ClinVar Miner

List of variants studied for Usher syndrome type 1

Included ClinVar conditions (15):
Minimum submission review status: Collection method:
Minimum conflict level:
ClinVar version:
Total variants: 757
Download table as spreadsheet
HGVS dbSNP
MYO7A, IVS27AS, G-C, -1
NM_000260.3(MYO7A):c.1969C>T rs878853236
NM_000260.3(MYO7A):c.29T>C rs878853237
NM_000260.3(MYO7A):c.3028_3029ins15 (p.?) rs782367511
NM_000260.4(MYO7A):c.1007G>A (p.Arg336His) rs45629132
NM_000260.4(MYO7A):c.1097T>C (p.Leu366Pro) rs397516281
NM_000260.4(MYO7A):c.1117C>T (p.Arg373Cys) rs868979094
NM_000260.4(MYO7A):c.1123C>G (p.Leu375Val) rs782728522
NM_000260.4(MYO7A):c.1132C>T (p.Arg378Cys) rs199818783
NM_000260.4(MYO7A):c.1133G>A (p.Arg378His) rs397516282
NM_000260.4(MYO7A):c.1135G>A (p.Gly379Arg) rs878853377
NM_000260.4(MYO7A):c.1142C>T (p.Thr381Met) rs782681743
NM_000260.4(MYO7A):c.1172C>T (p.Ala391Val) rs1555067608
NM_000260.4(MYO7A):c.117_132+6del rs1555051567
NM_000260.4(MYO7A):c.1183C>T (p.Arg395Cys) rs782279338
NM_000260.4(MYO7A):c.1189G>A (p.Ala397Thr) rs1297886521
NM_000260.4(MYO7A):c.1190C>A (p.Ala397Asp) rs1555067667
NM_000260.4(MYO7A):c.1200+1G>A rs397516283
NM_000260.4(MYO7A):c.1208A>G (p.Tyr403Cys) rs797044511
NM_000260.4(MYO7A):c.1232T>C (p.Val411Ala) rs369916141
NM_000260.4(MYO7A):c.133-2A>C rs782064437
NM_000260.4(MYO7A):c.133-2A>G rs782064437
NM_000260.4(MYO7A):c.133-7_146dup rs1555054558
NM_000260.4(MYO7A):c.1343+1G>A rs914189193
NM_000260.4(MYO7A):c.1344-2A>G rs111033415
NM_000260.4(MYO7A):c.1348G>C (p.Glu450Gln) rs1269622956
NM_000260.4(MYO7A):c.1349A>T (p.Glu450Val) rs1555069238
NM_000260.4(MYO7A):c.1368C>T (p.Phe456=) rs559209306
NM_000260.4(MYO7A):c.1401_1403dup (p.His468_Val469insGln) rs111033219
NM_000260.4(MYO7A):c.1403A>G (p.His468Arg) rs200304238
NM_000260.4(MYO7A):c.1496T>C (p.Ile499Thr) rs397516286
NM_000260.4(MYO7A):c.1506G>A (p.Lys502=) rs181126043
NM_000260.4(MYO7A):c.1543A>C (p.Lys515Gln) rs782023308
NM_000260.4(MYO7A):c.1555-8C>G rs1057517774
NM_000260.4(MYO7A):c.1556G>A (p.Gly519Asp) rs111033206
NM_000260.4(MYO7A):c.1575_1592del (p.Ser530_Asn535del) rs1555070062
NM_000260.4(MYO7A):c.1588_1605dup (p.Ser530_Asn535dup) rs1555070084
NM_000260.4(MYO7A):c.1591C>T (p.Gln531Ter) rs781951909
NM_000260.4(MYO7A):c.1619C>A (p.Pro540His) rs782607566
NM_000260.4(MYO7A):c.1691-2A>G rs1555072299
NM_000260.4(MYO7A):c.1721A>C (p.His574Pro) rs397516287
NM_000260.4(MYO7A):c.1726G>A (p.Asp576Asn) rs187165412
NM_000260.4(MYO7A):c.1797G>A (p.Met599Ile) rs121965082
NM_000260.4(MYO7A):c.1798-1G>A rs1555076948
NM_000260.4(MYO7A):c.1798-3C>G rs1555076939
NM_000260.4(MYO7A):c.18+2T>A rs564622720
NM_000260.4(MYO7A):c.182C>G (p.Pro61Arg) rs397516289
NM_000260.4(MYO7A):c.1845del (p.Lys615fs) rs886037762
NM_000260.4(MYO7A):c.1846C>T (p.Arg616Trp) rs369195493
NM_000260.4(MYO7A):c.1849T>C (p.Ser617Pro) rs782063761
NM_000260.4(MYO7A):c.1868G>A (p.Arg623His) rs111033416
NM_000260.4(MYO7A):c.1884C>A (p.Cys628Ter) rs121965083
NM_000260.4(MYO7A):c.19-1G>A rs111033426
NM_000260.4(MYO7A):c.19-2A>G rs1555051384
NM_000260.4(MYO7A):c.1900C>T (p.Arg634Ter) rs111033180
NM_000260.4(MYO7A):c.1935+1G>C rs1343207038
NM_000260.4(MYO7A):c.1945C>T (p.Arg649Trp) rs782503314
NM_000260.4(MYO7A):c.1952T>C (p.Leu651Pro) rs876657416
NM_000260.4(MYO7A):c.1956C>T (p.Cys652=) rs367693437
NM_000260.4(MYO7A):c.196_210del (p.Gly66_Met70del) rs1555054736
NM_000260.4(MYO7A):c.1976C>A (p.Ser659Ter) rs878853378
NM_000260.4(MYO7A):c.1996C>T (p.Arg666Ter) rs121965085
NM_000260.4(MYO7A):c.1997G>A (p.Arg666Gln) rs782396605
NM_000260.4(MYO7A):c.2002C>T (p.Arg668Cys) rs397516292
NM_000260.4(MYO7A):c.2005C>T (p.Arg669Ter) rs111033201
NM_000260.4(MYO7A):c.2006G>A (p.Arg669Gln) rs201178011
NM_000260.4(MYO7A):c.2023C>T (p.Arg675Cys) rs782459520
NM_000260.4(MYO7A):c.2122A>G (p.Met708Val) rs397516293
NM_000260.4(MYO7A):c.2187+1G>A rs111033290
NM_000260.4(MYO7A):c.218T>C (p.Leu73Pro) rs372188355
NM_000260.4(MYO7A):c.2218C>T (p.Arg740Trp) rs201234369
NM_000260.4(MYO7A):c.2239_2240AG[1] (p.Arg747fs) rs1555080760
NM_000260.4(MYO7A):c.223del (p.Asp75fs) rs876657415
NM_000260.4(MYO7A):c.224dup (p.Asp75fs) rs1224819887
NM_000260.4(MYO7A):c.2266C>T (p.Arg756Trp) rs782174733
NM_000260.4(MYO7A):c.2283-1G>T rs397516295
NM_000260.4(MYO7A):c.2283-2_2293del rs1555082041
NM_000260.4(MYO7A):c.2311G>T (p.Ala771Ser) rs782384464
NM_000260.4(MYO7A):c.2323C>T (p.Gln775Ter) rs201892914
NM_000260.4(MYO7A):c.2361C>A (p.Tyr787Ter) rs1555082145
NM_000260.4(MYO7A):c.2386C>G (p.Arg796Gly) rs111033339
NM_000260.4(MYO7A):c.2387G>A (p.Arg796Gln) rs111033224
NM_000260.4(MYO7A):c.2421C>T (p.His807=) rs782218928
NM_000260.4(MYO7A):c.2461C>T (p.Gln821Ter) rs1279918132
NM_000260.4(MYO7A):c.2476G>A (p.Ala826Thr) rs368341987
NM_000260.4(MYO7A):c.2488C>T (p.Arg830Cys) rs797044493
NM_000260.4(MYO7A):c.2489G>A (p.Arg830His) rs371029653
NM_000260.4(MYO7A):c.2522T>C (p.Leu841Pro) rs397516296
NM_000260.4(MYO7A):c.2558G>A (p.Arg853His) rs111033437
NM_000260.4(MYO7A):c.2724C>G (p.Asp908Glu) rs199979876
NM_000260.4(MYO7A):c.2724C>T (p.Asp908=) rs199979876
NM_000260.4(MYO7A):c.285+1G>C rs782661097
NM_000260.4(MYO7A):c.285+2T>G rs782292032
NM_000260.4(MYO7A):c.2850G>A (p.Leu950=) rs397516297
NM_000260.4(MYO7A):c.2878G>T (p.Glu960Ter) rs782131913
