ClinVar Miner

List of variants in gene ZNF469

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 534
Download table as spreadsheet
HGVS dbSNP
GRCh37/hg19 16q24.2(chr16:88376480-88510688)x1
NM_001127464.1:c.1268C>T
NM_001127464.1:c.5695C>T
NM_001127464.2(ZNF469):c.*870delT rs35684712
NM_001127464.2(ZNF469):c.-18C>A rs568661500
NM_001127464.2(ZNF469):c.10248delG (p.Arg3417Glyfs) rs764470052
NM_001127464.2(ZNF469):c.10392_10394delTCC (p.Pro3465del) rs145451469
NM_001127464.2(ZNF469):c.11290_11291delGGinsT (p.Gly3764Cysfs) rs1555520574
NM_001127464.2(ZNF469):c.1673del (p.Ala558Valfs) rs1064795080
NM_001127464.2(ZNF469):c.2625_2645del21 (p.Pro876_Gly882del) rs113102840
NM_001127464.2(ZNF469):c.2904_2909delGTCGGG (p.Ser969_Gly970del) rs281865147
NM_001127464.2(ZNF469):c.2914_2919delGGCGGC (p.Gly972_Gly973del) rs775423936
NM_001127464.2(ZNF469):c.2917_2919delGGC (p.Gly973del) rs775423936
NM_001127464.2(ZNF469):c.2951_2953delACG (p.Asp984del) rs886052397
NM_001127464.2(ZNF469):c.3034delG (p.Val1012Serfs) rs1555519050
NM_001127464.2(ZNF469):c.4448_4450delTGC (p.Leu1483del) rs555544144
NM_001127464.2(ZNF469):c.5576_5577delCCinsAG (p.Thr1859Lys) rs1555519640
NM_001127464.2(ZNF469):c.7554del (p.Ser2519Alafs) rs886039575
NM_001127464.2(ZNF469):c.9011_9025delTTCCCGGGAACACCC (p.Leu3004_Thr3008del) rs281865162
NM_001367624.1(ZNF469):c.*1001A>G rs3848234
NM_001367624.1(ZNF469):c.*1071A>T rs536887736
NM_001367624.1(ZNF469):c.*1323G>A rs780254370
NM_001367624.1(ZNF469):c.*1348G>A rs886052428
NM_001367624.1(ZNF469):c.*216G>A rs146964491
NM_001367624.1(ZNF469):c.*218G>A rs137889724
NM_001367624.1(ZNF469):c.*264A>G rs193210256
NM_001367624.1(ZNF469):c.*285C>T rs35994806
NM_001367624.1(ZNF469):c.*420G>A rs45532839
NM_001367624.1(ZNF469):c.*421G>T rs148260049
NM_001367624.1(ZNF469):c.*46C>A rs78600508
NM_001367624.1(ZNF469):c.*491T>C rs557906701
NM_001367624.1(ZNF469):c.*492G>A rs190108769
NM_001367624.1(ZNF469):c.*499A>G rs537339757
NM_001367624.1(ZNF469):c.*518G>A rs563015267
NM_001367624.1(ZNF469):c.*547G>T rs370886541
NM_001367624.1(ZNF469):c.*551_*577TCCTCCCTCTGACCACAGGGTCATGCC[3] rs6145934
NM_001367624.1(ZNF469):c.*599C>G rs146233624
NM_001367624.1(ZNF469):c.*617C>T rs886052422
NM_001367624.1(ZNF469):c.*618T>G rs3859020
NM_001367624.1(ZNF469):c.*634C>A rs74032868
NM_001367624.1(ZNF469):c.*649C>G rs561472955
NM_001367624.1(ZNF469):c.*664C>T rs886052423
NM_001367624.1(ZNF469):c.*665G>A rs75706884
NM_001367624.1(ZNF469):c.*788G>A rs3894713
NM_001367624.1(ZNF469):c.*792A>G rs886052424
NM_001367624.1(ZNF469):c.*845T>C rs7187709
NM_001367624.1(ZNF469):c.*879T>C rs886052426
NM_001367624.1(ZNF469):c.*8G>A rs45504291
NM_001367624.1(ZNF469):c.*907G>A rs1048192
NM_001367624.1(ZNF469):c.*921_*922insG rs11382974
NM_001367624.1(ZNF469):c.*932A>G rs886052427
NM_001367624.1(ZNF469):c.10034G>A (p.Arg3345His) rs79339739
NM_001367624.1(ZNF469):c.1005G>A (p.Leu335=) rs1555518581
NM_001367624.1(ZNF469):c.10067T>G (p.Leu3356Arg) rs1064796800
NM_001367624.1(ZNF469):c.10079G>T (p.Ser3360Ile) rs929128705
NM_001367624.1(ZNF469):c.10100G>A (p.Cys3367Tyr) rs387907062
NM_001367624.1(ZNF469):c.10134G>A (p.Gly3378=) rs1202541375
NM_001367624.1(ZNF469):c.10184A>G (p.Glu3395Gly) rs900191925
NM_001367624.1(ZNF469):c.1020C>T (p.Gly340=) rs273585633
NM_001367624.1(ZNF469):c.10294C>T (p.Gln3432Ter) rs1085307609
NM_001367624.1(ZNF469):c.10325G>A (p.Arg3442Lys) rs199528724
NM_001367624.1(ZNF469):c.10325G>C (p.Arg3442Thr) rs199528724
NM_001367624.1(ZNF469):c.10325G>T (p.Arg3442Met) rs199528724
NM_001367624.1(ZNF469):c.10326G>C (p.Arg3442Ser) rs56236932
NM_001367624.1(ZNF469):c.10326G>T (p.Arg3442Ser) rs56236932
NM_001367624.1(ZNF469):c.10327G>C (p.Gly3443Arg) rs532857190
NM_001367624.1(ZNF469):c.10328G>A (p.Gly3443Glu) rs140056980
NM_001367624.1(ZNF469):c.10328G>C (p.Gly3443Ala) rs140056980
NM_001367624.1(ZNF469):c.10328G>T (p.Gly3443Val) rs140056980
NM_001367624.1(ZNF469):c.10330G>C (p.Gly3444Arg) rs569602115
