ClinVar Miner

List of variants studied for Usher syndrome type 1

Included ClinVar conditions (16):
Minimum submission review status: Collection method:
Minimum conflict level:
ClinVar version:
Total variants: 2249
Download table as spreadsheet
HGVS dbSNP
MYO7A, IVS27AS, G-C, -1
NM_000260.3(MYO7A):c.1969C>T rs878853236
NM_000260.3(MYO7A):c.29T>C rs878853237
NM_000260.4(MYO7A):c.*100C>T
NM_000260.4(MYO7A):c.*101G>A rs886048683
NM_000260.4(MYO7A):c.*142A>G rs369873505
NM_000260.4(MYO7A):c.*201T>C
NM_000260.4(MYO7A):c.*208C>G rs886048684
NM_000260.4(MYO7A):c.*230A>G rs112830819
NM_000260.4(MYO7A):c.*315C>G
NM_000260.4(MYO7A):c.*363A>C rs115872143
NM_000260.4(MYO7A):c.*38G>A
NM_000260.4(MYO7A):c.*392A>G
NM_000260.4(MYO7A):c.*416C>T
NM_000260.4(MYO7A):c.*440G>A
NM_000260.4(MYO7A):c.*442T>C rs115238711
NM_000260.4(MYO7A):c.*504C>T rs34765389
NM_000260.4(MYO7A):c.*75C>T
NM_000260.4(MYO7A):c.-154G>A rs545774605
NM_000260.4(MYO7A):c.-170C>T rs886048667
NM_000260.4(MYO7A):c.-196C>T rs886048666
NM_000260.4(MYO7A):c.-20G>A rs886048668
NM_000260.4(MYO7A):c.-211A>G rs41298129
NM_000260.4(MYO7A):c.-52C>G
NM_000260.4(MYO7A):c.1003+10C>T rs782382971
NM_000260.4(MYO7A):c.1006C>T (p.Arg336Cys) rs369997614
NM_000260.4(MYO7A):c.1007G>A (p.Arg336His) rs45629132
NM_000260.4(MYO7A):c.103C>T (p.Gln35Ter)
NM_000260.4(MYO7A):c.1059C>T (p.Ala353=) rs573947142
NM_000260.4(MYO7A):c.1085_1086del (p.Asn362fs) rs1591286221
NM_000260.4(MYO7A):c.1092A>T (p.Pro364=)
NM_000260.4(MYO7A):c.1097T>C (p.Leu366Pro) rs397516281
NM_000260.4(MYO7A):c.109C>T (p.Gln37Ter)
NM_000260.4(MYO7A):c.1117C>T (p.Arg373Cys) rs868979094
NM_000260.4(MYO7A):c.1123C>G (p.Leu375Val) rs782728522
NM_000260.4(MYO7A):c.1126A>G (p.Ile376Val) rs368716988
NM_000260.4(MYO7A):c.1132C>T (p.Arg378Cys) rs199818783
NM_000260.4(MYO7A):c.1133G>A (p.Arg378His) rs397516282
NM_000260.4(MYO7A):c.1134_1146dup (p.Ser383fs) rs1591286671
NM_000260.4(MYO7A):c.1135G>A (p.Gly379Arg) rs878853377
NM_000260.4(MYO7A):c.1142C>T (p.Thr381Met) rs782681743
NM_000260.4(MYO7A):c.1168C>T (p.Gln390Ter) rs1555067598
NM_000260.4(MYO7A):c.1172C>T (p.Ala391Val) rs1555067608
NM_000260.4(MYO7A):c.1175T>C (p.Leu392Pro)
NM_000260.4(MYO7A):c.117_132+6del rs1555051567
NM_000260.4(MYO7A):c.1183C>T (p.Arg395Cys) rs782279338
NM_000260.4(MYO7A):c.1189G>A (p.Ala397Thr) rs1297886521
NM_000260.4(MYO7A):c.1190C>A (p.Ala397Asp) rs1555067667
