ClinVar Miner

List of variants in gene USH1C reported as benign

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 95
Download table as spreadsheet
HGVS dbSNP
NC_000011.10:g.17544490A>C rs1859819
NM_153676.4(USH1C):c.*186C>T rs1055577
NM_153676.4(USH1C):c.*211A>G rs1055581
NM_153676.4(USH1C):c.*419_*420insAACA rs10626485
NM_153676.4(USH1C):c.*46T>C rs1055574
NM_153676.4(USH1C):c.-60T>C rs371444878
NM_153676.4(USH1C):c.101A>G (p.His34Arg) rs75157409
NM_153676.4(USH1C):c.105-16C>T rs2041027
NM_153676.4(USH1C):c.1085+21C>G rs2240488
NM_153676.4(USH1C):c.1086-108A>G rs2041032
NM_153676.4(USH1C):c.1086-12G>A rs11024318
NM_153676.4(USH1C):c.1086-13G>T rs200490320
NM_153676.4(USH1C):c.1086-42G>A rs2108332
NM_153676.4(USH1C):c.1086-45A>G rs2041031
NM_153676.4(USH1C):c.1188A>G (p.Pro396=) rs2240487
NM_153676.4(USH1C):c.1211-1129G>A rs35188020
NM_153676.4(USH1C):c.1211-1134G>A rs115931035
NM_153676.4(USH1C):c.1211-1152G>A rs116996553
NM_153676.4(USH1C):c.1236T>C (p.Asp412=) rs199704356
NM_153676.4(USH1C):c.1261-34C>T rs2190454
NM_153676.4(USH1C):c.1414-34G>A rs2237964
NM_153676.4(USH1C):c.1531-64C>A rs2237965
NM_153676.4(USH1C):c.1632C>T (p.Asp544=) rs142545736
NM_153676.4(USH1C):c.1740T>C (p.Pro580=) rs200085788
NM_153676.4(USH1C):c.1770C>T (p.Ala590=) rs17776775
NM_153676.4(USH1C):c.1858C>T (p.Arg620Cys) rs143160805
NM_153676.4(USH1C):c.1859G>T (p.Arg620Leu) rs139996942
NM_153676.4(USH1C):c.186T>C (p.Ile62=) rs200239508
NM_153676.4(USH1C):c.1872G>A (p.Ser624=) rs80124409
NM_153676.4(USH1C):c.1906C>T (p.Arg636Cys) rs149510892
NM_153676.4(USH1C):c.2004C>A (p.Pro668=) rs201586291
NM_153676.4(USH1C):c.2014-1G>A rs150567427
NM_153676.4(USH1C):c.2124T>C (p.Ser708=) rs369021714
NM_153676.4(USH1C):c.2134-12T>C rs76769358
NM_153676.4(USH1C):c.2167C>T (p.Gln723Ter) rs146451547
NM_153676.4(USH1C):c.2184+10T>C rs200889109
NM_153676.4(USH1C):c.2184+12C>T rs138547759
NM_153676.4(USH1C):c.2184+229C>T rs11024312
NM_153676.4(USH1C):c.2226+12C>T rs17703528
NM_153676.4(USH1C):c.2226+197G>A rs12270644
NM_153676.4(USH1C):c.225T>C (p.Asp75=) rs111033279
NM_153676.4(USH1C):c.2280+18dup
NM_153676.4(USH1C):c.2280+29C>T rs114971046
NM_153676.4(USH1C):c.2281-113A>G rs2072234
NM_153676.4(USH1C):c.2340C>T (p.Val780=) rs10832796
NM_153676.4(USH1C):c.2347G>T (p.Ala783Ser) rs34077456
NM_153676.4(USH1C):c.2373G>A (p.Glu791=) rs746011575
NM_153676.4(USH1C):c.2381-46G>A rs2072233
NM_153676.4(USH1C):c.2443C>T (p.Leu815=) rs148477093
NM_153676.4(USH1C):c.2457G>C (p.Glu819Asp) rs1064074
NM_153676.4(USH1C):c.2488G>A (p.Gly830Arg) rs142751309
NM_153676.4(USH1C):c.2490+12G>C rs2072232
NM_153676.4(USH1C):c.2491-165C>A rs2072230
NM_153676.4(USH1C):c.2491-16C>T
NM_153676.4(USH1C):c.2499C>T (p.Ile833=) rs34581703
NM_153676.4(USH1C):c.2547-11T>C rs10832795
NM_153676.4(USH1C):c.2547-159_2547-158del rs10530940
NM_153676.4(USH1C):c.2547-183C>G rs1859824
NM_153676.4(USH1C):c.2547-8A>G rs78509055
NM_153676.4(USH1C):c.2591G>A (p.Arg864Gln) rs374696855
NM_153676.4(USH1C):c.2611G>A (p.Ala871Thr) rs56165709
NM_153676.4(USH1C):c.2656-106T>C rs2072226
NM_153676.4(USH1C):c.2656-260A>G rs7108947
NM_153676.4(USH1C):c.2656-47C>T rs2072225
NM_153676.4(USH1C):c.294C>T (p.Leu98=) rs34055234
NM_153676.4(USH1C):c.307C>T (p.Arg103Cys) rs397517880
NM_153676.4(USH1C):c.324T>C (p.Phe108=) rs549758189
NM_153676.4(USH1C):c.36+214C>T rs7125811
NM_153676.4(USH1C):c.360C>T (p.Gly120=) rs140869579
NM_153676.4(USH1C):c.37-243A>G rs2883581
NM_153676.4(USH1C):c.37-45C>G rs2240489
NM_153676.4(USH1C):c.37-47G>T rs2355022
NM_153676.4(USH1C):c.37-61A>G rs878546
NM_153676.4(USH1C):c.381G>T (p.Gly127=) rs41282942
NM_153676.4(USH1C):c.387+17C>T rs78718533
NM_153676.4(USH1C):c.388G>A (p.Val130Ile) rs55843567
NM_153676.4(USH1C):c.403G>A (p.Val135Ile) rs145013633
NM_153676.4(USH1C):c.496+13A>G rs111033277
NM_153676.4(USH1C):c.496+21G>T rs111033278
NM_153676.4(USH1C):c.496+21GCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGGGAGCAGG[9] rs55983148
NM_153676.4(USH1C):c.496+33= rs12795083
NM_153676.4(USH1C):c.522-45del rs5789990
NM_153676.4(USH1C):c.580-27G>A rs6486378
NM_153676.4(USH1C):c.648G>A (p.Leu216=) rs77137413
NM_153676.4(USH1C):c.651A>G (p.Val217=) rs75977878
NM_153676.4(USH1C):c.674+4G>A rs202095395
NM_153676.4(USH1C):c.675-296A>G rs4756898
NM_153676.4(USH1C):c.759+20C>T
NM_153676.4(USH1C):c.759+272A>G rs79878474
NM_153676.4(USH1C):c.759+294C>T rs75165004
NM_153676.4(USH1C):c.760-116G>A rs41282938
NM_153676.4(USH1C):c.760-66T>C rs4757539
NM_153676.4(USH1C):c.819+10G>C rs41282936
NM_153676.4(USH1C):c.877-19del
NM_153676.4(USH1C):c.946G>C (p.Glu316Gln) rs35336155

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.