NM_001367624.1(ZNF469):c.10331G>T (p.Gly3444Val) rs530393871
NM_001367624.1(ZNF469):c.10332dup (p.Arg3445fs) rs764470052
NM_001367624.1(ZNF469):c.10361G>A (p.Arg3454Gln) rs75288466
NM_001367624.1(ZNF469):c.10377G>C (p.Pro3459=) rs910515287
NM_001367624.1(ZNF469):c.10472C>G (p.Pro3491Arg) rs183437633
NM_001367624.1(ZNF469):c.1048G>A (p.Asp350Asn) rs568820656
NM_001367624.1(ZNF469):c.10518G>A (p.Pro3506=) rs376379111
NM_001367624.1(ZNF469):c.10572C>T (p.Pro3524=) rs763317477
NM_001367624.1(ZNF469):c.10573G>A (p.Glu3525Lys) rs273585628
NM_001367624.1(ZNF469):c.10582G>A (p.Glu3528Lys) rs758708056
NM_001367624.1(ZNF469):c.10599C>T (p.Pro3533=) rs78022634
NM_001367624.1(ZNF469):c.10656G>A (p.Pro3552=) rs191234581
NM_001367624.1(ZNF469):c.1065C>A (p.Leu355=) rs748505843
NM_001367624.1(ZNF469):c.10683C>T (p.Ala3561=) rs794727258
NM_001367624.1(ZNF469):c.1069T>C (p.Ser357Pro) rs11648572
NM_001367624.1(ZNF469):c.10700G>A (p.Gly3567Glu) rs199610834
NM_001367624.1(ZNF469):c.10708G>A (p.Ala3570Thr) rs57052487
NM_001367624.1(ZNF469):c.10710G>A (p.Ala3570=) rs548910839
NM_001367624.1(ZNF469):c.10713G>A (p.Leu3571=) rs981130895
NM_001367624.1(ZNF469):c.1072C>T (p.Pro358Ser) rs1064796784
NM_001367624.1(ZNF469):c.10740C>T (p.Asn3580=) rs527707590
NM_001367624.1(ZNF469):c.10762G>A (p.Gly3588Arg) rs750481489
NM_001367624.1(ZNF469):c.10795G>T (p.Ala3599Ser) rs199760004
NM_001367624.1(ZNF469):c.10812G>A (p.Pro3604=) rs897455659
NM_001367624.1(ZNF469):c.10855G>A (p.Val3619Met) rs111494864
NM_001367624.1(ZNF469):c.10860C>T (p.Phe3620=) rs1230771468
NM_001367624.1(ZNF469):c.10888C>T (p.Arg3630Cys) rs200668806
NM_001367624.1(ZNF469):c.1088C>T (p.Ser363Leu) rs771000169
NM_001367624.1(ZNF469):c.10927C>T (p.Leu3643=) rs273585637
NM_001367624.1(ZNF469):c.1095G>T (p.Pro365=) rs534477237
NM_001367624.1(ZNF469):c.10972G>C (p.Glu3658Gln) rs1105066
NM_001367624.1(ZNF469):c.10975G>A (p.Gly3659Arg) rs3812951
NM_001367624.1(ZNF469):c.10984C>T (p.Arg3662Ter) rs1171824548
NM_001367624.1(ZNF469):c.1098A>C (p.Arg366Ser) rs11640794
NM_001367624.1(ZNF469):c.10990= (p.Ala3664=) rs904783
NM_001367624.1(ZNF469):c.11022G>A (p.Ala3674=) rs1002770054
NM_001367624.1(ZNF469):c.11052G>A (p.Ser3684=) rs780722176
NM_001367624.1(ZNF469):c.11070C>T (p.Ser3690=) rs1272116933
NM_001367624.1(ZNF469):c.11107G>A (p.Val3703Met) rs151127652
NM_001367624.1(ZNF469):c.11109G>T (p.Val3703=) rs886052419
NM_001367624.1(ZNF469):c.11184C>G (p.Pro3728=) rs1041924878
NM_001367624.1(ZNF469):c.11185G>A (p.Gly3729Ser) rs273585629
NM_001367624.1(ZNF469):c.11203A>G (p.Ser3735Gly) rs536054902
NM_001367624.1(ZNF469):c.11221G>A (p.Gly3741Ser) rs745385522
NM_001367624.1(ZNF469):c.11244C>T (p.Ser3748=) rs936296523
NM_001367624.1(ZNF469):c.11277C>T (p.Ser3759=) rs372634401
NM_001367624.1(ZNF469):c.11278G>A (p.Glu3760Lys) rs547014159
NM_001367624.1(ZNF469):c.11344G>A (p.Ala3782Thr) rs1327878609
NM_001367624.1(ZNF469):c.11406C>A (p.His3802Gln) rs141042464
NM_001367624.1(ZNF469):c.11409G>C (p.Gly3803=) rs150233193
NM_001367624.1(ZNF469):c.11425G>A (p.Glu3809Lys) rs201834513
NM_001367624.1(ZNF469):c.1143C>A (p.Pro381=) rs74032864
NM_001367624.1(ZNF469):c.11444C>T (p.Thr3815Met) rs1057518368
NM_001367624.1(ZNF469):c.11496_11505del (p.Ser3833fs) rs1567517877
NM_001367624.1(ZNF469):c.11502C>T (p.Phe3834=) rs1030545648
NM_001367624.1(ZNF469):c.11536C>G (p.Arg3846Gly) rs886052420
NM_001367624.1(ZNF469):c.11546G>A (p.Arg3849Gln) rs775672255
NM_001367624.1(ZNF469):c.11566C>T (p.Arg3856Cys) rs762894872
NM_001367624.1(ZNF469):c.11568C>T (p.Arg3856=) rs367547260
NM_001367624.1(ZNF469):c.11586C>G (p.Pro3862=) rs750184195
NM_001367624.1(ZNF469):c.11658G>C (p.Gln3886His) rs182269913
NM_001367624.1(ZNF469):c.11691G>A (p.Gln3897=) rs1322051909
NM_001367624.1(ZNF469):c.11697A>C (p.Arg3899Ser) rs561879014
NM_001367624.1(ZNF469):c.11699C>T (p.Pro3900Leu) rs273585630
NM_001367624.1(ZNF469):c.11714C>G (p.Pro3905Arg) rs529322092