NM_000260.4(MYO7A):c.1191C>T (p.Ala397=)
NM_000260.4(MYO7A):c.1200+1G>A rs397516283
NM_000260.4(MYO7A):c.1201-12A>G
NM_000260.4(MYO7A):c.1208A>G (p.Tyr403Cys) rs797044511
NM_000260.4(MYO7A):c.1232T>C (p.Val411Ala) rs369916141
NM_000260.4(MYO7A):c.1242C>T (p.Ile414=) rs886048673
NM_000260.4(MYO7A):c.1258A>T (p.Lys420Ter) rs782539587
NM_000260.4(MYO7A):c.1288C>T (p.Arg430Cys) rs201839693
NM_000260.4(MYO7A):c.132+6T>C
NM_000260.4(MYO7A):c.133-14C>T rs116228809
NM_000260.4(MYO7A):c.133-2A>C rs782064437
NM_000260.4(MYO7A):c.133-2A>G rs782064437
NM_000260.4(MYO7A):c.133-3C>A
NM_000260.4(MYO7A):c.133-7C>T rs111033221
NM_000260.4(MYO7A):c.133-7_146dup rs1555054558
NM_000260.4(MYO7A):c.1343+1G>A rs914189193
NM_000260.4(MYO7A):c.1343+6G>A
NM_000260.4(MYO7A):c.1343+7C>T rs782595035
NM_000260.4(MYO7A):c.1343+8G>A rs2276278
NM_000260.4(MYO7A):c.1343+8G>T rs2276278
NM_000260.4(MYO7A):c.1344-2A>G rs111033415
NM_000260.4(MYO7A):c.1344-7C>G rs886048674
NM_000260.4(MYO7A):c.1348G>C (p.Glu450Gln) rs1269622956
NM_000260.4(MYO7A):c.1349A>T (p.Glu450Val) rs1555069238
NM_000260.4(MYO7A):c.1351C>T (p.Gln451Ter)
NM_000260.4(MYO7A):c.1358G>A (p.Cys453Tyr) rs202080237
NM_000260.4(MYO7A):c.1368C>T (p.Phe456=) rs559209306
NM_000260.4(MYO7A):c.1401_1403dup (p.His468_Val469insGln) rs111033219
NM_000260.4(MYO7A):c.1403A>G (p.His468Arg) rs200304238
NM_000260.4(MYO7A):c.1423G>T (p.Glu475Ter)
NM_000260.4(MYO7A):c.1461C>T (p.Ile487=) rs782195221
NM_000260.4(MYO7A):c.1496T>C (p.Ile499Thr) rs397516286
NM_000260.4(MYO7A):c.1506G>A (p.Lys502=) rs181126043
NM_000260.4(MYO7A):c.1530C>T (p.Ile510=) rs746423219
NM_000260.4(MYO7A):c.1543A>C (p.Lys515Gln) rs782023308
NM_000260.4(MYO7A):c.1554+7C>T rs150114658
NM_000260.4(MYO7A):c.1554+8G>A rs111033227
NM_000260.4(MYO7A):c.1554G>A (p.Lys518=) rs886048675
NM_000260.4(MYO7A):c.1555-8C>G rs1057517774
NM_000260.4(MYO7A):c.1556G>A (p.Gly519Asp) rs111033206
NM_000260.4(MYO7A):c.156C>G (p.Asn52Lys) rs886048669
NM_000260.4(MYO7A):c.156C>T (p.Asn52=)
NM_000260.4(MYO7A):c.1575_1592del (p.Ser530_Asn535del) rs1555070062
NM_000260.4(MYO7A):c.1588_1605dup (p.Ser530_Asn535dup) rs1555070084
NM_000260.4(MYO7A):c.1591C>T (p.Gln531Ter) rs781951909
NM_000260.4(MYO7A):c.1605C>T (p.Asn535=) rs111033228
NM_000260.4(MYO7A):c.160A>G (p.Thr54Ala) rs369142107
NM_000260.4(MYO7A):c.1619C>A (p.Pro540His) rs782607566
NM_000260.4(MYO7A):c.1621C>A (p.Pro541Thr)