NM_000260.4(MYO7A):c.2960C>T (p.Pro987Leu) rs397516298
NM_000260.4(MYO7A):c.3049_3051del (p.Tyr1017del) rs1180304045
NM_000260.4(MYO7A):c.3109-27_3109-7dup rs1555085333
NM_000260.4(MYO7A):c.3134T>C (p.Ile1045Thr) rs377326213
NM_000260.4(MYO7A):c.313del (p.Ala104_Val105insTer) rs1555061466
NM_000260.4(MYO7A):c.318C>G (p.Asn106Lys) rs1555061483
NM_000260.4(MYO7A):c.3260T>C (p.Leu1087Pro) rs375050157
NM_000260.4(MYO7A):c.3262C>T (p.Gln1088Ter) rs376535635
NM_000260.4(MYO7A):c.3298G>T (p.Glu1100Ter) rs782468194
NM_000260.4(MYO7A):c.3310A>T (p.Lys1104Ter) rs1555085978
NM_000260.4(MYO7A):c.3375+3G>A rs397516299
NM_000260.4(MYO7A):c.3397G>A (p.Gly1133Arg) rs782313913
NM_000260.4(MYO7A):c.3437G>A (p.Arg1146Gln) rs782140421
NM_000260.4(MYO7A):c.3451C>G (p.Leu1151Val) rs782465732
NM_000260.4(MYO7A):c.3472A>G (p.Ile1158Val) rs797044517
NM_000260.4(MYO7A):c.3474C>T (p.Ile1158=) rs201834743
NM_000260.4(MYO7A):c.3476G>T (p.Gly1159Val) rs199897298
NM_000260.4(MYO7A):c.3491G>A (p.Arg1164Gln) rs782350886
NM_000260.4(MYO7A):c.3502C>T (p.Arg1168Trp) rs554073390
NM_000260.4(MYO7A):c.3503G>A (p.Arg1168Gln) rs797044516
NM_000260.4(MYO7A):c.3504-1G>C rs1555090171
NM_000260.4(MYO7A):c.3504-2A>G rs1555090168
NM_000260.4(MYO7A):c.3508G>A (p.Glu1170Lys) rs111033214
NM_000260.4(MYO7A):c.3527G>A (p.Ser1176Asn) rs373147966
NM_000260.4(MYO7A):c.3546C>A (p.Asn1182Lys) rs1555090294
NM_000260.4(MYO7A):c.3560G>T (p.Ser1187Ile) rs1555090314
NM_000260.4(MYO7A):c.3576G>A (p.Trp1192Ter) rs1253943370
NM_000260.4(MYO7A):c.358C>A (p.Arg120Ser) rs397516302
NM_000260.4(MYO7A):c.3594C>A (p.Cys1198Ter) rs782694195
NM_000260.4(MYO7A):c.3602G>C (p.Cys1201Ser) rs117966637
NM_000260.4(MYO7A):c.3610C>A (p.Pro1204Thr) rs1555090442
NM_000260.4(MYO7A):c.3631-1G>C rs1555090885
NM_000260.4(MYO7A):c.3669C>T (p.Tyr1223=) rs727504631
NM_000260.4(MYO7A):c.3689G>A (p.Arg1230His) rs368705036
NM_000260.4(MYO7A):c.3701C>G (p.Thr1234Ser) rs775908821
NM_000260.4(MYO7A):c.3719G>A (p.Arg1240Gln) rs111033178
NM_000260.4(MYO7A):c.3724C>T (p.Gln1242Ter) rs1057517857
NM_000260.4(MYO7A):c.3750+5G>A rs111033391
NM_000260.4(MYO7A):c.3764del (p.Lys1255fs) rs111033347
NM_000260.4(MYO7A):c.3797A>G (p.Asp1266Gly) rs781670345
NM_000260.4(MYO7A):c.380T>C (p.Ile127Thr) rs41298131
NM_000260.4(MYO7A):c.3815_3822del (p.Leu1272fs) rs1555091636
NM_000260.4(MYO7A):c.3827C>T (p.Ser1276Leu) rs369458838
NM_000260.4(MYO7A):c.3856G>A (p.Ala1286Thr) rs727503328
NM_000260.4(MYO7A):c.3892G>A (p.Gly1298Arg) rs727503329
NM_000260.4(MYO7A):c.3924+1G>C rs1226046110
NM_000260.4(MYO7A):c.3924G>A (p.Lys1308=) rs1349274983
NM_000260.4(MYO7A):c.392C>T (p.Pro131Leu) rs1555061692
NM_000260.4(MYO7A):c.3943G>A (p.Gly1315Ser) rs769771981
NM_000260.4(MYO7A):c.397C>A (p.His133Asn) rs111033403
NM_000260.4(MYO7A):c.397C>G (p.His133Asp) rs111033403
NM_000260.4(MYO7A):c.397dup (p.His133fs) rs111033187
NM_000260.4(MYO7A):c.3998_4012del (p.Gln1333_Glu1337del) rs1555092931
NM_000260.4(MYO7A):c.3G>A (p.Met1Ile) rs782787126
NM_000260.4(MYO7A):c.4006C>T (p.Gln1336Ter)
NM_000260.4(MYO7A):c.4018G>A (p.Ala1340Thr) rs376291076
NM_000260.4(MYO7A):c.4018delinsCC (p.Ala1340fs) rs1555092993
NM_000260.4(MYO7A):c.401T>A (p.Ile134Asn) rs111033181
NM_000260.4(MYO7A):c.4024del (p.Trp1342fs) rs1555093028
NM_000260.4(MYO7A):c.4029G>C (p.Arg1343Ser) rs763469001
NM_000260.4(MYO7A):c.4033_4035TTC[1] (p.Phe1346del) rs1437625274
NM_000260.4(MYO7A):c.4039C>A (p.Arg1347Ser) rs111534474
NM_000260.4(MYO7A):c.4108_4111del (p.Gln1370fs) rs1480697910
NM_000260.4(MYO7A):c.4115T>G (p.Val1372Gly) rs869312181
NM_000260.4(MYO7A):c.4117C>T (p.Arg1373Ter) rs766641715
NM_000260.4(MYO7A):c.4153-10C>G rs397516306
NM_000260.4(MYO7A):c.4153-11C>T rs727503330
NM_000260.4(MYO7A):c.4153-7C>A rs369489756
NM_000260.4(MYO7A):c.4153-8C>G rs143216377
NM_000260.4(MYO7A):c.4184dup (p.Tyr1396fs) rs1555095933
NM_000260.4(MYO7A):c.4195G>C (p.Asp1399His) rs373080197
NM_000260.4(MYO7A):c.4254del (p.Asp1419fs) rs1555096070
NM_000260.4(MYO7A):c.4280C>T (p.Thr1427Met) rs547006116
NM_000260.4(MYO7A):c.4297del (p.Gln1433fs) rs1555096223
NM_000260.4(MYO7A):c.4338_4340GAG[1] (p.Arg1448del) rs1432069074
NM_000260.4(MYO7A):c.4360G>A (p.Val1454Ile) rs397516309
NM_000260.4(MYO7A):c.4450C>T (p.Leu1484Phe) rs200416912
NM_000260.4(MYO7A):c.448C>T (p.Arg150Ter) rs121965079
NM_000260.4(MYO7A):c.449G>A (p.Arg150Gln) rs202245413
NM_000260.4(MYO7A):c.4500_4501TG[1] (p.Val1501fs) rs1555099541
NM_000260.4(MYO7A):c.4569-1G>A rs775792432
NM_000260.4(MYO7A):c.4576del (p.Arg1526fs) rs1555100200
NM_000260.4(MYO7A):c.4642del (p.Gly1547_Leu1548insTer) rs1555100273
NM_000260.4(MYO7A):c.4659_4660del (p.Cys1554fs) rs1555100315
NM_000260.4(MYO7A):c.4697C>T (p.Thr1566Met) rs41298747
NM_000260.4(MYO7A):c.470+1G>A rs797044510
NM_000260.4(MYO7A):c.471-1G>A rs548172627
NM_000260.4(MYO7A):c.47T>A (p.Leu16Ter) rs1052030
NM_000260.4(MYO7A):c.47T>C (p.Leu16Ser) rs1052030
NM_000260.4(MYO7A):c.4805G>A (p.Arg1602Gln) rs139889944
NM_000260.4(MYO7A):c.4821T>A (p.Tyr1607Ter) rs397516315
NM_000260.4(MYO7A):c.4828dup (p.Ala1610fs) rs1555100603
NM_000260.4(MYO7A):c.4837_4839dup (p.Asp1613dup) rs1555100610
NM_000260.4(MYO7A):c.4838del (p.Asp1613fs) rs1199012623
NM_000260.4(MYO7A):c.4844C>T (p.Pro1615Leu) rs201321140
NM_000260.4(MYO7A):c.4845del (p.Asn1616fs) rs1555100625
