ClinVar Miner

List of variants in gene ZNF469 reported by Illumina Clinical Services Laboratory,Illumina

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 252
Download table as spreadsheet
NM_001127464.2(ZNF469):c.*870delT rs35684712
NM_001127464.2(ZNF469):c.2914_2919delGGCGGC (p.Gly972_Gly973del) rs775423936
NM_001127464.2(ZNF469):c.2951_2953delACG (p.Asp984del) rs886052397
NM_001127464.2(ZNF469):c.4448_4450delTGC (p.Leu1483del) rs555544144
NM_001367624.1(ZNF469):c.*1001A>G rs3848234
NM_001367624.1(ZNF469):c.*1071A>T rs536887736
NM_001367624.1(ZNF469):c.*1323G>A rs780254370
NM_001367624.1(ZNF469):c.*1348G>A rs886052428
NM_001367624.1(ZNF469):c.*216G>A rs146964491
NM_001367624.1(ZNF469):c.*218G>A rs137889724
NM_001367624.1(ZNF469):c.*264A>G rs193210256
NM_001367624.1(ZNF469):c.*285C>T rs35994806
NM_001367624.1(ZNF469):c.*420G>A rs45532839
NM_001367624.1(ZNF469):c.*421G>T rs148260049
NM_001367624.1(ZNF469):c.*46C>A rs78600508
NM_001367624.1(ZNF469):c.*491T>C rs557906701
NM_001367624.1(ZNF469):c.*492G>A rs190108769
NM_001367624.1(ZNF469):c.*499A>G rs537339757
NM_001367624.1(ZNF469):c.*518G>A rs563015267
NM_001367624.1(ZNF469):c.*547G>T rs370886541
NM_001367624.1(ZNF469):c.*551_*577TCCTCCCTCTGACCACAGGGTCATGCC[3] rs6145934
NM_001367624.1(ZNF469):c.*599C>G rs146233624
NM_001367624.1(ZNF469):c.*617C>T rs886052422
NM_001367624.1(ZNF469):c.*618T>G rs3859020
NM_001367624.1(ZNF469):c.*634C>A rs74032868
NM_001367624.1(ZNF469):c.*649C>G rs561472955
NM_001367624.1(ZNF469):c.*664C>T rs886052423
NM_001367624.1(ZNF469):c.*665G>A rs75706884
NM_001367624.1(ZNF469):c.*788G>A rs3894713
NM_001367624.1(ZNF469):c.*792A>G rs886052424
NM_001367624.1(ZNF469):c.*845T>C rs7187709
NM_001367624.1(ZNF469):c.*879T>C rs886052426
NM_001367624.1(ZNF469):c.*8G>A rs45504291
NM_001367624.1(ZNF469):c.*907G>A rs1048192
NM_001367624.1(ZNF469):c.*921_*922insG rs11382974
NM_001367624.1(ZNF469):c.*932A>G rs886052427
NM_001367624.1(ZNF469):c.1020C>T (p.Gly340=) rs273585633
NM_001367624.1(ZNF469):c.10325G>T (p.Arg3442Met) rs199528724
NM_001367624.1(ZNF469):c.10326G>C (p.Arg3442Ser) rs56236932
NM_001367624.1(ZNF469):c.10328G>T (p.Gly3443Val) rs140056980
NM_001367624.1(ZNF469):c.10330G>C (p.Gly3444Arg) rs569602115
NM_001367624.1(ZNF469):c.10331G>T (p.Gly3444Val) rs530393871
NM_001367624.1(ZNF469):c.1048G>A (p.Asp350Asn) rs568820656
NM_001367624.1(ZNF469):c.10572C>T (p.Pro3524=) rs763317477
NM_001367624.1(ZNF469):c.10599C>T (p.Pro3533=) rs78022634