NM_000260.4(MYO7A):c.1623dup (p.Lys542fs) rs782077721
NM_000260.4(MYO7A):c.1635T>C (p.His545=)
NM_000260.4(MYO7A):c.1690+4C>T
NM_000260.4(MYO7A):c.1690+9G>T rs371146074
NM_000260.4(MYO7A):c.1691-2A>G rs1555072299
NM_000260.4(MYO7A):c.1710A>G (p.Arg570=) rs782763913
NM_000260.4(MYO7A):c.1719G>T (p.Leu573=)
NM_000260.4(MYO7A):c.1721A>C (p.His574Pro) rs397516287
NM_000260.4(MYO7A):c.1726G>A (p.Asp576Asn) rs187165412
NM_000260.4(MYO7A):c.1741G>T (p.Val581Phe)
NM_000260.4(MYO7A):c.1797+13C>T
NM_000260.4(MYO7A):c.1797+7C>T
NM_000260.4(MYO7A):c.1797G>A (p.Met599Ile) rs121965082
NM_000260.4(MYO7A):c.1798-1G>A rs1555076948
NM_000260.4(MYO7A):c.1798-3C>G rs1555076939
NM_000260.4(MYO7A):c.18+2T>A rs564622720
NM_000260.4(MYO7A):c.1801G>A (p.Ala601Thr) rs782481491
NM_000260.4(MYO7A):c.1814A>G (p.Lys605Arg) rs968552859
NM_000260.4(MYO7A):c.1817G>A (p.Arg606His) rs782311929
NM_000260.4(MYO7A):c.182C>G (p.Pro61Arg) rs397516289
NM_000260.4(MYO7A):c.1843A>T (p.Lys615Ter)
NM_000260.4(MYO7A):c.1845del (p.Lys615fs) rs886037762
NM_000260.4(MYO7A):c.1846C>T (p.Arg616Trp) rs369195493
NM_000260.4(MYO7A):c.1849T>C (p.Ser617Pro) rs782063761
NM_000260.4(MYO7A):c.1854G>A (p.Leu618=) rs35429535
NM_000260.4(MYO7A):c.1868G>A (p.Arg623His) rs111033416
NM_000260.4(MYO7A):c.1868G>T (p.Arg623Leu)
NM_000260.4(MYO7A):c.186G>A (p.Thr62=) rs368267301
NM_000260.4(MYO7A):c.1871C>T (p.Thr624Met)
NM_000260.4(MYO7A):c.1884C>A (p.Cys628Ter) rs121965083
NM_000260.4(MYO7A):c.1885C>T (p.Gln629Ter)
NM_000260.4(MYO7A):c.19-1G>A rs111033426
NM_000260.4(MYO7A):c.19-2A>G rs1555051384
NM_000260.4(MYO7A):c.19-9C>T rs368452072
NM_000260.4(MYO7A):c.1900C>T (p.Arg634Ter) rs111033180
NM_000260.4(MYO7A):c.1905C>A (p.Cys635Ter)
NM_000260.4(MYO7A):c.1935+1G>C rs1343207038
NM_000260.4(MYO7A):c.1942G>A (p.Asp648Asn)
NM_000260.4(MYO7A):c.1945C>T (p.Arg649Trp) rs782503314
NM_000260.4(MYO7A):c.1952T>C (p.Leu651Pro) rs876657416
NM_000260.4(MYO7A):c.1956C>T (p.Cys652=) rs367693437
NM_000260.4(MYO7A):c.1957G>A (p.Val653Met)
NM_000260.4(MYO7A):c.196_210del (p.Gly66_Met70del) rs1555054736
NM_000260.4(MYO7A):c.1970G>A (p.Arg657Gln)
NM_000260.4(MYO7A):c.1974C>A (p.Tyr658Ter)
NM_000260.4(MYO7A):c.1976C>A (p.Ser659Ter) rs878853378
NM_000260.4(MYO7A):c.1984A>T (p.Met662Leu) rs782485961
NM_000260.4(MYO7A):c.1996C>T (p.Arg666Ter) rs121965085
NM_000260.4(MYO7A):c.1997G>A (p.Arg666Gln) rs782396605