NM_000260.4(MYO7A):c.484G>A (p.Ala162Thr) rs111033485
NM_000260.4(MYO7A):c.487G>A (p.Gly163Arg) rs1472566324
NM_000260.4(MYO7A):c.4894del (p.Leu1632fs) rs1188637368
NM_000260.4(MYO7A):c.4919del (p.Gly1640fs) rs1555101858
NM_000260.4(MYO7A):c.4921G>A (p.Glu1641Lys) rs767975012
NM_000260.4(MYO7A):c.494C>T (p.Thr165Met) rs111033174
NM_000260.4(MYO7A):c.4983C>T (p.Asp1661=) rs111033331
NM_000260.4(MYO7A):c.5013del (p.Thr1672fs) rs1555102041
NM_000260.4(MYO7A):c.5043+1G>T rs1555102147
NM_000260.4(MYO7A):c.5065G>A (p.Asp1689Asn) rs544639673
NM_000260.4(MYO7A):c.5095C>G (p.Gln1699Glu) rs530520654
NM_000260.4(MYO7A):c.5101C>T (p.Arg1701Ter) rs111033182
NM_000260.4(MYO7A):c.5156A>G (p.Tyr1719Cys) rs77625410
NM_000260.4(MYO7A):c.5168+2T>C rs1192104600
NM_000260.4(MYO7A):c.5177C>T (p.Pro1726Leu) rs1478464275
NM_000260.4(MYO7A):c.5229del (p.Leu1744fs) rs1555103458
NM_000260.4(MYO7A):c.5246G>A (p.Arg1749Gln) rs781537330
NM_000260.4(MYO7A):c.5259del (p.Lys1753fs) rs1555103532
NM_000260.4(MYO7A):c.52C>T (p.Gln18Ter) rs1555051455
NM_000260.4(MYO7A):c.5392C>T (p.Gln1798Ter) rs397516317
NM_000260.4(MYO7A):c.5481-1G>C rs1555105118
NM_000260.4(MYO7A):c.5488dup (p.Glu1830fs) rs1555105135
NM_000260.4(MYO7A):c.5494C>T (p.Arg1832Trp) rs748080151
NM_000260.4(MYO7A):c.5507T>C (p.Leu1836Pro) rs1164918878
NM_000260.4(MYO7A):c.5510T>C (p.Leu1837Pro) rs1385324903
NM_000260.4(MYO7A):c.5543del (p.Asn1848fs) rs1555105202
NM_000260.4(MYO7A):c.5559C>T (p.His1853=) rs373612656
NM_000260.4(MYO7A):c.5560G>A (p.Val1854Met) rs754761542
NM_000260.4(MYO7A):c.5573T>C (p.Leu1858Pro) rs368657015
NM_000260.4(MYO7A):c.5581C>T (p.Arg1861Ter) rs878864531
NM_000260.4(MYO7A):c.5617C>T (p.Arg1873Trp) rs397516321
NM_000260.4(MYO7A):c.5618G>A (p.Arg1873Gln) rs397516322
NM_000260.4(MYO7A):c.5632del (p.Ala1877_Leu1878insTer) rs1299898646
NM_000260.4(MYO7A):c.5637-173C>T rs207472020
NM_000260.4(MYO7A):c.5648G>A (p.Arg1883Gln) rs111033215
NM_000260.4(MYO7A):c.5660C>T (p.Pro1887Leu) rs199606180
NM_000260.4(MYO7A):c.5753T>A (p.Val1918Glu) rs1555106562
NM_000260.4(MYO7A):c.578C>T (p.Thr193Ile) rs1188616455
NM_000260.4(MYO7A):c.5797del (p.Thr1933fs) rs1555106609
NM_000260.4(MYO7A):c.5804T>C (p.Leu1935Pro) rs397516323
NM_000260.4(MYO7A):c.5824G>A (p.Gly1942Arg) rs111033192
NM_000260.4(MYO7A):c.5824G>T (p.Gly1942Ter) rs111033192
NM_000260.4(MYO7A):c.5856G>A (p.Lys1952=) rs1453053718
NM_000260.4(MYO7A):c.5857-2A>G rs1555107286
NM_000260.4(MYO7A):c.5857-3C>A rs727505114
NM_000260.4(MYO7A):c.5866G>A (p.Val1956Ile) rs142293185
NM_000260.4(MYO7A):c.5886_5889del (p.Phe1962fs) rs1397834886
NM_000260.4(MYO7A):c.5899C>T (p.Arg1967Ter) rs376764423
NM_000260.4(MYO7A):c.593-4G>A rs876657534
NM_000260.4(MYO7A):c.5945-1G>A rs1268984037
NM_000260.4(MYO7A):c.5956_5959TCAC[3] (p.Tyr1989fs) rs1555107555
NM_000260.4(MYO7A):c.5968C>T (p.Gln1990Ter) rs773844428
NM_000260.4(MYO7A):c.6025del (p.Ala2009fs) rs397516326
NM_000260.4(MYO7A):c.6028G>A (p.Asp2010Asn) rs755934966
NM_000260.4(MYO7A):c.6051+1G>A rs1403288739
NM_000260.4(MYO7A):c.6062A>G (p.Lys2021Arg) rs876657655
NM_000260.4(MYO7A):c.6070C>T (p.Arg2024Ter) rs111033198
NM_000260.4(MYO7A):c.6092G>A (p.Arg2031Gln) rs762258869
NM_000260.4(MYO7A):c.616C>T (p.Arg206Cys) rs782361954
NM_000260.4(MYO7A):c.6196C>T (p.Gln2066Ter) rs1060499801
NM_000260.4(MYO7A):c.6220C>T (p.Pro2074Ser) rs747131589
NM_000260.4(MYO7A):c.6235C>T (p.Arg2079Trp) rs759614902
NM_000260.4(MYO7A):c.6238-2A>C rs1555109612
NM_000260.4(MYO7A):c.6247G>A (p.Ala2083Thr) rs41298759
NM_000260.4(MYO7A):c.631A>G (p.Ser211Gly) rs111033486
NM_000260.4(MYO7A):c.6321G>A (p.Trp2107Ter) rs773945008
NM_000260.4(MYO7A):c.6345C>T (p.Phe2115=) rs397516329
NM_000260.4(MYO7A):c.6349G>T (p.Val2117Leu) rs1555109788
NM_000260.4(MYO7A):c.634C>T (p.Arg212Cys) rs121965080
NM_000260.4(MYO7A):c.6350T>C (p.Val2117Ala) rs1555109806
NM_000260.4(MYO7A):c.635G>A (p.Arg212His) rs28934610
NM_000260.4(MYO7A):c.640G>A (p.Gly214Arg) rs111033283
NM_000260.4(MYO7A):c.6433del (p.Thr2145fs) rs1555110680
NM_000260.4(MYO7A):c.6439-2A>G rs397516330
NM_000260.4(MYO7A):c.6459del (p.Phe2154fs) rs1555111077
NM_000260.4(MYO7A):c.6478T>G (p.Trp2160Gly) rs1003695470
NM_000260.4(MYO7A):c.6487G>A (p.Gly2163Ser) rs747656448
NM_000260.4(MYO7A):c.652_657del (p.Asp218_Ile219del) rs1555062984
NM_000260.4(MYO7A):c.6557T>C (p.Leu2186Pro) rs876657417
NM_000260.4(MYO7A):c.6560G>A (p.Gly2187Asp) rs397516332
NM_000260.4(MYO7A):c.6628_6643del (p.Gly2210fs) rs1555111501
NM_000260.4(MYO7A):c.700C>T (p.Gln234Ter) rs41298133
NM_000260.4(MYO7A):c.721C>T (p.Arg241Cys) rs782166819
NM_000260.4(MYO7A):c.736-3C>T rs1555063792
NM_000260.4(MYO7A):c.73G>A (p.Gly25Arg) rs782252317
NM_000260.4(MYO7A):c.849+5G>A rs1060499716
NM_000260.4(MYO7A):c.905G>A (p.Arg302His) rs41298135
NM_000260.4(MYO7A):c.93C>A (p.Cys31Ter) rs35689081
NM_000260.4(MYO7A):c.977T>A (p.Leu326Gln) rs797044491
NM_000260.4(MYO7A):c.999T>G (p.Tyr333Ter) rs111033285
NM_001142763.1:c.-189197_c.610-5166del
NM_001142769.3(PCDH15):c.4410-943G>A rs1554816509
NM_001142769.3(PCDH15):c.4450C>A (p.Pro1484Thr) rs1554816211
NM_001142769.3(PCDH15):c.4454C>T (p.Pro1485Leu) rs1554816210
NM_001142769.3(PCDH15):c.4465G>T (p.Glu1489Ter) rs1554816196
NM_001142769.3(PCDH15):c.4492_4503del (p.Ala1498_Glu1501del) rs1554816165