NM_001367624.1(ZNF469):c.1069T>C (p.Ser357Pro) rs11648572
NM_001367624.1(ZNF469):c.10700G>A (p.Gly3567Glu) rs199610834
NM_001367624.1(ZNF469):c.10708G>A (p.Ala3570Thr) rs57052487
NM_001367624.1(ZNF469):c.10740C>T (p.Asn3580=) rs527707590
NM_001367624.1(ZNF469):c.10972G>C (p.Glu3658Gln) rs1105066
NM_001367624.1(ZNF469):c.10975G>A (p.Gly3659Arg) rs3812951
NM_001367624.1(ZNF469):c.1098A>C (p.Arg366Ser) rs11640794
NM_001367624.1(ZNF469):c.10990= (p.Ala3664=) rs904783
NM_001367624.1(ZNF469):c.11052G>A (p.Ser3684=) rs780722176
NM_001367624.1(ZNF469):c.11107G>A (p.Val3703Met) rs151127652
NM_001367624.1(ZNF469):c.11109G>T (p.Val3703=) rs886052419
NM_001367624.1(ZNF469):c.11203A>G (p.Ser3735Gly) rs536054902
NM_001367624.1(ZNF469):c.11409G>C (p.Gly3803=) rs150233193
NM_001367624.1(ZNF469):c.11425G>A (p.Glu3809Lys) rs201834513
NM_001367624.1(ZNF469):c.1143C>A (p.Pro381=) rs74032864
NM_001367624.1(ZNF469):c.11536C>G (p.Arg3846Gly) rs886052420
NM_001367624.1(ZNF469):c.11546G>A (p.Arg3849Gln) rs775672255
NM_001367624.1(ZNF469):c.11566C>T (p.Arg3856Cys) rs762894872
NM_001367624.1(ZNF469):c.11658G>C (p.Gln3886His) rs182269913
NM_001367624.1(ZNF469):c.11757A>G (p.Pro3919=) rs4782301
NM_001367624.1(ZNF469):c.11809G>A (p.Gly3937Arg) rs886052421
NM_001367624.1(ZNF469):c.11822C>T (p.Thr3941Ile) rs766057875
NM_001367624.1(ZNF469):c.11856C>T (p.Ser3952=) rs4782362
NM_001367624.1(ZNF469):c.1285G>A (p.Ala429Thr) rs113937803
NM_001367624.1(ZNF469):c.139G>A (p.Gly47Ser) rs138954293
NM_001367624.1(ZNF469):c.142G>A (p.Ala48Thr) rs886052388
NM_001367624.1(ZNF469):c.1471G>A (p.Ala491Thr) rs117555121
NM_001367624.1(ZNF469):c.1489G>A (p.Gly497Arg) rs28723506
NM_001367624.1(ZNF469):c.1528G>A (p.Gly510Ser) rs755555951
NM_001367624.1(ZNF469):c.1529G>C (p.Gly510Ala) rs7199961
NM_001367624.1(ZNF469):c.1547G>C (p.Gly516Ala) rs753160761
NM_001367624.1(ZNF469):c.1584G>A (p.Pro528=) rs143852982
NM_001367624.1(ZNF469):c.1615A>T (p.Ser539Cys) rs189476639
NM_001367624.1(ZNF469):c.1663G>A (p.Asp555Asn) rs749179728
NM_001367624.1(ZNF469):c.1697C>T (p.Ala566Val) rs181785233
NM_001367624.1(ZNF469):c.1719C>T (p.His573=) rs552893295
NM_001367624.1(ZNF469):c.1776A>G (p.Pro592=) rs12927001
NM_001367624.1(ZNF469):c.1827G>A (p.Ser609=) rs148616993
NM_001367624.1(ZNF469):c.1875C>A (p.Leu625=) rs886052392
NM_001367624.1(ZNF469):c.1882C>A (p.Pro628Thr) rs886052393
NM_001367624.1(ZNF469):c.1896G>A (p.Ser632=) rs554795578