NM_000260.4(MYO7A):c.2001C>T (p.Ile667=)
NM_000260.4(MYO7A):c.2002C>T (p.Arg668Cys) rs397516292
NM_000260.4(MYO7A):c.2005C>T (p.Arg669Ter) rs111033201
NM_000260.4(MYO7A):c.2006G>A (p.Arg669Gln) rs201178011
NM_000260.4(MYO7A):c.2023C>T (p.Arg675Cys) rs782459520
NM_000260.4(MYO7A):c.2025C>T (p.Arg675=) rs797044658
NM_000260.4(MYO7A):c.2034C>T (p.Phe678=)
NM_000260.4(MYO7A):c.2035G>A (p.Val679Ile) rs35641839
NM_000260.4(MYO7A):c.2056C>T (p.Arg686Cys) rs782364394
NM_000260.4(MYO7A):c.2057G>A (p.Arg686His) rs781991817
NM_000260.4(MYO7A):c.2057G>C (p.Arg686Pro)
NM_000260.4(MYO7A):c.2095-4C>G rs763060756
NM_000260.4(MYO7A):c.2097C>T (p.Gly699=) rs373495082
NM_000260.4(MYO7A):c.2106C>T (p.Arg702=) rs369787754
NM_000260.4(MYO7A):c.2107G>A (p.Gly703Arg) rs572300575
NM_000260.4(MYO7A):c.2119C>A (p.Arg707Ser)
NM_000260.4(MYO7A):c.2120G>A (p.Arg707His)
NM_000260.4(MYO7A):c.2122A>G (p.Met708Val) rs397516293
NM_000260.4(MYO7A):c.2146C>G (p.His716Asp) rs886048676
NM_000260.4(MYO7A):c.2157G>A (p.Trp719Ter)
NM_000260.4(MYO7A):c.215G>T (p.Arg72Leu) rs886048670
NM_000260.4(MYO7A):c.2181T>C (p.Phe727=) rs373656667
NM_000260.4(MYO7A):c.2187+1G>A rs111033290
NM_000260.4(MYO7A):c.2187+1G>T rs111033290
NM_000260.4(MYO7A):c.218T>C (p.Leu73Pro) rs372188355
NM_000260.4(MYO7A):c.2218C>T (p.Arg740Trp) rs201234369
NM_000260.4(MYO7A):c.2236G>A (p.Asp746Asn) rs36090425
NM_000260.4(MYO7A):c.223del (p.Asp75fs) rs876657415
NM_000260.4(MYO7A):c.2241_2242del (p.Arg747fs) rs1555080760
NM_000260.4(MYO7A):c.2248C>T (p.Leu750Phe) rs1224881006
NM_000260.4(MYO7A):c.224dup (p.Asp75fs) rs1224819887
NM_000260.4(MYO7A):c.225C>A (p.Asp75Glu) rs782757893
NM_000260.4(MYO7A):c.2266C>T (p.Arg756Trp) rs782174733
NM_000260.4(MYO7A):c.2267G>A (p.Arg756Gln)
NM_000260.4(MYO7A):c.2282+5G>A rs540145750
NM_000260.4(MYO7A):c.2283-1G>T rs397516295
NM_000260.4(MYO7A):c.2283-2_2293del rs1555082041
NM_000260.4(MYO7A):c.2283G>A (p.Arg761=) rs111033229
NM_000260.4(MYO7A):c.2293C>A (p.Leu765Met) rs201203036
NM_000260.4(MYO7A):c.2307C>T (p.Asn769=)
NM_000260.4(MYO7A):c.2307del (p.Asn769fs) rs1060499800
NM_000260.4(MYO7A):c.2311G>T (p.Ala771Ser) rs782384464
NM_000260.4(MYO7A):c.2323C>T (p.Gln775Ter) rs201892914
NM_000260.4(MYO7A):c.2337G>A (p.Arg779=)
NM_000260.4(MYO7A):c.2355del (p.Asn786fs) rs1591369118
NM_000260.4(MYO7A):c.2361C>A (p.Tyr787Ter) rs1555082145
NM_000260.4(MYO7A):c.2366T>C (p.Leu789Pro)