NM_001142769.3(PCDH15):c.4519-1G>A rs1554815909
NM_001142771.2(PCDH15):c.4497+1077_4497+1082del rs1253885211
NM_001142771.2(PCDH15):c.4497+1257_4497+1258del rs1554815781
NM_001142771.2(PCDH15):c.4497+1297_4497+1300dup rs1343032451
NM_001142771.2(PCDH15):c.4497+1355_4497+1359dup rs1554815732
NM_001142771.2(PCDH15):c.4497+1403GAG[5] rs1272584101
NM_001142771.2(PCDH15):c.4497+1412G>T rs1467453189
NM_001142771.2(PCDH15):c.4497+1420del rs778088114
NM_001142771.2(PCDH15):c.4497+1511_4497+1519del rs1554815654
NM_001142771.2(PCDH15):c.4497+1523G>T rs755005336
NM_001142771.2(PCDH15):c.4497+1550C>T rs765589050
NM_001142771.2(PCDH15):c.4497+1559C>T rs368397508
NM_001142771.2(PCDH15):c.4497+1577GAA[3] rs774006219
NM_001142771.2(PCDH15):c.4497+1617_4497+1637del rs769671738
NM_001142771.2(PCDH15):c.4497+1708_4497+1711dup rs1554815534
NM_001142771.2(PCDH15):c.4498-1564T>C rs193186244
NM_001142771.2(PCDH15):c.4498-1648_4498-1644dup rs1554815468
NM_001142771.2(PCDH15):c.4498-1662del rs1554815484
NM_001142771.2(PCDH15):c.4498-1666G>T rs1297423576
NM_001142771.2(PCDH15):c.4498-1709_4498-1706dup rs1554815527
NM_001142771.2(PCDH15):c.4498-2A>G rs1554814991
NM_001142771.2(PCDH15):c.4514_4517dup (p.Lys1507fs) rs1442769492
NM_001142771.2(PCDH15):c.4534C>T (p.Arg1512Ter) rs770416107
NM_001142771.2(PCDH15):c.4548del (p.Ser1517fs) rs778963761
NM_001142771.2(PCDH15):c.4555_4560dup (p.Thr1519_Gly1520dup) rs1554814938
NM_001142771.2(PCDH15):c.4565_4568dup (p.Ser1523fs) rs1554814927
NM_001142771.2(PCDH15):c.4654_4661del (p.Ser1552fs) rs750833316
NM_001142771.2(PCDH15):c.4692_4695dup (p.Lys1566fs) rs757520086
NM_001142771.2(PCDH15):c.4740del (p.Asp1581fs) rs1554814800
NM_001142771.2(PCDH15):c.4814_4817dup (p.Met1606fs) rs760669176
NM_001142771.2(PCDH15):c.4816dup (p.Met1606fs) rs766484375
NM_001142771.2(PCDH15):c.4869_4871dup (p.Asn1624dup) rs1554814729
NM_001142771.2(PCDH15):c.4880T>C (p.Val1627Ala) rs755487351
NM_001142771.2(PCDH15):c.4908_4909CA[1] (p.Thr1637fs) rs1320916581
NM_001142771.2(PCDH15):c.4908_4915del (p.Ser1636fs) rs1554814684
NM_001142771.2(PCDH15):c.4918C>T (p.Gln1640Ter) rs1554814683
NM_001142771.2(PCDH15):c.4932_4935dup (p.Ser1646Ter) rs1198732380
NM_001142771.2(PCDH15):c.4934_4937dup (p.Ser1646fs) rs1554814669
NM_001142771.2(PCDH15):c.4986_4988TGA[2] (p.Asp1664del) rs1554814635
NM_001142771.2(PCDH15):c.5041A>T (p.Lys1681Ter) rs1554814611
NM_005709.3(USH1C):c.1284+6881_1284+6882ins14 rs781176348
NM_005709.3(USH1C):c.238dupC (p.Arg80Profs) rs397515359
NM_005709.4(USH1C):c.1284+6880del rs745622612
NM_006383.4(CIB2):c.192G>C (p.Glu64Asp) rs145415848
NM_022124.6(CDH23):c.10036G>C (p.Glu3346Gln) rs562525508
NM_022124.6(CDH23):c.1515-12G>A rs369396703
NM_022124.6(CDH23):c.193del (p.Leu65fs) rs796051861
NM_022124.6(CDH23):c.1987-1G>A rs1060499714
NM_022124.6(CDH23):c.2206C>T (p.Arg736Ter)
NM_022124.6(CDH23):c.2236G>A (p.Val746Ile) rs550384315
NM_022124.6(CDH23):c.2263C>T (p.His755Tyr) rs181255269
NM_022124.6(CDH23):c.2289+1G>A rs769433759
NM_022124.6(CDH23):c.2410G>A (p.Asp804Asn) rs1554857840
NM_022124.6(CDH23):c.3022G>A (p.Val1008Met) rs201053044
NM_022124.6(CDH23):c.3178C>T (p.Arg1060Trp) rs201536811
NM_022124.6(CDH23):c.3262G>A (p.Val1088Met) rs200632520
NM_022124.6(CDH23):c.3428dup (p.His1143fs) rs1253419936
NM_022124.6(CDH23):c.3625A>G (p.Thr1209Ala) rs41281314
NM_022124.6(CDH23):c.3739C>T (p.Arg1247Cys) rs202204597
NM_022124.6(CDH23):c.3839_3841TGA[1] (p.Met1281del) rs796051860
NM_022124.6(CDH23):c.3880C>T (p.Gln1294Ter) rs121908350
NM_022124.6(CDH23):c.3929C>A (p.Ala1310Asp) rs483353051
NM_022124.6(CDH23):c.3986G>A (p.Gly1329Asp) rs201877610
NM_022124.6(CDH23):c.4000C>T (p.Arg1334Trp) rs373276722
NM_022124.6(CDH23):c.4104+4A>T rs483353052
NM_022124.6(CDH23):c.4210-2A>G
NM_022124.6(CDH23):c.4309C>T (p.Arg1437Ter) rs397517329
NM_022124.6(CDH23):c.4391C>T (p.Ala1464Val) rs374362883
NM_022124.6(CDH23):c.4488G>C (p.Gln1496His) rs121908347
NM_022124.6(CDH23):c.5066T>C (p.Met1689Thr) rs397517334
NM_022124.6(CDH23):c.5237G>A (p.Arg1746Gln) rs111033270
NM_022124.6(CDH23):c.5410C>T (p.Arg1804Trp) rs376271562
NM_022124.6(CDH23):c.5945A>G (p.Asn1982Ser) rs555432123
NM_022124.6(CDH23):c.6000C>A (p.Tyr2000Ter) rs1564794944
NM_022124.6(CDH23):c.6049G>A (p.Gly2017Ser) rs183431253
NM_022124.6(CDH23):c.6050-9G>A rs367928692
NM_022124.6(CDH23):c.6285dup (p.Glu2096Ter) rs1564796487
NM_022124.6(CDH23):c.6911G>A (p.Arg2304Gln) rs201434373
NM_022124.6(CDH23):c.7049C>T (p.Ser2350Leu) rs371522435
NM_022124.6(CDH23):c.7362+5G>A rs727502931
NM_022124.6(CDH23):c.7468G>A (p.Glu2490Lys) rs41281336
NM_022124.6(CDH23):c.8239del (p.Val2747fs) rs1554877007
NM_022124.6(CDH23):c.8378G>A (p.Arg2793Gln) rs547034667
NM_022124.6(CDH23):c.9127C>T (p.Arg3043Trp) rs375907609
NM_022124.6(CDH23):c.945+1G>A
NM_022124.6(CDH23):c.9510+19_9510+25del rs149704197
NM_022124.6(CDH23):c.9524G>A (p.Arg3175His) rs140884994
NM_022124.6(CDH23):c.9565C>T (p.Arg3189Trp) rs121908353
NM_022124.6(CDH23):c.9569C>T (p.Ala3190Val) rs111033536
NM_031475.3(ESPN):c.2369_2386del (p.Arg790_Arg795del) rs1557720377
NM_032119.4(ADGRV1):c.14119G>T (p.Asp4707Tyr) rs1057519383
NM_032119.4(ADGRV1):c.16377G>T (p.Gln5459His) rs371947306
NM_033056.4(PCDH15):c.-5_-3AGA[1] (p.Met1del) rs1555135527
