142751309
NM_153676.4(USH1C):c.2490+12G>C rs2072232
NM_153676.4(USH1C):c.2490+1G>T rs1554953746
NM_153676.4(USH1C):c.2490+2T>C rs1554953745
NM_153676.4(USH1C):c.2491-165C>A
NM_153676.4(USH1C):c.2491-1G>T rs1565017125
NM_153676.4(USH1C):c.2499C>T (p.Ile833=) rs34581703
NM_153676.4(USH1C):c.2538C>T (p.Asp846=) rs143860238
NM_153676.4(USH1C):c.2546+1G>T rs1554953350
NM_153676.4(USH1C):c.2547-11T>C rs10832795
NM_153676.4(USH1C):c.2547-159_2547-158del
NM_153676.4(USH1C):c.2547-183C>G
NM_153676.4(USH1C):c.2547-1G>T rs571304936
NM_153676.4(USH1C):c.2547-8A>G rs78509055
NM_153676.4(USH1C):c.2551T>G (p.Ser851Ala) rs200779709
NM_153676.4(USH1C):c.2568A>G (p.Val856=) rs1385487954
NM_153676.4(USH1C):c.2579C>T (p.Pro860Leu) rs876658112
NM_153676.4(USH1C):c.2590C>T (p.Arg864Ter) rs767767573
NM_153676.4(USH1C):c.2591G>A (p.Arg864Gln) rs374696855
NM_153676.4(USH1C):c.2611G>A (p.Ala871Thr) rs56165709
NM_153676.4(USH1C):c.2616C>T (p.Ala872=) rs141591891
NM_153676.4(USH1C):c.2617G>A (p.Val873Met) rs201533059
NM_153676.4(USH1C):c.2630G>A (p.Gly877Glu) rs371856107
NM_153676.4(USH1C):c.264G>A (p.Val88=) rs397517879
NM_153676.4(USH1C):c.2655+12G>A rs727504552
NM_153676.4(USH1C):c.2656-106T>C
NM_153676.4(USH1C):c.2656-1G>A rs747133793
NM_153676.4(USH1C):c.2656-260A>G
NM_153676.4(USH1C):c.2656-47C>T rs2072225
NM_153676.4(USH1C):c.2661_2663TCT[1] (p.Leu889del) rs1474458620
NM_153676.4(USH1C):c.266G>A (p.Arg89His) rs749647539
NM_153676.4(USH1C):c.2681del (p.Gly894fs) rs1554952757
NM_153676.4(USH1C):c.2688_2695dup (p.Arg899fs) rs1554952752
NM_153676.4(USH1C):c.2695C>G (p.Arg899Gly) rs757572697
NM_153676.4(USH1C):c.275G>A (p.Arg92His) rs147954324
NM_153676.4(USH1C):c.294C>T (p.Leu98=) rs34055234
NM_153676.4(USH1C):c.307C>T (p.Arg103Cys) rs397517880
NM_153676.4(USH1C):c.308G>A (p.Arg103His) rs397514500
NM_153676.4(USH1C):c.311G>A (p.Gly104Asp) rs1317951509
NM_153676.4(USH1C):c.36+214C>T
NM_153676.4(USH1C):c.360C>T (p.Gly120=) rs140869579
NM_153676.4(USH1C):c.37-243A>G
NM_153676.4(USH1C):c.37-45C>G rs2240489
NM_153676.4(USH1C):c.37-47G>T rs2355022
NM_153676.4(USH1C):c.37-61A>G
NM_153676.4(USH1C):c.379G>A (p.Gly127Arg) rs768207716
NM_153676.4(USH1C):c.381G>T (p.Gly127=) rs41282942
NM_153676.4(USH1C):c.387+17C>T rs78718533
NM_153676.4(USH1C):c.388-8T>A rs777486804
NM_153676.4(USH1C):c.388G>A (p.Val130Ile) rs55843567
NM_153676.4(USH1C):c.403G>A (p.Val135Ile) rs145013633
NM_153676.4(USH1C):c.406C>T (p.Arg136Trp) rs368903400
NM_153676.4(USH1C):c.440A>G (p.His147Arg) rs777591673
NM_153676.4(USH1C):c.445G>A (p.Glu149Lys) rs1565058763
NM_153676.4(USH1C):c.463C>T (p.Arg155Ter) rs377145777
NM_153676.4(USH1C):c.464G>C (p.Arg155Pro) rs142730611
NM_153676.4(USH1C):c.496+13A>G rs111033277
NM_153676.4(USH1C):c.496+1G>A rs138138689
NM_153676.4(USH1C):c.496+1G>T rs138138689
NM_153676.4(USH1C):c.496+21G>T rs111033278
NM_153676.4(USH1C):c.496+66G>T