NM_000260.4(MYO7A):c.2371C>T (p.Arg791Cys)
NM_000260.4(MYO7A):c.2372G>A (p.Arg791His) rs782693893
NM_000260.4(MYO7A):c.2386C>G (p.Arg796Gly) rs111033339
NM_000260.4(MYO7A):c.2387G>A (p.Arg796Gln) rs111033224
NM_000260.4(MYO7A):c.2392C>T (p.Gln798Ter)
NM_000260.4(MYO7A):c.239G>A (p.Gly80Asp) rs376796087
NM_000260.4(MYO7A):c.2410C>T (p.Arg804Trp)
NM_000260.4(MYO7A):c.2411G>A (p.Arg804Gln) rs561347333
NM_000260.4(MYO7A):c.2420A>C (p.His807Pro)
NM_000260.4(MYO7A):c.2421C>T (p.His807=) rs782218928
NM_000260.4(MYO7A):c.2446C>T (p.Arg816Cys)
NM_000260.4(MYO7A):c.2447G>A (p.Arg816His) rs148343670
NM_000260.4(MYO7A):c.2452A>G (p.Ile818Val)
NM_000260.4(MYO7A):c.2455C>T (p.Gln819Ter)
NM_000260.4(MYO7A):c.2461C>T (p.Gln821Ter) rs1279918132
NM_000260.4(MYO7A):c.2468G>A (p.Arg823His)
NM_000260.4(MYO7A):c.2468G>C (p.Arg823Pro)
NM_000260.4(MYO7A):c.2472C>A (p.Cys824Ter)
NM_000260.4(MYO7A):c.2475C>T (p.Arg825=) rs782711428
NM_000260.4(MYO7A):c.2476G>A (p.Ala826Thr) rs368341987
NM_000260.4(MYO7A):c.2488C>T (p.Arg830Cys) rs797044493
NM_000260.4(MYO7A):c.2489G>A (p.Arg830His) rs371029653
NM_000260.4(MYO7A):c.2506C>T (p.Arg836Cys) rs375510570
NM_000260.4(MYO7A):c.2507G>A (p.Arg836His) rs782179888
NM_000260.4(MYO7A):c.2522T>C (p.Leu841Pro) rs397516296
NM_000260.4(MYO7A):c.2526C>T (p.Thr842=) rs782594184
NM_000260.4(MYO7A):c.2527G>A (p.Val843Met) rs140559111
NM_000260.4(MYO7A):c.2558G>A (p.Arg853His) rs111033437
NM_000260.4(MYO7A):c.2598C>T (p.Arg866=)
NM_000260.4(MYO7A):c.2601C>T (p.Leu867=) rs782554940
NM_000260.4(MYO7A):c.2617C>T (p.Arg873Trp) rs200454015
NM_000260.4(MYO7A):c.2618G>A (p.Arg873Gln) rs1052032
NM_000260.4(MYO7A):c.2649G>A (p.Glu883=)
NM_000260.4(MYO7A):c.2656G>A (p.Ala886Thr)
NM_000260.4(MYO7A):c.2662A>G (p.Lys888Glu)
NM_000260.4(MYO7A):c.2679C>T (p.Ala893=) rs782279442
NM_000260.4(MYO7A):c.2680G>A (p.Glu894Lys)
NM_000260.4(MYO7A):c.2697G>A (p.Glu899=) rs782531164
NM_000260.4(MYO7A):c.2703G>A (p.Leu901=)
NM_000260.4(MYO7A):c.2724C>G (p.Asp908Glu) rs199979876
NM_000260.4(MYO7A):c.2724C>T (p.Asp908=) rs199979876
NM_000260.4(MYO7A):c.2754C>T (p.Ala918=) rs78072361
NM_000260.4(MYO7A):c.2755G>A (p.Ala919Thr)
NM_000260.4(MYO7A):c.2762G>A (p.Arg921Gln)
NM_000260.4(MYO7A):c.2782C>T (p.Gln928Ter)
NM_000260.4(MYO7A):c.2787G>A (p.Met929Ile)
NM_000260.4(MYO7A):c.2798G>A (p.Arg933His) rs201489714
NM_000260.4(MYO7A):c.2806C>T (p.Pro936Ser)