NM_001367624.1(ZNF469):c.1932G>C (p.Thr644=) rs539996728
NM_001367624.1(ZNF469):c.1982A>G (p.Tyr661Cys) rs886052394
NM_001367624.1(ZNF469):c.1994C>T (p.Pro665Leu) rs184583062
NM_001367624.1(ZNF469):c.2034C>T (p.Ala678=) rs58401704
NM_001367624.1(ZNF469):c.2035G>A (p.Glu679Lys) rs551591362
NM_001367624.1(ZNF469):c.2085C>T (p.Pro695=) rs74547407
NM_001367624.1(ZNF469):c.2130T>C (p.Pro710=) rs12918876
NM_001367624.1(ZNF469):c.2132C>G (p.Pro711Arg) rs571184307
NM_001367624.1(ZNF469):c.2270T>G (p.Leu757Arg) rs753664726
NM_001367624.1(ZNF469):c.2361C>G (p.His787Gln) rs886052395
NM_001367624.1(ZNF469):c.2370G>A (p.Leu790=) rs147859144
NM_001367624.1(ZNF469):c.2407G>T (p.Ala803Ser) rs113484918
NM_001367624.1(ZNF469):c.2574G>C (p.Pro858=) rs74384633
NM_001367624.1(ZNF469):c.2652C>G (p.Pro884=) rs767431034
NM_001367624.1(ZNF469):c.2666C>T (p.Ala889Val) rs145186655
NM_001367624.1(ZNF469):c.2693C>T (p.Pro898Leu) rs754458926
NM_001367624.1(ZNF469):c.2699C>T (p.Pro900Leu) rs273585618
NM_001367624.1(ZNF469):c.2717C>T (p.Pro906Leu) rs77951481
NM_001367624.1(ZNF469):c.2803G>A (p.Glu935Lys) rs117995699
NM_001367624.1(ZNF469):c.2810A>T (p.Asp937Val) rs550198026
NM_001367624.1(ZNF469):c.2814G>A (p.Ala938=) rs140480823
NM_001367624.1(ZNF469):c.2873T>C (p.Leu958Pro) rs370402083
NM_001367624.1(ZNF469):c.2913C>A (p.Gly971=) rs60462217
NM_001367624.1(ZNF469):c.2929G>C (p.Gly977Arg) rs770061832
NM_001367624.1(ZNF469):c.2931C>T (p.Gly977=) rs539527724
NM_001367624.1(ZNF469):c.2952C>T (p.Asp984=) rs886052398
NM_001367624.1(ZNF469):c.2953G>A (p.Gly985Ser) rs886052399
NM_001367624.1(ZNF469):c.2986C>A (p.Arg996Ser) rs886052400
NM_001367624.1(ZNF469):c.3125G>A (p.Arg1042Gln) rs181077813
NM_001367624.1(ZNF469):c.3153T>C (p.Ile1051=) rs9924504
NM_001367624.1(ZNF469):c.3183C>T (p.Arg1061=) rs756703220
NM_001367624.1(ZNF469):c.3255G>C (p.Glu1085Asp) rs886052401
NM_001367624.1(ZNF469):c.3321G>A (p.Arg1107=) rs763826959
NM_001367624.1(ZNF469):c.3326C>T (p.Pro1109Leu) rs562264117
NM_001367624.1(ZNF469):c.3472C>T (p.Pro1158Ser) rs184894059
NM_001367624.1(ZNF469):c.3485G>T (p.Arg1162Leu) rs886052402
NM_001367624.1(ZNF469):c.3506C>T (p.Pro1169Leu) rs769853271
NM_001367624.1(ZNF469):c.3516T>C (p.Arg1172=) rs111557381
NM_001367624.1(ZNF469):c.3522G>A (p.Pro1174=) rs9938800
NM_001367624.1(ZNF469):c.3565C>A (p.Pro1189Thr) rs766878740
NM_001367624.1(ZNF469):c.3568A>G (p.Lys1190Glu) rs7197071
NM_001367624.1(ZNF469):c.3650C>T (p.Pro1217Leu) rs115183769