NM_033056.4(PCDH15):c.1006C>T (p.Arg336Ter) rs370261904
NM_033056.4(PCDH15):c.1088del (p.Leu363fs) rs199469706
NM_033056.4(PCDH15):c.1205G>C (p.Gly402Ala) rs145017164
NM_033056.4(PCDH15):c.1305+1G>A rs758947077
NM_033056.4(PCDH15):c.1305+1G>C rs758947077
NM_033056.4(PCDH15):c.1305+1del rs1554833699
NM_033056.4(PCDH15):c.139del (p.Asp47fs) rs1555032952
NM_033056.4(PCDH15):c.1456G>A (p.Gly486Ser) rs1196401374
NM_033056.4(PCDH15):c.145G>T (p.Glu49Ter) rs1168400018
NM_033056.4(PCDH15):c.157+1G>C rs1057516770
NM_033056.4(PCDH15):c.157+59097T>C rs75443986
NM_033056.4(PCDH15):c.158-16930T>C rs207470941
NM_033056.4(PCDH15):c.158-1G>A rs876657418
NM_033056.4(PCDH15):c.158-2A>T rs1304228309
NM_033056.4(PCDH15):c.1591C>T (p.Leu531Phe) rs750009006
NM_033056.4(PCDH15):c.1627del (p.Glu543fs) rs1057516892
NM_033056.4(PCDH15):c.1635_1636AT[1] (p.Thr545_Tyr546insTer) rs1554816541
NM_033056.4(PCDH15):c.16del (p.Tyr6fs) rs397517451
NM_033056.4(PCDH15):c.1737C>G (p.Tyr579Ter) rs1057517251
NM_033056.4(PCDH15):c.1770_1771del (p.Pro591fs) rs1057517150
NM_033056.4(PCDH15):c.1785-2A>C rs1057516474
NM_033056.4(PCDH15):c.1806T>G (p.Tyr602Ter) rs1057517443
NM_033056.4(PCDH15):c.1830_1833del (p.Asn610fs) rs1057517261
NM_033056.4(PCDH15):c.1900G>A (p.Val634Ile) rs146199636
NM_033056.4(PCDH15):c.1915C>T (p.Gln639Ter) rs138983888
NM_033056.4(PCDH15):c.1917+2T>C rs1554806149
NM_033056.4(PCDH15):c.1924G>A (p.Asp642Asn) rs1455035148
NM_033056.4(PCDH15):c.1927C>T (p.Arg643Ter) rs727504301
NM_033056.4(PCDH15):c.1940C>G (p.Ser647Ter) rs137853004
NM_033056.4(PCDH15):c.1997+1G>T rs763797356
NM_033056.4(PCDH15):c.1998-2A>G rs397517452
NM_033056.4(PCDH15):c.1A>G (p.Met1Val) rs1040514625
NM_033056.4(PCDH15):c.2047C>T (p.Arg683Cys) rs573043647
NM_033056.4(PCDH15):c.2052C>A (p.Tyr684Ter) rs1554956088
NM_033056.4(PCDH15):c.2091+2T>C rs1554956023
NM_033056.4(PCDH15):c.2102C>T (p.Ala701Val) rs199537178
NM_033056.4(PCDH15):c.2361_2363TGT[2] (p.Val790del) rs483352837
NM_033056.4(PCDH15):c.2419dup (p.Ile807fs) rs781148814
NM_033056.4(PCDH15):c.2435T>C (p.Ile812Thr) rs61731363
NM_033056.4(PCDH15):c.2487dup (p.Glu830fs) rs757027638
NM_033056.4(PCDH15):c.2581G>A (p.Val861Met) rs142512524
NM_033056.4(PCDH15):c.2624C>A (p.Ser875Ter) rs201328768
NM_033056.4(PCDH15):c.2717C>T (p.Pro906Leu) rs374205826
NM_033056.4(PCDH15):c.2728G>T (p.Ala910Ser) rs139175351
NM_033056.4(PCDH15):c.274C>T (p.Gln92Ter) rs143842048
NM_033056.4(PCDH15):c.2751+2T>C rs754543131
NM_033056.4(PCDH15):c.2785C>T (p.Arg929Ter) rs1057516342
NM_033056.4(PCDH15):c.2825del (p.Gly942fs) rs758685587
NM_033056.4(PCDH15):c.2869-1G>T rs1554883705
NM_033056.4(PCDH15):c.2885G>A (p.Arg962His) rs45483395
NM_033056.4(PCDH15):c.2971C>T (p.Arg991Ter) rs754391973
NM_033056.4(PCDH15):c.2992C>G (p.Pro998Ala) rs397517454
NM_033056.4(PCDH15):c.299del (p.Gly100fs) rs1554940316
NM_033056.4(PCDH15):c.29del (p.Cys10fs) rs1555135419
NM_033056.4(PCDH15):c.3023del (p.Ala1008fs) rs1057517284
NM_033056.4(PCDH15):c.3082del (p.His1028fs) rs1057517325
NM_033056.4(PCDH15):c.3122+2T>A rs1554882546
NM_033056.4(PCDH15):c.3123-1G>A rs1554873550
NM_033056.4(PCDH15):c.3211del (p.Ile1071fs) rs1057516974
NM_033056.4(PCDH15):c.3233-2A>G rs1554872194
NM_033056.4(PCDH15):c.323del (p.Pro108fs) rs1554934073
NM_033056.4(PCDH15):c.3316C>T (p.Arg1106Ter) rs202033121
NM_033056.4(PCDH15):c.333dup (p.His112fs) rs1057516992
NM_033056.4(PCDH15):c.3341del (p.Val1114fs) rs1057516656
NM_033056.4(PCDH15):c.3374-1G>T rs1554852472
NM_033056.4(PCDH15):c.3416_3418ATC[1] (p.His1140del) rs1554852410
NM_033056.4(PCDH15):c.3441dup (p.Phe1148fs) rs770832663
NM_033056.4(PCDH15):c.3501+13A>G rs727503365
NM_033056.4(PCDH15):c.3501+1G>T rs1402893508
NM_033056.4(PCDH15):c.3502-2A>G rs1554836566
NM_033056.4(PCDH15):c.358_359del (p.Cys120fs) rs1057517264
NM_033056.4(PCDH15):c.3653del (p.Phe1218fs) rs1057516268
NM_033056.4(PCDH15):c.3717+1G>A rs748706627
NM_033056.4(PCDH15):c.3717+2dup rs1248401224
NM_033056.4(PCDH15):c.3731_3734del (p.Asn1244fs) rs1554833314
NM_033056.4(PCDH15):c.3791_3794del (p.Ile1264fs) rs1554833249
NM_033056.4(PCDH15):c.3792_3798dup (p.Leu1267fs) rs1554833242
NM_033056.4(PCDH15):c.3806+1G>C rs1554833227
NM_033056.4(PCDH15):c.3806+2T>C rs756692340
NM_033056.4(PCDH15):c.3807-2A>G rs1328440878
NM_033056.4(PCDH15):c.3807-6T>G rs727504791
NM_033056.4(PCDH15):c.3817C>A (p.Arg1273Ser) rs111033363
NM_033056.4(PCDH15):c.3857T>A (p.Val1286Glu) rs375292203
NM_033056.4(PCDH15):c.3862T>C (p.Ser1288Pro) rs1554827269
NM_033056.4(PCDH15):c.3885_3889dup (p.Ala1297fs) rs1057516780
NM_033056.4(PCDH15):c.394dup (p.Glu132fs) rs397515566
NM_033056.4(PCDH15):c.3983+1G>T rs758921360
NM_033056.4(PCDH15):c.3983+2dup rs1554827124
NM_033056.4(PCDH15):c.3984-1G>C rs1057520709
NM_033056.4(PCDH15):c.3984-2A>G rs1554824185
NM_033056.4(PCDH15):c.4006_4008dup (p.Asp1336dup) rs1554824158
NM_033056.4(PCDH15):c.400C>T (p.Arg134Ter) rs137853003
NM_033056.4(PCDH15):c.4024C>A (p.Gln1342Lys) rs61731387
NM_033056.4(PCDH15):c.4114_4119del (p.Tyr1372_Thr1373del) rs1394411772
NM_033056.4(PCDH15):c.4118C>T (p.Thr1373Ile) rs756490783
NM_033056.4(PCDH15):c.4127C>A (p.Ala1376Asp) rs752371584
NM_033056.4(PCDH15):c.4147del (p.Ile1383fs) rs1554824058
NM_033056.4(PCDH15):c.416_444del (p.Asp139fs) rs1057517182