NM_000260.4(MYO7A):c.2819C>A (p.Ser940Ter)
NM_000260.4(MYO7A):c.2837T>G (p.Met946Arg) rs1296612982
NM_000260.4(MYO7A):c.285+1G>C rs782661097
NM_000260.4(MYO7A):c.285+2T>G rs782292032
NM_000260.4(MYO7A):c.2850G>A (p.Leu950=) rs397516297
NM_000260.4(MYO7A):c.286-5C>T rs111033471
NM_000260.4(MYO7A):c.2878G>T (p.Glu960Ter) rs782131913
NM_000260.4(MYO7A):c.2882G>A (p.Gly961Asp) rs199575418
NM_000260.4(MYO7A):c.2886G>C (p.Gln962His) rs200641606
NM_000260.4(MYO7A):c.288G>A (p.Thr96=) rs56023295
NM_000260.4(MYO7A):c.288G>T (p.Thr96=) rs56023295
NM_000260.4(MYO7A):c.2904G>A (p.Glu968=) rs111033233
NM_000260.4(MYO7A):c.2960C>T (p.Pro987Leu) rs397516298
NM_000260.4(MYO7A):c.3014C>T (p.Ala1005Val) rs113326082
NM_000260.4(MYO7A):c.3028_3029insTACACCCGGTTGTCC (p.Gln1010_Gly1011insLeuHisProValVal) rs782367511
NM_000260.4(MYO7A):c.3042G>T (p.Thr1014=) rs111033507
NM_000260.4(MYO7A):c.3049_3051del (p.Tyr1017del) rs1180304045
NM_000260.4(MYO7A):c.3084C>A (p.Tyr1028Ter)
NM_000260.4(MYO7A):c.3086A>G (p.His1029Arg) rs60103800
NM_000260.4(MYO7A):c.3090C>A (p.Asp1030Glu)
NM_000260.4(MYO7A):c.3090C>T (p.Asp1030=)
NM_000260.4(MYO7A):c.3109-15C>T
NM_000260.4(MYO7A):c.3109-27_3109-7dup rs1555085333
NM_000260.4(MYO7A):c.3109-68G>A rs2276287
NM_000260.4(MYO7A):c.3134T>C (p.Ile1045Thr) rs377326213
NM_000260.4(MYO7A):c.313del (p.Ala104_Val105insTer) rs1555061466
NM_000260.4(MYO7A):c.3157C>T (p.Pro1053Ser) rs370104824
NM_000260.4(MYO7A):c.318C>G (p.Asn106Lys) rs1555061483
NM_000260.4(MYO7A):c.3246G>A (p.Thr1082=) rs35963362
NM_000260.4(MYO7A):c.324C>T (p.Tyr108=) rs116892396
NM_000260.4(MYO7A):c.3260T>C (p.Leu1087Pro) rs375050157
NM_000260.4(MYO7A):c.3260T>G (p.Leu1087Arg)
NM_000260.4(MYO7A):c.3262C>T (p.Gln1088Ter) rs376535635
NM_000260.4(MYO7A):c.3270G>A (p.Leu1090=) rs370305347
NM_000260.4(MYO7A):c.3271C>T (p.Gln1091Ter)
NM_000260.4(MYO7A):c.3283G>A (p.Glu1095Lys) rs199810429
NM_000260.4(MYO7A):c.3291G>A (p.Gln1097=) rs561459113
NM_000260.4(MYO7A):c.3297C>T (p.Pro1099=) rs367668576
NM_000260.4(MYO7A):c.3298G>T (p.Glu1100Ter) rs782468194
NM_000260.4(MYO7A):c.32G>A (p.Trp11Ter)
NM_000260.4(MYO7A):c.3310A>T (p.Lys1104Ter) rs1555085978
NM_000260.4(MYO7A):c.3375+12C>T
NM_000260.4(MYO7A):c.3375+14C>A rs782500012
NM_000260.4(MYO7A):c.3375+3G>A rs397516299
NM_000260.4(MYO7A):c.3384G>C (p.Lys1128Asn) rs372050452
NM_000260.4(MYO7A):c.3396C>T (p.Asp1132=) rs543234546