NM_001367624.1(ZNF469):c.11752G>A (p.Glu3918Lys) rs1085307510
NM_001367624.1(ZNF469):c.11757A>G (p.Pro3919=) rs4782301
NM_001367624.1(ZNF469):c.11771C>T (p.Thr3924Met) rs139259830
NM_001367624.1(ZNF469):c.11809G>A (p.Gly3937Arg) rs886052421
NM_001367624.1(ZNF469):c.11821A>C (p.Thr3941Pro) rs1555520642
NM_001367624.1(ZNF469):c.11822C>T (p.Thr3941Ile) rs766057875
NM_001367624.1(ZNF469):c.11856C>T (p.Ser3952=) rs4782362
NM_001367624.1(ZNF469):c.1285G>A (p.Ala429Thr) rs113937803
NM_001367624.1(ZNF469):c.1346C>T (p.Pro449Leu) rs1388799029
NM_001367624.1(ZNF469):c.135C>T (p.Thr45=) rs538850431
NM_001367624.1(ZNF469):c.139G>A (p.Gly47Ser) rs138954293
NM_001367624.1(ZNF469):c.1406G>C (p.Ser469Thr) rs770926082
NM_001367624.1(ZNF469):c.142G>A (p.Ala48Thr) rs886052388
NM_001367624.1(ZNF469):c.1471G>A (p.Ala491Thr) rs117555121
NM_001367624.1(ZNF469):c.1483C>T (p.Pro495Ser) rs202205643
NM_001367624.1(ZNF469):c.1489G>A (p.Gly497Arg) rs28723506
NM_001367624.1(ZNF469):c.1528G>A (p.Gly510Ser) rs755555951
NM_001367624.1(ZNF469):c.1528_1529delinsAC (p.Gly510Thr) rs1555518716
NM_001367624.1(ZNF469):c.1529G>C (p.Gly510Ala) rs7199961
NM_001367624.1(ZNF469):c.1543G>A (p.Gly515Arg) rs1131691990
NM_001367624.1(ZNF469):c.1547G>C (p.Gly516Ala) rs753160761
NM_001367624.1(ZNF469):c.1584G>A (p.Pro528=) rs143852982
NM_001367624.1(ZNF469):c.1609G>A (p.Val537Met) rs184458982
NM_001367624.1(ZNF469):c.1615A>T (p.Ser539Cys) rs189476639
NM_001367624.1(ZNF469):c.1627G>A (p.Gly543Ser) rs281865145
NM_001367624.1(ZNF469):c.1654G>A (p.Gly552Arg) rs769955501
NM_001367624.1(ZNF469):c.1663G>A (p.Asp555Asn) rs749179728
NM_001367624.1(ZNF469):c.1689C>T (p.Phe563=) rs751136702
NM_001367624.1(ZNF469):c.1697C>T (p.Ala566Val) rs181785233
NM_001367624.1(ZNF469):c.1719C>T (p.His573=) rs552893295
NM_001367624.1(ZNF469):c.1776A>G (p.Pro592=) rs12927001
NM_001367624.1(ZNF469):c.1781C>T (p.Pro594Leu) rs757534069
NM_001367624.1(ZNF469):c.1800G>A (p.Thr600=) rs768772320
NM_001367624.1(ZNF469):c.1809C>T (p.Ser603=) rs748014455
NM_001367624.1(ZNF469):c.1827G>A (p.Ser609=) rs148616993
NM_001367624.1(ZNF469):c.183C>T (p.Pro61=) rs746875261
NM_001367624.1(ZNF469):c.1856G>T (p.Ser619Ile) rs1187845779
NM_001367624.1(ZNF469):c.186G>T (p.Glu62Asp) rs770775791
NM_001367624.1(ZNF469):c.1875C>A (p.Leu625=) rs886052392
NM_001367624.1(ZNF469):c.1882C>A (p.Pro628Thr) rs886052393
NM_001367624.1(ZNF469):c.1896G>A (p.Ser632=) rs554795578
NM_001367624.1(ZNF469):c.1911A>G (p.Pro637=) rs373169260
NM_001367624.1(ZNF469):c.1932G>A (p.Thr644=) rs539996728
NM_001367624.1(ZNF469):c.1932G>C (p.Thr644=) rs539996728
NM_001367624.1(ZNF469):c.1982A>G (p.Tyr661Cys) rs886052394
NM_001367624.1(ZNF469):c.1994C>T (p.Pro665Leu) rs184583062
NM_001367624.1(ZNF469):c.19C>T (p.Arg7Ter) rs1004428835
NM_001367624.1(ZNF469):c.2017G>A (p.Ala673Thr) rs770623245
NM_001367624.1(ZNF469):c.2034C>T (p.Ala678=) rs58401704
NM_001367624.1(ZNF469):c.2035G>A (p.Glu679Lys) rs551591362
NM_001367624.1(ZNF469):c.2063C>A (p.Thr688Asn) rs281865146
NM_001367624.1(ZNF469):c.2085C>T (p.Pro695=) rs74547407
NM_001367624.1(ZNF469):c.2124G>A (p.Ala708=) rs1216460720
NM_001367624.1(ZNF469):c.2126C>T (p.Pro709Leu) rs1017679214
NM_001367624.1(ZNF469):c.2130T>C (p.Pro710=) rs12918876
NM_001367624.1(ZNF469):c.2132C>G (p.Pro711Arg) rs571184307
NM_001367624.1(ZNF469):c.222G>A (p.Lys74=) rs998864240
NM_001367624.1(ZNF469):c.2270T>G (p.Leu757Arg) rs753664726
NM_001367624.1(ZNF469):c.2297G>A (p.Arg766Gln) rs144492145
NM_001367624.1(ZNF469):c.2308C>T (p.Pro770Ser) rs1039078920
NM_001367624.1(ZNF469):c.2309C>T (p.Pro770Leu) rs1425767356
NM_001367624.1(ZNF469):c.2361C>G (p.His787Gln) rs886052395
NM_001367624.1(ZNF469):c.2370G>A (p.Leu790=) rs147859144
NM_001367624.1(ZNF469):c.2407G>T (p.Ala803Ser) rs113484918
NM_001367624.1(ZNF469):c.2415C>T (p.Ala805=) rs961899310
NM_001367624.1(ZNF469):c.2478G>T (p.Pro826=) rs273585634
NM_001367624.1(ZNF469):c.248C>T (p.Pro83Leu) rs775103017