NM_033056.4(PCDH15):c.4197_4198insGTAG (p.Arg1400fs) rs1057516821
NM_033056.4(PCDH15):c.4211+1G>A rs1554823229
NM_033056.4(PCDH15):c.4211+1del rs1554823231
NM_033056.4(PCDH15):c.4211+2T>G rs753832779
NM_033056.4(PCDH15):c.4211+2dup rs1057517419
NM_033056.4(PCDH15):c.4214G>A (p.Arg1405His) rs143538460
NM_033056.4(PCDH15):c.4227T>A (p.Cys1409Ter) rs1057516472
NM_033056.4(PCDH15):c.4231_4234dup (p.Thr1412fs) rs1554822897
NM_033056.4(PCDH15):c.4237_4238del (p.Ala1413fs) rs1554822891
NM_033056.4(PCDH15):c.4247_4258del (p.Gln1416_Leu1419del) rs1296979751
NM_033056.4(PCDH15):c.4305_4310dup (p.Pro1442_Pro1443dup) rs1327987212
NM_033056.4(PCDH15):c.4308_4310GCC[2] (p.Pro1441_Pro1443del) rs559130985
NM_033056.4(PCDH15):c.4308_4310GCC[7] (p.Pro1442_Pro1443dup) rs559130985
NM_033056.4(PCDH15):c.4308_4310GCC[9] (p.Pro1440_Pro1443dup) rs559130985
NM_033056.4(PCDH15):c.4313del (p.Pro1438fs) rs1057516351
NM_033056.4(PCDH15):c.4317_4328dup (p.Pro1440_Pro1443dup) rs1554822754
NM_033056.4(PCDH15):c.4367+1G>A rs1057516613
NM_033056.4(PCDH15):c.4367+2T>C rs1554822703
NM_033056.4(PCDH15):c.4368-14TCTTT[3] rs1452730552
NM_033056.4(PCDH15):c.4368-15_4368-2del rs1057516560
NM_033056.4(PCDH15):c.4368-1_4369dup rs1554821139
NM_033056.4(PCDH15):c.4368-2A>T rs989521806
NM_033056.4(PCDH15):c.4368-3_4379dup rs1554821131
NM_033056.4(PCDH15):c.4368-76C>T rs375657329
NM_033056.4(PCDH15):c.4368-77G>A rs776152870
NM_033056.4(PCDH15):c.4368-77del rs1554821197
NM_033056.4(PCDH15):c.4368-79_4368-76del rs1554821194
NM_033056.4(PCDH15):c.4383C>A (p.Tyr1461Ter) rs1033803342
NM_033056.4(PCDH15):c.4399_4410dup (p.Arg1467_Asn1470dup) rs1554821093
NM_033056.4(PCDH15):c.4409_4413dup (p.Val1472fs) rs749884609
NM_033056.4(PCDH15):c.4410_4420del (p.Asn1470fs) rs767621707
NM_033056.4(PCDH15):c.4435_4437CAA[1] (p.Gln1480del) rs1358121247
NM_033056.4(PCDH15):c.4546_4553dup (p.Glu1519fs) rs1554820916
NM_033056.4(PCDH15):c.4548_4551del (p.Ser1517fs) rs1233449433
NM_033056.4(PCDH15):c.4556_4557dup (p.Asp1520fs) rs1554820902
NM_033056.4(PCDH15):c.4561_4565dup (p.Ser1523fs) rs1554820894
NM_033056.4(PCDH15):c.4563_4566dup (p.Ser1523fs) rs1554820891
NM_033056.4(PCDH15):c.4603_4607del (p.Gln1535fs) rs771473483
NM_033056.4(PCDH15):c.4618del (p.Ser1540fs) rs1554820847
NM_033056.4(PCDH15):c.4621_4624dup (p.Ile1542fs) rs1363726588
NM_033056.4(PCDH15):c.4639_4656dup (p.Asp1547_Phe1552dup) rs1554820809
NM_033056.4(PCDH15):c.4705_4708dup (p.Ile1570fs) rs1554820749
NM_033056.4(PCDH15):c.4724_4726dup (p.Gln1576_Ser1577insArg) rs762814533
NM_033056.4(PCDH15):c.4725_4728TCAG[4] (p.Leu1580fs) rs770063261
NM_033056.4(PCDH15):c.4726C>T (p.Gln1576Ter) rs758204385
NM_033056.4(PCDH15):c.4754dup (p.Met1585fs) rs1554820712
NM_033056.4(PCDH15):c.4768_4771dup (p.Arg1591delinsLysTer) rs1554820690
NM_033056.4(PCDH15):c.4769_4771dup (p.Asn1590dup) rs1554820687
NM_033056.4(PCDH15):c.4792C>T (p.Gln1598Ter) rs1554820663
NM_033056.4(PCDH15):c.4812del (p.Arg1604fs) rs1554820651
NM_033056.4(PCDH15):c.4813C>T (p.Gln1605Ter) rs1554820648
NM_033056.4(PCDH15):c.4832del (p.Asn1611fs) rs1554820630
NM_033056.4(PCDH15):c.4834dup (p.Thr1612fs) rs1554820628
NM_033056.4(PCDH15):c.4853_4864dup (p.Lys1618_Ser1621dup) rs1554820580
NM_033056.4(PCDH15):c.4875_4894del (p.Leu1626fs) rs772393186
NM_033056.4(PCDH15):c.4875_4896del (p.Leu1625fs) rs1240582095
NM_033056.4(PCDH15):c.4895_4897dup (p.Leu1633_Thr1634insTyr) rs1554820541
NM_033056.4(PCDH15):c.4905_4907dup (p.Lys1636dup) rs750133663
NM_033056.4(PCDH15):c.4907_4908del (p.Lys1636fs) rs1491209806
NM_033056.4(PCDH15):c.4915_4918dup (p.Arg1640fs) rs780945310
NM_033056.4(PCDH15):c.4921C>T (p.Gln1641Ter) rs1484672299
NM_033056.4(PCDH15):c.4925del (p.Gly1642fs) rs1554820498
NM_033056.4(PCDH15):c.4936A>G (p.Met1646Val) rs141103437
NM_033056.4(PCDH15):c.4955_4963dup (p.Ser1655Ter) rs1554820445
NM_033056.4(PCDH15):c.4964_4965CT[3] (p.Ser1657fs) rs1491078644
NM_033056.4(PCDH15):c.4968_4970dup (p.Ser1658dup) rs1554820428
NM_033056.4(PCDH15):c.4973C>A (p.Ser1658Ter) rs902963615
NM_033056.4(PCDH15):c.4983_4986dup (p.Cys1663fs) rs1554820394
NM_033056.4(PCDH15):c.4987dup (p.Cys1663fs) rs775238614
NM_033056.4(PCDH15):c.5003_5007dup (p.Ser1670fs) rs1554820378
NM_033056.4(PCDH15):c.5014_5022dup (p.Ser1672_Leu1674dup) rs1554820353
NM_033056.4(PCDH15):c.5029_5032dup (p.Ser1678fs) rs773160902
NM_033056.4(PCDH15):c.5047_5050dup (p.Lys1684fs) rs1554820332
NM_033056.4(PCDH15):c.5061_5067dup (p.Ile1690Ter) rs1554820318
NM_033056.4(PCDH15):c.5109_5129del (p.Arg1704_Ser1710del) rs1554820270
NM_033056.4(PCDH15):c.5134_5135CT[5] (p.Arg1714delinsLeuTer) rs1554820255
NM_033056.4(PCDH15):c.5161_5162del (p.Met1721fs) rs1554820230
NM_033056.4(PCDH15):c.5193dup (p.Glu1732Ter) rs1554820212
NM_033056.4(PCDH15):c.5252_5259del (p.Pro1751fs) rs1554820145
NM_033056.4(PCDH15):c.5254_5280del (p.Pro1752_Pro1760del) rs767526540
NM_033056.4(PCDH15):c.5257_5262del (p.Ile1753_Ser1754del) rs1554820140
NM_033056.4(PCDH15):c.5257_5268dup (p.Ile1753_Pro1756dup) rs756858099
NM_033056.4(PCDH15):c.5257_5277del (p.Ile1753_Pro1759del) rs752658191
NM_033056.4(PCDH15):c.5266_5319del (p.Pro1756_Pro1773del) rs1554820050
NM_033056.4(PCDH15):c.5269_5295del (p.Ser1757_Leu1765del) rs957797299
NM_033056.4(PCDH15):c.5272_5274CCT[1] (p.Pro1759_Pro1760del) rs754779351