NM_000260.4(MYO7A):c.3397G>A (p.Gly1133Arg) rs782313913
NM_000260.4(MYO7A):c.33G>A (p.Trp11Ter)
NM_000260.4(MYO7A):c.3404C>A (p.Ser1135Tyr) rs376688581
NM_000260.4(MYO7A):c.3415G>A (p.Gly1139Ser) rs200840044
NM_000260.4(MYO7A):c.3437G>A (p.Arg1146Gln) rs782140421
NM_000260.4(MYO7A):c.3449A>G (p.Asn1150Ser)
NM_000260.4(MYO7A):c.3451C>G (p.Leu1151Val) rs782465732
NM_000260.4(MYO7A):c.3456G>A (p.Glu1152=)
NM_000260.4(MYO7A):c.3472A>G (p.Ile1158Val) rs797044517
NM_000260.4(MYO7A):c.3474C>T (p.Ile1158=) rs201834743
NM_000260.4(MYO7A):c.3476G>T (p.Gly1159Val) rs199897298
NM_000260.4(MYO7A):c.3489G>A (p.Leu1163=) rs1555087287
NM_000260.4(MYO7A):c.3491G>A (p.Arg1164Gln) rs782350886
NM_000260.4(MYO7A):c.3502C>T (p.Arg1168Trp) rs554073390
NM_000260.4(MYO7A):c.3503+8C>A
NM_000260.4(MYO7A):c.3503G>A (p.Arg1168Gln) rs797044516
NM_000260.4(MYO7A):c.3504-1G>C rs1555090171
NM_000260.4(MYO7A):c.3504-2A>G rs1555090168
NM_000260.4(MYO7A):c.3507C>T (p.Asp1169=) rs782788403
NM_000260.4(MYO7A):c.3508G>A (p.Glu1170Lys) rs111033214
NM_000260.4(MYO7A):c.351G>T (p.Glu117Asp) rs886048671
NM_000260.4(MYO7A):c.3527G>A (p.Ser1176Asn) rs373147966
NM_000260.4(MYO7A):c.3536T>A (p.Leu1179Gln) rs199918940
NM_000260.4(MYO7A):c.3546C>A (p.Asn1182Lys) rs1555090294
NM_000260.4(MYO7A):c.3560G>T (p.Ser1187Ile) rs1555090314
NM_000260.4(MYO7A):c.3576G>A (p.Trp1192Ter) rs1253943370
NM_000260.4(MYO7A):c.358C>A (p.Arg120Ser) rs397516302
NM_000260.4(MYO7A):c.3594C>A (p.Cys1198Ter) rs782694195
NM_000260.4(MYO7A):c.3594C>T (p.Cys1198=)
NM_000260.4(MYO7A):c.359G>A (p.Arg120His) rs369493667
NM_000260.4(MYO7A):c.3602G>C (p.Cys1201Ser) rs117966637
NM_000260.4(MYO7A):c.3610C>A (p.Pro1204Thr) rs1555090442
NM_000260.4(MYO7A):c.3615C>T (p.Ser1205=)
NM_000260.4(MYO7A):c.3631-1G>C rs1555090885
NM_000260.4(MYO7A):c.3631-6C>A
NM_000260.4(MYO7A):c.3638G>A (p.Arg1213Gln)
NM_000260.4(MYO7A):c.3659C>T (p.Pro1220Leu) rs727504710
NM_000260.4(MYO7A):c.3660G>A (p.Pro1220=) rs751497005
NM_000260.4(MYO7A):c.3662C>G (p.Pro1221Arg) rs780594308
NM_000260.4(MYO7A):c.3669C>T (p.Tyr1223=) rs727504631
NM_000260.4(MYO7A):c.3688C>T (p.Arg1230Cys)
NM_000260.4(MYO7A):c.3689G>A (p.Arg1230His) rs368705036
NM_000260.4(MYO7A):c.3701C>G (p.Thr1234Ser) rs775908821
NM_000260.4(MYO7A):c.3702C>G (p.Thr1234=) rs77299211
NM_000260.4(MYO7A):c.3719G>A (p.Arg1240Gln) rs111033178