NM_001367624.1(ZNF469):c.2508T>C (p.Asp836=) rs1447365697
NM_001367624.1(ZNF469):c.2569A>G (p.Asn857Asp) rs1555518955
NM_001367624.1(ZNF469):c.2574G>C (p.Pro858=) rs74384633
NM_001367624.1(ZNF469):c.2643C>G (p.Ser881=) rs273585635
NM_001367624.1(ZNF469):c.2652C>G (p.Pro884=) rs767431034
NM_001367624.1(ZNF469):c.2653C>G (p.Leu885Val) rs139653501
NM_001367624.1(ZNF469):c.2666C>T (p.Ala889Val) rs145186655
NM_001367624.1(ZNF469):c.2671G>T (p.Val891Leu) rs753481187
NM_001367624.1(ZNF469):c.2693C>T (p.Pro898Leu) rs754458926
NM_001367624.1(ZNF469):c.2699C>G (p.Pro900Arg) rs273585618
NM_001367624.1(ZNF469):c.2699C>T (p.Pro900Leu) rs273585618
NM_001367624.1(ZNF469):c.2700G>C (p.Pro900=) rs747652441
NM_001367624.1(ZNF469):c.2717C>T (p.Pro906Leu) rs77951481
NM_001367624.1(ZNF469):c.2733C>T (p.Pro911=) rs1278230482
NM_001367624.1(ZNF469):c.2789G>T (p.Gly930Val) rs564654481
NM_001367624.1(ZNF469):c.2803G>A (p.Glu935Lys) rs117995699
NM_001367624.1(ZNF469):c.2810A>T (p.Asp937Val) rs550198026
NM_001367624.1(ZNF469):c.2814G>A (p.Ala938=) rs140480823
NM_001367624.1(ZNF469):c.2841G>A (p.Arg947=) rs150435442
NM_001367624.1(ZNF469):c.2873T>C (p.Leu958Pro) rs370402083
NM_001367624.1(ZNF469):c.290C>T (p.Pro97Leu) rs273585617
NM_001367624.1(ZNF469):c.2913C>A (p.Gly971=) rs60462217
NM_001367624.1(ZNF469):c.2929G>C (p.Gly977Arg) rs770061832
NM_001367624.1(ZNF469):c.2931C>T (p.Gly977=) rs539527724
NM_001367624.1(ZNF469):c.2952C>T (p.Asp984=) rs886052398
NM_001367624.1(ZNF469):c.2953G>A (p.Gly985Ser) rs886052399
NM_001367624.1(ZNF469):c.2986C>A (p.Arg996Ser) rs886052400
NM_001367624.1(ZNF469):c.3055C>T (p.Pro1019Ser) rs937180195
NM_001367624.1(ZNF469):c.3072C>T (p.Ser1024=) rs1219175594
NM_001367624.1(ZNF469):c.3079C>A (p.Arg1027Ser) rs1057524853
NM_001367624.1(ZNF469):c.30G>A (p.Pro10=) rs281165936
NM_001367624.1(ZNF469):c.3109A>T (p.Arg1037Trp) rs753720576
NM_001367624.1(ZNF469):c.3119A>C (p.Lys1040Thr) rs273585619
NM_001367624.1(ZNF469):c.3125G>A (p.Arg1042Gln) rs181077813
NM_001367624.1(ZNF469):c.3150C>T (p.Leu1050=) rs1020696310
NM_001367624.1(ZNF469):c.3153T>C (p.Ile1051=) rs9924504
NM_001367624.1(ZNF469):c.3183C>T (p.Arg1061=) rs756703220
NM_001367624.1(ZNF469):c.3255G>C (p.Glu1085Asp) rs886052401
NM_001367624.1(ZNF469):c.327G>A (p.Ala109=) rs192479136
NM_001367624.1(ZNF469):c.3320G>A (p.Arg1107Gln) rs281865148
NM_001367624.1(ZNF469):c.3321G>A (p.Arg1107=) rs763826959
NM_001367624.1(ZNF469):c.3326C>T (p.Pro1109Leu) rs562264117
NM_001367624.1(ZNF469):c.3341G>T (p.Arg1114Leu) rs568046708
NM_001367624.1(ZNF469):c.334G>A (p.Ala112Thr) rs766853024
NM_001367624.1(ZNF469):c.337G>A (p.Glu113Lys) rs281865144
NM_001367624.1(ZNF469):c.3452C>T (p.Ala1151Val) rs755348435
NM_001367624.1(ZNF469):c.3468G>A (p.Glu1156=) rs1555519130
NM_001367624.1(ZNF469):c.3472C>T (p.Pro1158Ser) rs184894059
NM_001367624.1(ZNF469):c.3480G>C (p.Gly1160=) rs747150324
NM_001367624.1(ZNF469):c.3485G>T (p.Arg1162Leu) rs886052402
NM_001367624.1(ZNF469):c.3506C>T (p.Pro1169Leu) rs769853271
NM_001367624.1(ZNF469):c.3516T>C (p.Arg1172=) rs111557381
NM_001367624.1(ZNF469):c.3522G>A (p.Pro1174=) rs9938800
NM_001367624.1(ZNF469):c.3550G>A (p.Ala1184Thr) rs553460850
NM_001367624.1(ZNF469):c.3565C>A (p.Pro1189Thr) rs766878740
NM_001367624.1(ZNF469):c.3568A>G (p.Lys1190Glu) rs7197071
NM_001367624.1(ZNF469):c.362T>C (p.Ile121Thr) rs1555518437
NM_001367624.1(ZNF469):c.3650C>T (p.Pro1217Leu) rs115183769
NM_001367624.1(ZNF469):c.3654G>C (p.Ser1218=) rs1555519186
NM_001367624.1(ZNF469):c.3714C>T (p.Ser1238=) rs572061351
NM_001367624.1(ZNF469):c.3759G>A (p.Ala1253=) rs543669472
NM_001367624.1(ZNF469):c.376A>G (p.Ser126Gly) rs886052389
NM_001367624.1(ZNF469):c.3773C>A (p.Ala1258Glu) rs141255631
NM_001367624.1(ZNF469):c.3776G>A (p.Ser1259Asn) rs886052403
NM_001367624.1(ZNF469):c.3864G>A (p.Ala1288=) rs1268811640
NM_001367624.1(ZNF469):c.3894G>C (p.Val1298=) rs115790991
NM_001367624.1(ZNF469):c.3918G>A (p.Gly1306=) rs768501538