NM_033056.4(PCDH15):c.5272_5274CCT[4] (p.Pro1760dup) rs754779351
NM_033056.4(PCDH15):c.5274_5278del (p.Pro1759fs) rs1554820127
NM_033056.4(PCDH15):c.5278_5286del (p.Pro1760_Pro1762del) rs373916538
NM_033056.4(PCDH15):c.5294_5302dup (p.Leu1765_Pro1767dup) rs557936064
NM_033056.4(PCDH15):c.5296_5304del (p.Ala1766_Pro1768del) rs397517466
NM_033056.4(PCDH15):c.5308_5310del (p.Asp1770del) rs1554820073
NM_033056.4(PCDH15):c.5317_5319del (p.Pro1773del) rs1415161284
NM_033056.4(PCDH15):c.5332dup (p.Cys1778fs) rs1338600699
NM_033056.4(PCDH15):c.5336del (p.Pro1779fs) rs1554820022
NM_033056.4(PCDH15):c.5343del (p.Ser1782fs) rs1554820009
NM_033056.4(PCDH15):c.5347_5363del (p.Pro1783fs) rs748086016
NM_033056.4(PCDH15):c.5349_5359del (p.Pro1784fs) rs1554819982
NM_033056.4(PCDH15):c.5355_5365del (p.Ile1786fs) rs1554819970
NM_033056.4(PCDH15):c.5357dup (p.Leu1788fs) rs1376879405
NM_033056.4(PCDH15):c.5359C>T (p.Pro1787Ser) rs61862390
NM_033056.4(PCDH15):c.5361_5376del (p.Pro1789fs) rs1554819957
NM_033056.4(PCDH15):c.5363_5368TTCCTC[3] (p.1788_1789LP[3]) rs779691085
NM_033056.4(PCDH15):c.5364_5373del (p.Pro1789fs) rs753690225
NM_033056.4(PCDH15):c.5388dup (p.Pro1797fs) rs1554819925
NM_033056.4(PCDH15):c.5398G>A (p.Val1800Ile) rs111033463
NM_033056.4(PCDH15):c.5430_5438del (p.Leu1811_Pro1813del) rs1554819833
NM_033056.4(PCDH15):c.5445_5456del (p.Thr1816_Pro1819del) rs764759018
NM_033056.4(PCDH15):c.5463_5489del (p.Pro1823_Pro1831del) rs1554819787
NM_033056.4(PCDH15):c.5472_5495del (p.Ile1825_Ser1832del) rs763534924
NM_033056.4(PCDH15):c.5511_5512CA[1] (p.Thr1838fs) rs1554819767
NM_033056.4(PCDH15):c.5520dup (p.Val1841fs) rs1554819761
NM_033056.4(PCDH15):c.5565C>A (p.Ala1855=) rs111033445
NM_033056.4(PCDH15):c.5566G>T (p.Glu1856Ter) rs371269732
NM_033056.4(PCDH15):c.5598_5600AAC[1] (p.Thr1869del) rs113363047
NM_033056.4(PCDH15):c.5600_5603delinsT (p.Thr1867_Thr1868delinsMet) rs1554819686
NM_033056.4(PCDH15):c.5617dup (p.Thr1873fs) rs1554819653
NM_033056.4(PCDH15):c.5619_5623dup (p.Pro1875fs) rs1418472770
NM_033056.4(PCDH15):c.5626C>T (p.Gln1876Ter) rs750274894
NM_033056.4(PCDH15):c.5628_5629GA[2] (p.Glu1878fs) rs794727570
NM_033056.4(PCDH15):c.5682dup (p.Ser1895fs) rs1287068204
NM_033056.4(PCDH15):c.5684C>G (p.Ser1895Ter) rs1554819599
NM_033056.4(PCDH15):c.5702_5705dup (p.Ile1903fs) rs1554819570
NM_033056.4(PCDH15):c.5710_5711del (p.Glu1904fs) rs1554819558
NM_033056.4(PCDH15):c.5713A>T (p.Lys1905Ter) rs780553426
NM_033056.4(PCDH15):c.5721_5724dup (p.Arg1909fs) rs568470164
NM_033056.4(PCDH15):c.5726G>A (p.Arg1909His) rs145851144
NM_033056.4(PCDH15):c.5743_5766del (p.Leu1915_Glu1922del) rs1554819513
NM_033056.4(PCDH15):c.5753del (p.Met1918fs) rs1554819525
NM_033056.4(PCDH15):c.5798_5816dup (p.Asn1939fs) rs755876430
NM_033056.4(PCDH15):c.5806_5807del (p.Ser1936fs) rs1554819488
NM_033056.4(PCDH15):c.5806del (p.Ser1936fs) rs1554819493
NM_033056.4(PCDH15):c.5818_5820dup (p.Ile1940dup) rs750168790
NM_033056.4(PCDH15):c.5838_5841del (p.Lys1946fs) rs1368908688
NM_033056.4(PCDH15):c.5849_5852dup (p.Thr1953fs) rs757543551
NM_033056.4(PCDH15):c.5863del (p.Leu1955fs) rs1554819436
NM_033056.4(PCDH15):c.594+1G>T rs1057516470
NM_033056.4(PCDH15):c.647T>G (p.Leu216Ter) rs1554903979
NM_033056.4(PCDH15):c.705+1G>A rs1554903842
NM_033056.4(PCDH15):c.705+2_705+3insTT rs1554903836
NM_033056.4(PCDH15):c.733C>T (p.Arg245Ter) rs111033260
NM_033056.4(PCDH15):c.7C>T (p.Arg3Ter) rs137853001
NM_033056.4(PCDH15):c.803G>A (p.Cys268Tyr) rs1283739647
NM_033056.4(PCDH15):c.84T>A (p.Tyr28Ter) rs903145299
NM_033056.4(PCDH15):c.875C>G (p.Pro292Arg) rs138744579
NM_033056.4(PCDH15):c.901dup (p.Thr301fs) rs1057517048
NM_033056.4(PCDH15):c.92-515T>G rs1283842168
NM_153676.4(USH1C):c.1013A>C (p.Glu338Ala) rs876658109
NM_153676.4(USH1C):c.1016G>A (p.Arg339Gln) rs765571023
NM_153676.4(USH1C):c.1020-2A>C rs147956944
NM_153676.4(USH1C):c.104+1G>A rs1287021691
NM_153676.4(USH1C):c.1069C>T (p.Arg357Trp) rs140934960
NM_153676.4(USH1C):c.1139del (p.Gly379_Ser380insTer) rs1554960390
NM_153676.4(USH1C):c.1146dup (p.Gln383fs) rs1554960388
NM_153676.4(USH1C):c.1210+5G>A rs372285784
NM_153676.4(USH1C):c.1211-1175del rs1207247951
NM_153676.4(USH1C):c.1216G>T (p.Gly406Ter) rs1554959148
NM_153676.4(USH1C):c.1233C>T (p.Tyr411=) rs377439949
NM_153676.4(USH1C):c.1265del (p.Gly422fs) rs1554957912
NM_153676.4(USH1C):c.1290T>G (p.Tyr430Ter) rs1406224812
NM_153676.4(USH1C):c.1292G>T (p.Gly431Val) rs751388655
NM_153676.4(USH1C):c.1351_1356AAAGAG[1] (p.451_452KE[1]) rs1554957867
NM_153676.4(USH1C):c.1363G>T (p.Glu455Ter) rs148115969
NM_153676.4(USH1C):c.1413+2T>C rs1344670523
NM_153676.4(USH1C):c.1414-2_1414-1insCTG rs769675063
NM_153676.4(USH1C):c.1531-11A>G rs397517872
NM_153676.4(USH1C):c.1543_1551CCCCCGCCT[3] (p.Pro518_Pro520dup) rs777764626
NM_153676.4(USH1C):c.1548G>A (p.Pro516=) rs780428813
NM_153676.4(USH1C):c.1556C>T (p.Pro519Leu) rs778703128
NM_153676.4(USH1C):c.1559dup (p.Ser521fs) rs1554957167
NM_153676.4(USH1C):c.1654_1660del (p.Tyr552fs) rs758580540
NM_153676.4(USH1C):c.1712_1716dup (p.Pro573fs) rs1554957020
NM_153676.4(USH1C):c.1739_1744del (p.Pro580_Val581del) rs1175090344
NM_153676.4(USH1C):c.1806del (p.Ile603fs) rs765346539
NM_153676.4(USH1C):c.1806dup (p.Ile603fs) rs765346539