NM_001367624.1(ZNF469):c.376A>G (p.Ser126Gly) rs886052389
NM_001367624.1(ZNF469):c.3776G>A (p.Ser1259Asn) rs886052403
NM_001367624.1(ZNF469):c.3894G>C (p.Val1298=) rs115790991
NM_001367624.1(ZNF469):c.3918G>A (p.Gly1306=) rs768501538
NM_001367624.1(ZNF469):c.3931C>T (p.Pro1311Ser) rs187453092
NM_001367624.1(ZNF469):c.3950A>G (p.Lys1317Arg) rs772817384
NM_001367624.1(ZNF469):c.402C>T (p.Asp134=) rs569036398
NM_001367624.1(ZNF469):c.4195C>T (p.His1399Tyr) rs886052404
NM_001367624.1(ZNF469):c.4198C>A (p.Pro1400Thr) rs145158875
NM_001367624.1(ZNF469):c.4216G>T (p.Asp1406Tyr) rs557997233
NM_001367624.1(ZNF469):c.4227G>A (p.Pro1409=) rs371897217
NM_001367624.1(ZNF469):c.4343C>T (p.Pro1448Leu) rs4782300
NM_001367624.1(ZNF469):c.4363C>G (p.Leu1455Val) rs116532825
NM_001367624.1(ZNF469):c.4376T>G (p.Leu1459Arg) rs559625962
NM_001367624.1(ZNF469):c.4406A>G (p.Tyr1469Cys) rs116072997
NM_001367624.1(ZNF469):c.4419T>G (p.Ser1473=) rs12445417
NM_001367624.1(ZNF469):c.4421C>T (p.Ala1474Val) rs199897247
NM_001367624.1(ZNF469):c.4434C>T (p.Ser1478=) rs74032865
NM_001367624.1(ZNF469):c.4456G>A (p.Asp1486Asn) rs373777402
NM_001367624.1(ZNF469):c.4472C>T (p.Thr1491Met) rs375045076
NM_001367624.1(ZNF469):c.4479G>A (p.Pro1493=) rs373162171
NM_001367624.1(ZNF469):c.4574G>C (p.Ser1525Thr) rs545662898
NM_001367624.1(ZNF469):c.470G>A (p.Gly157Glu) rs781096189
NM_001367624.1(ZNF469):c.4778C>T (p.Ser1593Leu) rs768864900
NM_001367624.1(ZNF469):c.4849C>T (p.Pro1617Ser) rs557351664
NM_001367624.1(ZNF469):c.4884G>A (p.Thr1628=) rs141666432
NM_001367624.1(ZNF469):c.4892G>A (p.Gly1631Glu) rs755244502
NM_001367624.1(ZNF469):c.4907A>G (p.His1636Arg) rs557636016
NM_001367624.1(ZNF469):c.4909C>T (p.Arg1637Trp) rs575820215
NM_001367624.1(ZNF469):c.4926G>A (p.Ser1642=) rs117310292
NM_001367624.1(ZNF469):c.5010C>A (p.Ala1670=) rs766852564
NM_001367624.1(ZNF469):c.5087C>T (p.Pro1696Leu) rs115487796
NM_001367624.1(ZNF469):c.5145G>A (p.Arg1715=) rs577775261
NM_001367624.1(ZNF469):c.5150C>G (p.Pro1717Arg) rs544832628
NM_001367624.1(ZNF469):c.5162G>T (p.Cys1721Phe) rs568197988
NM_001367624.1(ZNF469):c.5340C>G (p.Pro1780=) rs184374078
NM_001367624.1(ZNF469):c.5488G>T (p.Ala1830Ser) rs778548266
NM_001367624.1(ZNF469):c.5548C>A (p.Pro1850Thr) rs199932922
NM_001367624.1(ZNF469):c.5577G>A (p.Pro1859=) rs764487066
NM_001367624.1(ZNF469):c.5661C>G (p.Thr1887=) rs9931465
NM_001367624.1(ZNF469):c.5697C>T (p.Ser1899=) rs111986360
NM_001367624.1(ZNF469):c.5707C>T (p.Arg1903Cys) rs757657013