NM_153676.4(USH1C):c.496C>T (p.His166Tyr) rs367996370
NM_153676.4(USH1C):c.497-3C>A rs958295779
NM_153676.4(USH1C):c.497-4G>A rs397517881
NM_153676.4(USH1C):c.521+14C>G rs1235631667
NM_153676.4(USH1C):c.522-45del rs5789990
NM_153676.4(USH1C):c.569C>T (p.Ser190Leu) rs200319849
NM_153676.4(USH1C):c.579+1G>C rs1283092935
NM_153676.4(USH1C):c.580-27G>A rs6486378
NM_153676.4(USH1C):c.582C>T (p.Gly194=) rs397517882
NM_153676.4(USH1C):c.587G>A (p.Arg196Gln) rs397517883
NM_153676.4(USH1C):c.592A>T (p.Ser198Cys) rs141771249
NM_153676.4(USH1C):c.598G>A (p.Gly200Ser) rs770543827
NM_153676.4(USH1C):c.629A>C (p.Lys210Thr) rs372789934
NM_153676.4(USH1C):c.634G>A (p.Val212Ile) rs886048060
NM_153676.4(USH1C):c.648G>A (p.Leu216=) rs77137413
NM_153676.4(USH1C):c.651A>G (p.Val217=) rs75977878
NM_153676.4(USH1C):c.669C>A (p.Gly223=) rs144761543
NM_153676.4(USH1C):c.66G>A (p.Glu22=) rs768165881
NM_153676.4(USH1C):c.672C>A (p.Cys224Ter) rs1223763703
NM_153676.4(USH1C):c.674+1G>A rs775496999
NM_153676.4(USH1C):c.674+2T>G rs1298596518
NM_153676.4(USH1C):c.674+4G>A rs202095395
NM_153676.4(USH1C):c.675-296A>G
NM_153676.4(USH1C):c.675-4G>A rs550964012
NM_153676.4(USH1C):c.684C>T (p.Ser228=) rs149172005
NM_153676.4(USH1C):c.748_759+5del rs1355262412
NM_153676.4(USH1C):c.759+10G>T rs368528034
NM_153676.4(USH1C):c.759+272A>G
NM_153676.4(USH1C):c.759+294C>T
NM_153676.4(USH1C):c.760-116G>A
NM_153676.4(USH1C):c.760-1G>T rs1187887456
NM_153676.4(USH1C):c.760-4C>T rs374167444
NM_153676.4(USH1C):c.760-66T>C
NM_153676.4(USH1C):c.76C>T (p.Leu26Phe) rs267602805
NM_153676.4(USH1C):c.789C>G (p.Gly263=) rs376197674
NM_153676.4(USH1C):c.790G>A (p.Val264Ile) rs79875849
NM_153676.4(USH1C):c.793G>A (p.Asp265Asn) rs199537187
NM_153676.4(USH1C):c.7C>A (p.Arg3=) rs876657624
NM_153676.4(USH1C):c.7C>T (p.Arg3Ter) rs876657624
NM_153676.4(USH1C):c.819+10G>C rs41282936
NM_153676.4(USH1C):c.819+1G>A rs1554961152
NM_153676.4(USH1C):c.820-59C>T
NM_153676.4(USH1C):c.845G>A (p.Arg282His) rs779111365
NM_153676.4(USH1C):c.851T>A (p.Leu284Gln) rs756485601
NM_153676.4(USH1C):c.877-1G>A rs771279169
NM_153676.4(USH1C):c.880C>T (p.Arg294Trp) rs555152976
NM_153676.4(USH1C):c.881G>A (p.Arg294Gln) rs773481791
NM_153676.4(USH1C):c.883G>A (p.Glu295Lys) rs200127622
NM_153676.4(USH1C):c.908G>A (p.Arg303Gln) rs397517884
NM_153676.4(USH1C):c.915_920del (p.Glu306_Ala307del) rs1554960929
NM_153676.4(USH1C):c.91C>T (p.Arg31Ter) rs121908370
NM_153676.4(USH1C):c.921G>A (p.Ala307=) rs778447994
NM_153676.4(USH1C):c.92G>A (p.Arg31Gln) rs776511246
NM_153676.4(USH1C):c.946G>C (p.Glu316Gln) rs35336155
NM_153676.4(USH1C):c.965G>A (p.Arg322Gln) rs140424216
NM_153676.4(USH1C):c.966G>C (p.Arg322=)
NP_005700.2(USH1C):p.Arg357Trp
USH1C, 1-BP DEL, 1220G
USH1C, IVS12DS, G-C, +5
USH1C, IVS16AS, G-T, -1
USH1C, IVS1DS, G-T, +1
USH1C, IVS5AS, A DEL, -2
USH1C, IVS5DS, G-A, +1

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.