NM_153676.4(USH1C):c.1807dup (p.Ile603fs) rs1554956941
NM_153676.4(USH1C):c.1822C>T (p.Pro608Ser) rs727505247
NM_153676.4(USH1C):c.1824del (p.Pro609fs) rs1389725640
NM_153676.4(USH1C):c.1840C>T (p.Gln614Ter) rs1554956913
NM_153676.4(USH1C):c.1840del (p.Gln614fs) rs1554956916
NM_153676.4(USH1C):c.1871C>A (p.Ser624Ter) rs778700091
NM_153676.4(USH1C):c.1874C>T (p.Ala625Val) rs727505187
NM_153676.4(USH1C):c.187C>T (p.Arg63Trp) rs375741564
NM_153676.4(USH1C):c.188G>A (p.Arg63Gln) rs372497947
NM_153676.4(USH1C):c.1954_1955CA[1] (p.His652fs) rs766725582
NM_153676.4(USH1C):c.1A>G (p.Met1Val) rs1554965967
NM_153676.4(USH1C):c.2006_2010del (p.Thr669fs) rs1554956821
NM_153676.4(USH1C):c.2041C>T (p.Arg681Ter) rs369369849
NM_153676.4(USH1C):c.2089G>T (p.Glu697Ter) rs139116036
NM_153676.4(USH1C):c.2124T>C (p.Ser708=) rs369021714
NM_153676.4(USH1C):c.216G>A (p.Val72=) rs151045328
NM_153676.4(USH1C):c.2185-2A>G rs1358056232
NM_153676.4(USH1C):c.2191C>T (p.Arg731Trp) rs397517874
NM_153676.4(USH1C):c.2192G>A (p.Arg731Gln) rs371626423
NM_153676.4(USH1C):c.2194A>G (p.Lys732Glu) rs148168494
NM_153676.4(USH1C):c.2227-1G>A
NM_153676.4(USH1C):c.2227-1G>T rs778110397
NM_153676.4(USH1C):c.2240A>G (p.Gln747Arg) rs201600193
NM_153676.4(USH1C):c.2280+2T>C rs1554954681
NM_153676.4(USH1C):c.2281-1G>A rs1554954574
NM_153676.4(USH1C):c.2281-2A>G rs921755529
NM_153676.4(USH1C):c.2326dup (p.Ile776fs) rs758555088
NM_153676.4(USH1C):c.2341G>A (p.Val781Ile) rs397517875
NM_153676.4(USH1C):c.2381-2A>G rs1465352266
NM_153676.4(USH1C):c.2418C>A (p.Asn806Lys) rs397517876
NM_153676.4(USH1C):c.2418C>T (p.Asn806=) rs397517876
NM_153676.4(USH1C):c.2419G>A (p.Gly807Ser) rs142652588
NM_153676.4(USH1C):c.241C>T (p.Arg81Cys) rs876658111
NM_153676.4(USH1C):c.2431_2451del (p.Thr811_Glu817del) rs779253356
NM_153676.4(USH1C):c.2441C>A (p.Thr814Asn) rs397517877
NM_153676.4(USH1C):c.2458G>A (p.Ala820Thr) rs397517878
NM_153676.4(USH1C):c.245C>G (p.Ser82Cys) rs769021971
NM_153676.4(USH1C):c.248+1G>A rs1482487617
NM_153676.4(USH1C):c.2487C>T (p.Gly829=) rs142801489
NM_153676.4(USH1C):c.2490+1G>T rs1554953746
NM_153676.4(USH1C):c.2490+1del rs1366154374
NM_153676.4(USH1C):c.2490+2T>C rs1554953745
NM_153676.4(USH1C):c.2528dup (p.Glu844fs) rs1554953360
NM_153676.4(USH1C):c.2546+1G>T rs1554953350
NM_153676.4(USH1C):c.2547-1G>T rs571304936
NM_153676.4(USH1C):c.2590C>T (p.Arg864Ter) rs767767573
NM_153676.4(USH1C):c.2611G>A (p.Ala871Thr) rs56165709
NM_153676.4(USH1C):c.2617G>A (p.Val873Met) rs201533059
NM_153676.4(USH1C):c.2655+12G>A rs727504552
NM_153676.4(USH1C):c.2656-1G>A rs747133793
NM_153676.4(USH1C):c.2661_2663TCT[1] (p.Leu889del) rs1474458620
NM_153676.4(USH1C):c.266G>A (p.Arg89His) rs749647539
NM_153676.4(USH1C):c.2681del (p.Gly894fs) rs1554952757
NM_153676.4(USH1C):c.2688_2695dup (p.Arg899fs) rs1554952752
NM_153676.4(USH1C):c.308G>A (p.Arg103His) rs397514500
NM_153676.4(USH1C):c.311G>A (p.Gly104Asp) rs1317951509
NM_153676.4(USH1C):c.36+1G>T
NM_153676.4(USH1C):c.379G>A (p.Gly127Arg) rs768207716
NM_153676.4(USH1C):c.388-8T>A rs777486804
NM_153676.4(USH1C):c.388G>A (p.Val130Ile) rs55843567
NM_153676.4(USH1C):c.440A>G (p.His147Arg) rs777591673
NM_153676.4(USH1C):c.463C>T (p.Arg155Ter) rs377145777
NM_153676.4(USH1C):c.496+1G>A rs138138689
NM_153676.4(USH1C):c.496+1G>T rs138138689
NM_153676.4(USH1C):c.496+21GCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGGGAGCAGG[9] rs55983148
NM_153676.4(USH1C):c.497-2del
NM_153676.4(USH1C):c.497-4G>A rs397517881
NM_153676.4(USH1C):c.569C>T (p.Ser190Leu) rs200319849
NM_153676.4(USH1C):c.579+1G>C rs1283092935
NM_153676.4(USH1C):c.582C>T (p.Gly194=) rs397517882
NM_153676.4(USH1C):c.598G>A (p.Gly200Ser) rs770543827
NM_153676.4(USH1C):c.629A>C (p.Lys210Thr) rs372789934
NM_153676.4(USH1C):c.672C>A (p.Cys224Ter) rs1223763703
NM_153676.4(USH1C):c.674+1G>A rs775496999
NM_153676.4(USH1C):c.674+1del rs1554961872
NM_153676.4(USH1C):c.674+2T>G rs1298596518
NM_153676.4(USH1C):c.748_759+5del rs1355262412
NM_153676.4(USH1C):c.760-1G>T rs1187887456
NM_153676.4(USH1C):c.76C>T (p.Leu26Phe) rs267602805
NM_153676.4(USH1C):c.793G>A (p.Asp265Asn) rs199537187
NM_153676.4(USH1C):c.7C>T (p.Arg3Ter) rs876657624
NM_153676.4(USH1C):c.819+1G>A rs1554961152
NM_153676.4(USH1C):c.841_848del (p.Ser281fs) rs1064797153
NM_153676.4(USH1C):c.877-1G>A rs771279169
NM_153676.4(USH1C):c.915_920del (p.Glu306_Ala307del) rs1554960929
NM_153676.4(USH1C):c.91C>T (p.Arg31Ter) rs121908370
NM_153676.4(USH1C):c.92G>A (p.Arg31Gln) rs776511246
NM_173477.5(USH1G):c.1060G>T (p.Asp354Tyr) rs1316299165
NM_173477.5(USH1G):c.113G>A (p.Trp38Ter) rs104894652
NM_173477.5(USH1G):c.143T>C (p.Leu48Pro) rs104894651
NM_173477.5(USH1G):c.186_187del (p.Ile63fs) rs730880268
NM_173477.5(USH1G):c.394dup (p.Val132fs) rs587776546
NM_173477.5(USH1G):c.46C>G (p.Leu16Val) rs876657419
NM_173477.5(USH1G):c.644del (p.Lys215fs) rs1567940040
NM_173477.5(USH1G):c.832_851del (p.Ser278fs) rs397515345
NM_206933.2(USH2A):c.3902G>T (p.Gly1301Val) rs111033524
NM_206933.3(USH2A):c.9921T>G (p.Cys3307Trp) rs1057519382
NP_000251.3(MYO7A):p.Tyr1302fsTer97
NP_005700.2(USH1C):p.Arg357Trp
PCDH15, 3-BP DEL, 5601AAC
PCDH15, IVS27, A-G, -2
USH1C, 1-BP DEL, 1220G
USH1C, IVS5DS, G-A, +1
USH1G, 15-BP DEL, NT163

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.