NM_001367624.1(ZNF469):c.3931C>T (p.Pro1311Ser) rs187453092
NM_001367624.1(ZNF469):c.3950A>G (p.Lys1317Arg) rs772817384
NM_001367624.1(ZNF469):c.3954C>T (p.Asp1318=) rs760206158
NM_001367624.1(ZNF469):c.4001C>T (p.Pro1334Leu) rs1016116935
NM_001367624.1(ZNF469):c.402C>T (p.Asp134=) rs569036398
NM_001367624.1(ZNF469):c.4155C>T (p.Leu1385=) rs747930231
NM_001367624.1(ZNF469):c.4195C>T (p.His1399Tyr) rs886052404
NM_001367624.1(ZNF469):c.4198C>A (p.Pro1400Thr) rs145158875
NM_001367624.1(ZNF469):c.4216G>T (p.Asp1406Tyr) rs557997233
NM_001367624.1(ZNF469):c.4227G>A (p.Pro1409=) rs371897217
NM_001367624.1(ZNF469):c.4258G>T (p.Glu1420Ter) rs387907063
NM_001367624.1(ZNF469):c.4314G>A (p.Glu1438=) rs576048519
NM_001367624.1(ZNF469):c.4343C>T (p.Pro1448Leu) rs4782300
NM_001367624.1(ZNF469):c.4363C>G (p.Leu1455Val) rs116532825
NM_001367624.1(ZNF469):c.4376T>G (p.Leu1459Arg) rs559625962
NM_001367624.1(ZNF469):c.4406A>G (p.Tyr1469Cys) rs116072997
NM_001367624.1(ZNF469):c.4419T>G (p.Ser1473=) rs12445417
NM_001367624.1(ZNF469):c.4421C>T (p.Ala1474Val) rs199897247
NM_001367624.1(ZNF469):c.4422G>A (p.Ala1474=) rs368877287
NM_001367624.1(ZNF469):c.4427G>A (p.Arg1476Lys) rs763632522
NM_001367624.1(ZNF469):c.4434C>T (p.Ser1478=) rs74032865
NM_001367624.1(ZNF469):c.4440G>A (p.Leu1480=) rs755586686
NM_001367624.1(ZNF469):c.4443G>A (p.Pro1481=) rs547585456
NM_001367624.1(ZNF469):c.4447G>T (p.Ala1483Ser) rs273585620
NM_001367624.1(ZNF469):c.4456G>A (p.Asp1486Asn) rs373777402
NM_001367624.1(ZNF469):c.4463C>T (p.Pro1488Leu) rs565994438
NM_001367624.1(ZNF469):c.4472C>T (p.Thr1491Met) rs375045076
NM_001367624.1(ZNF469):c.4479G>A (p.Pro1493=) rs373162171
NM_001367624.1(ZNF469):c.4556C>T (p.Ser1519Leu) rs767278971
NM_001367624.1(ZNF469):c.4574G>C (p.Ser1525Thr) rs545662898
NM_001367624.1(ZNF469):c.457C>A (p.Pro153Thr) rs532620482
NM_001367624.1(ZNF469):c.457C>G (p.Pro153Ala) rs532620482
NM_001367624.1(ZNF469):c.4599A>C (p.Thr1533=) rs142246629
NM_001367624.1(ZNF469):c.4609G>A (p.Gly1537Ser) rs528560466
NM_001367624.1(ZNF469):c.4611C>T (p.Gly1537=) rs775651401
NM_001367624.1(ZNF469):c.470G>A (p.Gly157Glu) rs781096189
NM_001367624.1(ZNF469):c.4755G>A (p.Pro1585=) rs370447132
NM_001367624.1(ZNF469):c.4771G>T (p.Ala1591Ser) rs755066385
NM_001367624.1(ZNF469):c.4778C>T (p.Ser1593Leu) rs768864900
NM_001367624.1(ZNF469):c.4779G>A (p.Ser1593=) rs774473871
NM_001367624.1(ZNF469):c.4829G>A (p.Arg1610His) rs567038987
NM_001367624.1(ZNF469):c.4849C>T (p.Pro1617Ser) rs557351664
NM_001367624.1(ZNF469):c.4855G>A (p.Glu1619Lys) rs759327672
NM_001367624.1(ZNF469):c.4863G>T (p.Thr1621=) rs778048230
NM_001367624.1(ZNF469):c.4884G>A (p.Thr1628=) rs141666432
NM_001367624.1(ZNF469):c.4892G>A (p.Gly1631Glu) rs755244502
NM_001367624.1(ZNF469):c.4907A>G (p.His1636Arg) rs557636016
NM_001367624.1(ZNF469):c.4909C>T (p.Arg1637Trp) rs575820215
NM_001367624.1(ZNF469):c.4910G>A (p.Arg1637Gln) rs273585621
NM_001367624.1(ZNF469):c.4910G>C (p.Arg1637Pro) rs273585621
NM_001367624.1(ZNF469):c.4926G>A (p.Ser1642=) rs117310292
NM_001367624.1(ZNF469):c.4952A>G (p.Gln1651Arg) rs773925755
NM_001367624.1(ZNF469):c.498C>G (p.Leu166=) rs1555518472
NM_001367624.1(ZNF469):c.5006C>T (p.Ala1669Val) rs200070902
NM_001367624.1(ZNF469):c.5010C>A (p.Ala1670=) rs766852564
NM_001367624.1(ZNF469):c.5087C>T (p.Pro1696Leu) rs115487796
NM_001367624.1(ZNF469):c.5114C>T (p.Thr1705Ile) rs768667107
NM_001367624.1(ZNF469):c.5144G>A (p.Arg1715Lys) rs281865149
NM_001367624.1(ZNF469):c.5145G>A (p.Arg1715=) rs577775261
NM_001367624.1(ZNF469):c.5150C>G (p.Pro1717Arg) rs544832628
NM_001367624.1(ZNF469):c.5158G>A (p.Val1720Ile) rs1131691303
NM_001367624.1(ZNF469):c.5162G>T (p.Cys1721Phe) rs568197988
NM_001367624.1(ZNF469):c.519C>G (p.Pro173=) rs530740920
NM_001367624.1(ZNF469):c.523G>A (p.Ala175Thr) rs1085307628
NM_001367624.1(ZNF469):c.5266G>A (p.Ala1756Thr) rs371328036
NM_001367624.1(ZNF469):c.5340C>G (p.Pro1780=) rs184374078