NM_001367624.1(ZNF469):c.5856T>C (p.Cys1952=) rs186652137
NM_001367624.1(ZNF469):c.5862C>G (p.Pro1954=) rs201666199
NM_001367624.1(ZNF469):c.5912C>T (p.Ala1971Val) rs886052406
NM_001367624.1(ZNF469):c.6029G>A (p.Gly2010Glu) rs886052407
NM_001367624.1(ZNF469):c.6032G>A (p.Gly2011Asp) rs79155191
NM_001367624.1(ZNF469):c.6075G>A (p.Ala2025=) rs373300146
NM_001367624.1(ZNF469):c.609C>A (p.Pro203=) rs886052390
NM_001367624.1(ZNF469):c.6259G>A (p.Ala2087Thr) rs144986357
NM_001367624.1(ZNF469):c.627G>T (p.Gly209=) rs113227277
NM_001367624.1(ZNF469):c.62G>A (p.Arg21His) rs145178398
NM_001367624.1(ZNF469):c.6388C>G (p.Leu2130Val) rs562559927
NM_001367624.1(ZNF469):c.6462G>A (p.Pro2154=) rs61472141
NM_001367624.1(ZNF469):c.6470G>A (p.Arg2157Lys) rs13334190
NM_001367624.1(ZNF469):c.6480C>T (p.Pro2160=) rs370190101
NM_001367624.1(ZNF469):c.6552G>T (p.Thr2184=) rs12919507
NM_001367624.1(ZNF469):c.6665T>C (p.Leu2222Pro) rs78213929
NM_001367624.1(ZNF469):c.6777G>A (p.Glu2259=) rs76442115
NM_001367624.1(ZNF469):c.6779A>G (p.Lys2260Arg) rs75136873
NM_001367624.1(ZNF469):c.6846C>T (p.Ala2282=) rs748097865
NM_001367624.1(ZNF469):c.6944C>G (p.Pro2315Arg) rs77490207
NM_001367624.1(ZNF469):c.699C>T (p.Asp233=) rs886052391
NM_001367624.1(ZNF469):c.7062G>A (p.Thr2354=) rs866760637
NM_001367624.1(ZNF469):c.7079C>T (p.Pro2360Leu) rs76389306
NM_001367624.1(ZNF469):c.7111G>A (p.Gly2371Arg) rs886052408
NM_001367624.1(ZNF469):c.7116C>G (p.Thr2372=) rs762487170
NM_001367624.1(ZNF469):c.7156G>C (p.Gly2386Arg) rs12598474
NM_001367624.1(ZNF469):c.7159C>T (p.Arg2387Cys) rs886052409
NM_001367624.1(ZNF469):c.7195C>T (p.Pro2399Ser) rs759032227
NM_001367624.1(ZNF469):c.725G>T (p.Ser242Ile) rs536586591
NM_001367624.1(ZNF469):c.7265C>A (p.Ser2422Tyr) rs201540905
NM_001367624.1(ZNF469):c.7267C>A (p.Pro2423Thr) rs199727372
NM_001367624.1(ZNF469):c.7497G>A (p.Pro2499=) rs768288160
NM_001367624.1(ZNF469):c.7508C>A (p.Ala2503Glu) rs141218390
NM_001367624.1(ZNF469):c.7514C>T (p.Pro2505Leu) rs552311966
NM_001367624.1(ZNF469):c.7553C>A (p.Pro2518His) rs201943633
NM_001367624.1(ZNF469):c.7716G>A (p.Gln2572=) rs775513309
NM_001367624.1(ZNF469):c.7720C>T (p.His2574Tyr) rs886052410
NM_001367624.1(ZNF469):c.7805T>C (p.Leu2602Pro) rs150488251
NM_001367624.1(ZNF469):c.7817A>C (p.Gln2606Pro) rs529250336
NM_001367624.1(ZNF469):c.8003T>C (p.Met2668Thr) rs886052411
NM_001367624.1(ZNF469):c.8067G>A (p.Gly2689=) rs116213189