NM_001367624.1(ZNF469):c.5347G>A (p.Ala1783Thr) rs754873241
NM_001367624.1(ZNF469):c.536G>C (p.Gly179Ala) rs760014906
NM_001367624.1(ZNF469):c.5414C>A (p.Pro1805His) rs78446958
NM_001367624.1(ZNF469):c.5488G>T (p.Ala1830Ser) rs778548266
NM_001367624.1(ZNF469):c.5538G>A (p.Thr1846=) rs943125670
NM_001367624.1(ZNF469):c.5548C>A (p.Pro1850Thr) rs199932922
NM_001367624.1(ZNF469):c.5577G>A (p.Pro1859=) rs764487066
NM_001367624.1(ZNF469):c.5661C>G (p.Thr1887=) rs9931465
NM_001367624.1(ZNF469):c.5675G>A (p.Arg1892Lys) rs528085780
NM_001367624.1(ZNF469):c.5681A>T (p.Gln1894Leu) rs281865150
NM_001367624.1(ZNF469):c.5697C>T (p.Ser1899=) rs111986360
NM_001367624.1(ZNF469):c.5707C>T (p.Arg1903Cys) rs757657013
NM_001367624.1(ZNF469):c.578C>A (p.Ser193Tyr) rs1369047197
NM_001367624.1(ZNF469):c.5824G>A (p.Gly1942Arg) rs114755302
NM_001367624.1(ZNF469):c.5853C>T (p.Ala1951=) rs1409689399
NM_001367624.1(ZNF469):c.5856T>C (p.Cys1952=) rs186652137
NM_001367624.1(ZNF469):c.585C>G (p.Asn195Lys) rs896312288
NM_001367624.1(ZNF469):c.5862C>G (p.Pro1954=) rs201666199
NM_001367624.1(ZNF469):c.5912C>T (p.Ala1971Val) rs886052406
NM_001367624.1(ZNF469):c.5914G>A (p.Gly1972Arg) rs766410344
NM_001367624.1(ZNF469):c.6029G>A (p.Gly2010Glu) rs886052407
NM_001367624.1(ZNF469):c.6032G>A (p.Gly2011Asp) rs79155191
NM_001367624.1(ZNF469):c.6036G>A (p.Thr2012=) rs149961653
NM_001367624.1(ZNF469):c.6075G>A (p.Ala2025=) rs373300146
NM_001367624.1(ZNF469):c.6090C>T (p.Thr2030=) rs754253956
NM_001367624.1(ZNF469):c.6091G>A (p.Glu2031Lys) rs273585622
NM_001367624.1(ZNF469):c.609C>A (p.Pro203=) rs886052390
NM_001367624.1(ZNF469):c.6179C>A (p.Ser2060Tyr) rs273585623
NM_001367624.1(ZNF469):c.6204G>A (p.Leu2068=) rs575840696
NM_001367624.1(ZNF469):c.6259G>A (p.Ala2087Thr) rs144986357
NM_001367624.1(ZNF469):c.627G>T (p.Gly209=) rs113227277
NM_001367624.1(ZNF469):c.62G>A (p.Arg21His) rs145178398
NM_001367624.1(ZNF469):c.6333C>T (p.Ala2111=) rs1039243677
NM_001367624.1(ZNF469):c.6388C>G (p.Leu2130Val) rs562559927
NM_001367624.1(ZNF469):c.6444del (p.Gln2149fs) rs886044697
NM_001367624.1(ZNF469):c.6461C>T (p.Pro2154Leu) rs950986305
NM_001367624.1(ZNF469):c.6462G>A (p.Pro2154=) rs61472141
NM_001367624.1(ZNF469):c.6470G>A (p.Arg2157Lys) rs13334190
NM_001367624.1(ZNF469):c.6480C>T (p.Pro2160=) rs370190101
NM_001367624.1(ZNF469):c.6489G>A (p.Gln2163=) rs572299080
NM_001367624.1(ZNF469):c.6537T>C (p.Asp2179=) rs961670323
NM_001367624.1(ZNF469):c.6552G>T (p.Thr2184=) rs12919507
NM_001367624.1(ZNF469):c.6599C>T (p.Thr2200Ile) rs1465493306
NM_001367624.1(ZNF469):c.6629T>C (p.Leu2210Pro) rs564413710
NM_001367624.1(ZNF469):c.6664dup (p.Leu2222fs) rs1361564558
NM_001367624.1(ZNF469):c.6665T>C (p.Leu2222Pro) rs78213929
NM_001367624.1(ZNF469):c.6777G>A (p.Glu2259=) rs76442115
NM_001367624.1(ZNF469):c.6779A>G (p.Lys2260Arg) rs75136873
NM_001367624.1(ZNF469):c.6800G>A (p.Arg2267Gln) rs181887079
NM_001367624.1(ZNF469):c.6801A>T (p.Arg2267=) rs542478842
NM_001367624.1(ZNF469):c.6809C>A (p.Ser2270Tyr) rs273585624
NM_001367624.1(ZNF469):c.6841G>A (p.Val2281Met) rs986749671
NM_001367624.1(ZNF469):c.6846C>T (p.Ala2282=) rs748097865
NM_001367624.1(ZNF469):c.6880G>A (p.Gly2294Arg) rs773187176
NM_001367624.1(ZNF469):c.6944C>G (p.Pro2315Arg) rs77490207
NM_001367624.1(ZNF469):c.6965T>C (p.Met2322Thr) rs531612776
NM_001367624.1(ZNF469):c.6978C>G (p.His2326Gln) rs185282301
NM_001367624.1(ZNF469):c.6978C>T (p.His2326=) rs185282301
NM_001367624.1(ZNF469):c.6984G>A (p.Ser2328=) rs764025593
NM_001367624.1(ZNF469):c.699C>T (p.Asp233=) rs886052391
NM_001367624.1(ZNF469):c.7062G>A (p.Thr2354=) rs866760637
NM_001367624.1(ZNF469):c.7079C>T (p.Pro2360Leu) rs76389306
NM_001367624.1(ZNF469):c.7089C>T (p.Pro2363=) rs779456576
NM_001367624.1(ZNF469):c.7111G>A (p.Gly2371Arg) rs886052408
NM_001367624.1(ZNF469):c.7116C>G (p.Thr2372=) rs762487170
NM_001367624.1(ZNF469):c.7140A>G (p.Pro2380=) rs1396219207
NM_001367624.1(ZNF469):c.7156G>C (p.Gly2386Arg) rs12598474
NM_001367624.1(ZNF469):c.7159C>T (p.Arg2387Cys) rs886052409
NM_001367624.1(ZNF469):c.7195C>T (p.Pro2399Ser) rs759032227
NM_001367624.1(ZNF469):c.720G>A (p.Glu240=) rs273585632
NM_001367624.1(ZNF469):c.725G>T (p.Ser242Ile) rs536586591
NM_001367624.1(ZNF469):c.725_726delinsTT (p.Ser242Ile) rs886043704
NM_001367624.1(ZNF469):c.7265C>A (p.Ser2422Tyr) rs201540905
NM_001367624.1(ZNF469):c.7267C>A (p.Pro2423Thr) rs199727372
NM_001367624.1(ZNF469):c.7269C>T (p.Pro2423=) rs560708919
NM_001367624.1(ZNF469):c.7466G>A (p.Arg2489Gln) rs547492890
NM_001367624.1(ZNF469):c.7487G>A (p.Arg2496Gln) rs878852985
NM_001367624.1(ZNF469):c.7497G>A (p.Pro2499=) rs768288160
NM_001367624.1(ZNF469):c.749T>A (p.Val250Asp) rs764273631
NM_001367624.1(ZNF469):c.7508C>A (p.Ala2503Glu) rs141218390
NM_001367624.1(ZNF469):c.7514C>T (p.Pro2505Leu) rs552311966
NM_001367624.1(ZNF469):c.751C>A (p.Pro251Thr) rs540655479
NM_001367624.1(ZNF469):c.7523C>T (p.Ala2508Val) rs570690992
NM_001367624.1(ZNF469):c.7553C>A (p.Pro2518His) rs201943633
NM_001367624.1(ZNF469):c.756C>T (p.Pro252=) rs767535517
NM_001367624.1(ZNF469):c.7574C>T (p.Pro2525Leu) rs756003807
NM_001367624.1(ZNF469):c.759C>T (p.Ala253=) rs975846019
NM_001367624.1(ZNF469):c.7611G>C (p.Glu2537Asp) rs199519673
NM_001367624.1(ZNF469):c.7628G>A (p.Arg2543Gln) rs771550262
NM_001367624.1(ZNF469):c.7675A>G (p.Lys2559Glu) rs146789160
NM_001367624.1(ZNF469):c.7707C>T (p.His2569=) rs140697844
NM_001367624.1(ZNF469):c.7716G>A (p.Gln2572=) rs775513309
NM_001367624.1(ZNF469):c.7720C>T (p.His2574Tyr) rs886052410
NM_001367624.1(ZNF469):c.7764G>A (p.Pro2588=) rs117149938
NM_001367624.1(ZNF469):c.77G>C (p.Ser26Thr) rs273585616
NM_001367624.1(ZNF469):c.7805T>C (p.Leu2602Pro) rs150488251
NM_001367624.1(ZNF469):c.7817A>C (p.Gln2606Pro) rs529250336
NM_001367624.1(ZNF469):c.7831G>A (p.Glu2611Lys) rs281865151
NM_001367624.1(ZNF469):c.7850G>A (p.Arg2617Gln) rs200019229
NM_001367624.1(ZNF469):c.7931G>A (p.Arg2644Gln) rs281865152
NM_001367624.1(ZNF469):c.7935G>A (p.Glu2645=) rs189596398
NM_001367624.1(ZNF469):c.7956T>C (p.Ser2652=) rs898700599
NM_001367624.1(ZNF469):c.7981G>A (p.Gly2661Ser) rs138259179
NM_001367624.1(ZNF469):c.8003T>C (p.Met2668Thr) rs886052411
NM_001367624.1(ZNF469):c.8064C>T (p.Asp2688=) rs558108271
NM_001367624.1(ZNF469):c.8067G>A (p.Gly2689=) rs116213189
NM_001367624.1(ZNF469):c.8072A>G (p.Gln2691Arg) rs573064293
NM_001367624.1(ZNF469):c.8076G>A (p.Pro2692=) rs149200506
NM_001367624.1(ZNF469):c.8080C>T (p.Arg2694Cys) rs540443650
NM_001367624.1(ZNF469):c.8093T>A (p.Leu2698Gln) rs3812956
NM_001367624.1(ZNF469):c.80C>T (p.Pro27Leu) rs1009769670
NM_001367624.1(ZNF469):c.8112G>C (p.Glu2704Asp) rs773262065
NM_001367624.1(ZNF469):c.8121G>A (p.Ala2707=) rs116696830
NM_001367624.1(ZNF469):c.81G>A (p.Pro27=) rs534464702
NM_001367624.1(ZNF469):c.8212G>A (p.Ala2738Thr) rs3812955
NM_001367624.1(ZNF469):c.8214A>C (p.Ala2738=) rs1459194051
NM_001367624.1(ZNF469):c.8330A>T (p.Asp2777Val) rs3812954
NM_001367624.1(ZNF469):c.8344C>T (p.His2782Tyr) rs553227769
NM_001367624.1(ZNF469):c.8381C>T (p.Thr2794Met) rs202188220
NM_001367624.1(ZNF469):c.8387C>G (p.Pro2796Arg) rs886052412
NM_001367624.1(ZNF469):c.8409C>T (p.Pro2803=) rs376502074
NM_001367624.1(ZNF469):c.8425C>G (p.Pro2809Ala) rs794727257
NM_001367624.1(ZNF469):c.8430G>A (p.Ala2810=) rs574024256
NM_001367624.1(ZNF469):c.8438C>G (p.Thr2813Ser) rs985304000
NM_001367624.1(ZNF469):c.8477A>G (p.Asp2826Gly) rs886043475
NM_001367624.1(ZNF469):c.8489G>C (p.Gly2830Ala) rs541325052
NM_001367624.1(ZNF469):c.8503G>C (p.Glu2835Gln) rs200153921
NM_001367624.1(ZNF469):c.8577C>T (p.Phe2859=) rs1057524534
NM_001367624.1(ZNF469):c.8599G>A (p.Gly2867Ser) rs745468033
NM_001367624.1(ZNF469):c.8604C>T (p.Arg2868=) rs3812953
NM_001367624.1(ZNF469):c.8625G>A (p.Pro2875=) rs138771545
NM_001367624.1(ZNF469):c.8627A>G (p.His2876Arg) rs1983014