NM_001367624.1(ZNF469):c.8080C>T (p.Arg2694Cys) rs540443650
NM_001367624.1(ZNF469):c.8093T>A (p.Leu2698Gln) rs3812956
NM_001367624.1(ZNF469):c.8112G>C (p.Glu2704Asp) rs773262065
NM_001367624.1(ZNF469):c.8121G>A (p.Ala2707=) rs116696830
NM_001367624.1(ZNF469):c.81G>A (p.Pro27=) rs534464702
NM_001367624.1(ZNF469):c.8212G>A (p.Ala2738Thr) rs3812955
NM_001367624.1(ZNF469):c.8330A>T (p.Asp2777Val) rs3812954
NM_001367624.1(ZNF469):c.8344C>T (p.His2782Tyr) rs553227769
NM_001367624.1(ZNF469):c.8387C>G (p.Pro2796Arg) rs886052412
NM_001367624.1(ZNF469):c.8430G>A (p.Ala2810=) rs574024256
NM_001367624.1(ZNF469):c.8503G>C (p.Glu2835Gln) rs200153921
NM_001367624.1(ZNF469):c.8604C>T (p.Arg2868=) rs3812953
NM_001367624.1(ZNF469):c.8625G>A (p.Pro2875=) rs138771545
NM_001367624.1(ZNF469):c.8627A>G (p.His2876Arg) rs1983014
NM_001367624.1(ZNF469):c.8642G>A (p.Arg2881His) rs142753357
NM_001367624.1(ZNF469):c.8642G>T (p.Arg2881Leu) rs142753357
NM_001367624.1(ZNF469):c.8654C>T (p.Pro2885Leu) rs886052413
NM_001367624.1(ZNF469):c.869C>T (p.Ala290Val) rs117501524
NM_001367624.1(ZNF469):c.8785G>A (p.Glu2929Lys) rs578166707
NM_001367624.1(ZNF469):c.8801T>A (p.Leu2934Gln) rs764531239
NM_001367624.1(ZNF469):c.8806G>A (p.Glu2936Lys) rs762301873
NM_001367624.1(ZNF469):c.8856C>T (p.Asp2952=) rs766581620
NM_001367624.1(ZNF469):c.8869G>A (p.Gly2957Ser) rs573884006
NM_001367624.1(ZNF469):c.8974A>C (p.Met2992Leu) rs886052414
NM_001367624.1(ZNF469):c.9004A>C (p.Met3002Leu) rs141776185
NM_001367624.1(ZNF469):c.9024C>T (p.Asp3008=) rs886052415
NM_001367624.1(ZNF469):c.9174G>A (p.Leu3058=) rs886052416
NM_001367624.1(ZNF469):c.9279G>T (p.Glu3093Asp) rs886052417
NM_001367624.1(ZNF469):c.9321G>A (p.Pro3107=) rs543846859
NM_001367624.1(ZNF469):c.9373C>T (p.Arg3125Cys) rs543370102
NM_001367624.1(ZNF469):c.942G>A (p.Pro314=) rs767588443
NM_001367624.1(ZNF469):c.951C>T (p.Ala317=) rs561239255
NM_001367624.1(ZNF469):c.952G>A (p.Val318Met) rs139066376
NM_001367624.1(ZNF469):c.9555C>G (p.Ala3185=) rs273585636
NM_001367624.1(ZNF469):c.9676C>A (p.His3226Asn) rs867530230
NM_001367624.1(ZNF469):c.9696G>A (p.Thr3232=) rs573582117
NM_001367624.1(ZNF469):c.9705G>A (p.Ala3235=) rs757816736
NM_001367624.1(ZNF469):c.9784G>T (p.Ala3262Ser) rs886052418
NM_001367624.1(ZNF469):c.9894C>T (p.Asp3298=) rs551298094
NM_001367624.1(ZNF469):c.98C>T (p.Pro33Leu) rs752770883
NM_001367624.1(ZNF469):c.9921G>A (p.Thr3307=) rs533072680

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.