NM_001367624.1(ZNF469):c.8642G>A (p.Arg2881His) rs142753357
NM_001367624.1(ZNF469):c.8642G>T (p.Arg2881Leu) rs142753357
NM_001367624.1(ZNF469):c.8654C>T (p.Pro2885Leu) rs886052413
NM_001367624.1(ZNF469):c.8694C>T (p.Gly2898=) rs114884145
NM_001367624.1(ZNF469):c.869C>T (p.Ala290Val) rs117501524
NM_001367624.1(ZNF469):c.8705C>T (p.Thr2902Met) rs536725615
NM_001367624.1(ZNF469):c.8762G>A (p.Cys2921Tyr) rs1029645463
NM_001367624.1(ZNF469):c.8785G>A (p.Glu2929Lys) rs578166707
NM_001367624.1(ZNF469):c.8788G>T (p.Asp2930Tyr) rs76792613
NM_001367624.1(ZNF469):c.8801T>A (p.Leu2934Gln) rs764531239
NM_001367624.1(ZNF469):c.8806G>A (p.Glu2936Lys) rs762301873
NM_001367624.1(ZNF469):c.8856C>T (p.Asp2952=) rs766581620
NM_001367624.1(ZNF469):c.885C>T (p.His295=) rs928185688
NM_001367624.1(ZNF469):c.8868C>T (p.Pro2956=) rs137930753
NM_001367624.1(ZNF469):c.8869G>A (p.Gly2957Ser) rs573884006
NM_001367624.1(ZNF469):c.8941G>T (p.Asp2981Tyr) rs1343847655
NM_001367624.1(ZNF469):c.8974A>C (p.Met2992Leu) rs886052414
NM_001367624.1(ZNF469):c.8984C>T (p.Ala2995Val) rs759398721
NM_001367624.1(ZNF469):c.8996G>T (p.Gly2999Val) rs273585625
NM_001367624.1(ZNF469):c.9004A>C (p.Met3002Leu) rs141776185
NM_001367624.1(ZNF469):c.9018C>T (p.Ala3006=) rs1048591670
NM_001367624.1(ZNF469):c.9024C>T (p.Asp3008=) rs886052415
NM_001367624.1(ZNF469):c.9055G>A (p.Glu3019Lys) rs765339766
NM_001367624.1(ZNF469):c.9079C>T (p.Arg3027Cys) rs376513000
NM_001367624.1(ZNF469):c.9087C>T (p.Asp3029=) rs780843955
NM_001367624.1(ZNF469):c.9120G>A (p.Pro3040=) rs534910156
NM_001367624.1(ZNF469):c.9125G>A (p.Arg3042His) rs150598363
NM_001367624.1(ZNF469):c.9131C>T (p.Thr3044Met) rs273585626
NM_001367624.1(ZNF469):c.9161A>C (p.Glu3054Ala) rs139565761
NM_001367624.1(ZNF469):c.9174G>A (p.Leu3058=) rs886052416
NM_001367624.1(ZNF469):c.9245C>T (p.Ala3082Val) rs1015869921
NM_001367624.1(ZNF469):c.9268C>T (p.Arg3090Ter) rs764139968
NM_001367624.1(ZNF469):c.9279G>T (p.Glu3093Asp) rs886052417
NM_001367624.1(ZNF469):c.9316C>T (p.Arg3106Trp) rs1292941352
NM_001367624.1(ZNF469):c.9321G>A (p.Pro3107=) rs543846859
NM_001367624.1(ZNF469):c.9335G>A (p.Arg3112Gln) rs942909542
NM_001367624.1(ZNF469):c.9368G>A (p.Arg3123His) rs536601676
NM_001367624.1(ZNF469):c.9373C>T (p.Arg3125Cys) rs543370102
NM_001367624.1(ZNF469):c.942G>A (p.Pro314=) rs767588443
NM_001367624.1(ZNF469):c.9448G>A (p.Glu3150Lys) rs777096338
NM_001367624.1(ZNF469):c.946G>A (p.Glu316Lys) rs368772806
NM_001367624.1(ZNF469):c.9516C>G (p.Ala3172=) rs577913880
NM_001367624.1(ZNF469):c.9516C>T (p.Ala3172=) rs577913880
NM_001367624.1(ZNF469):c.951C>T (p.Ala317=) rs561239255
NM_001367624.1(ZNF469):c.952G>A (p.Val318Met) rs139066376
NM_001367624.1(ZNF469):c.9532G>A (p.Gly3178Ser) rs887755283
NM_001367624.1(ZNF469):c.9555C>G (p.Ala3185=) rs273585636
NM_001367624.1(ZNF469):c.9622C>T (p.Arg3208Trp) rs936945500
NM_001367624.1(ZNF469):c.963C>T (p.Gly321=) rs758193918
NM_001367624.1(ZNF469):c.9663C>T (p.Ser3221=) rs1555520265
NM_001367624.1(ZNF469):c.9673G>A (p.Ala3225Thr) rs1046436333
NM_001367624.1(ZNF469):c.9676C>A (p.His3226Asn) rs867530230
NM_001367624.1(ZNF469):c.9696G>A (p.Thr3232=) rs573582117
NM_001367624.1(ZNF469):c.9705G>A (p.Ala3235=) rs757816736
NM_001367624.1(ZNF469):c.9784G>T (p.Ala3262Ser) rs886052418
NM_001367624.1(ZNF469):c.9833C>A (p.Thr3278Asn) rs571738263
NM_001367624.1(ZNF469):c.9849C>T (p.Asp3283=) rs949391158
NM_001367624.1(ZNF469):c.9850G>A (p.Gly3284Arg) rs773064083
NM_001367624.1(ZNF469):c.9894C>T (p.Asp3298=) rs551298094
NM_001367624.1(ZNF469):c.98C>T (p.Pro33Leu) rs752770883
NM_001367624.1(ZNF469):c.9919A>G (p.Thr3307Ala) rs273585627
NM_001367624.1(ZNF469):c.9921G>A (p.Thr3307=) rs533072680
NM_001367624.1(ZNF469):c.992C>T (p.Ala331Val) rs149485731
NM_001367624.1(ZNF469):c.9999G>A (p.Lys3333=) rs781724789
NM_001367624.1(ZNF469):c.99G>A (p.Pro33=) rs273585631
ZNF469, 1-BP DEL, 5943A
ZNF469, 1-BP DEL, 9527G

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.