NM_000260.4(MYO7A):c.3723A>T (p.Thr1241=) rs767426033
NM_000260.4(MYO7A):c.3724C>T (p.Gln1242Ter) rs1057517857
NM_000260.4(MYO7A):c.3750+5G>A rs111033391
NM_000260.4(MYO7A):c.3750+7G>A rs397516305
NM_000260.4(MYO7A):c.3750+8C>T
NM_000260.4(MYO7A):c.3750+9G>A rs111033252
NM_000260.4(MYO7A):c.3751-14T>C
NM_000260.4(MYO7A):c.3764del (p.Lys1255fs) rs111033347
NM_000260.4(MYO7A):c.3783C>T (p.Pro1261=) rs754599732
NM_000260.4(MYO7A):c.3797A>G (p.Asp1266Gly) rs781670345
NM_000260.4(MYO7A):c.380T>C (p.Ile127Thr) rs41298131
NM_000260.4(MYO7A):c.3815_3822del (p.Leu1272fs) rs1555091636
NM_000260.4(MYO7A):c.3827C>T (p.Ser1276Leu) rs369458838
NM_000260.4(MYO7A):c.3828G>A (p.Ser1276=) rs78871677
NM_000260.4(MYO7A):c.3855C>T (p.Asn1285=)
NM_000260.4(MYO7A):c.3856G>A (p.Ala1286Thr) rs727503328
NM_000260.4(MYO7A):c.3858G>A (p.Ala1286=) rs372623270
NM_000260.4(MYO7A):c.3862G>T (p.Ala1288Ser)
NM_000260.4(MYO7A):c.3878_3879del (p.Leu1293fs) rs760251968
NM_000260.4(MYO7A):c.3891C>A (p.Phe1297Leu)
NM_000260.4(MYO7A):c.3892G>A (p.Gly1298Arg) rs727503329
NM_000260.4(MYO7A):c.3924+12C>T rs2276285
NM_000260.4(MYO7A):c.3924+1G>C rs1226046110
NM_000260.4(MYO7A):c.3924+8C>T rs565801140
NM_000260.4(MYO7A):c.3924G>A (p.Lys1308=) rs1349274983
NM_000260.4(MYO7A):c.3925-8G>A rs367645097
NM_000260.4(MYO7A):c.392C>T (p.Pro131Leu) rs1555061692
NM_000260.4(MYO7A):c.3943G>A (p.Gly1315Ser) rs769771981
NM_000260.4(MYO7A):c.394C>T (p.Pro132Ser)
NM_000260.4(MYO7A):c.3954C>T (p.His1318=) rs749218462
NM_000260.4(MYO7A):c.3964G>A (p.Ala1322Thr)
NM_000260.4(MYO7A):c.3978C>T (p.Cys1326=) rs111033376
NM_000260.4(MYO7A):c.397C>A (p.His133Asn) rs111033403
NM_000260.4(MYO7A):c.397C>G (p.His133Asp) rs111033403
NM_000260.4(MYO7A):c.397dup (p.His133fs) rs111033187
NM_000260.4(MYO7A):c.3982C>T (p.Gln1328Ter)
NM_000260.4(MYO7A):c.3998_4012del (p.Gln1333_Glu1337del) rs1555092931
NM_000260.4(MYO7A):c.39C>A (p.Asp13Glu) rs199989979
NM_000260.4(MYO7A):c.3G>A (p.Met1Ile) rs782787126
NM_000260.4(MYO7A):c.4006C>T (p.Gln1336Ter) rs750647872
NM_000260.4(MYO7A):c.4018G>A (p.Ala1340Thr) rs376291076
NM_000260.4(MYO7A):c.4018delinsCC (p.Ala1340fs) rs1555092993
NM_000260.4(MYO7A):c.401T>A (p.Ile134Asn) rs111033181
NM_000260.4(MYO7A):c.4023C>T (p.Pro1341=) rs73495790
NM_000260.4(MYO7A):c.4024del (p.Trp1342fs) rs1555093028
NM_000260.4(MYO7A):c.4029G>C (p.Arg1343Ser) rs763469001
NM_000260.4(MYO7A):c.4032C>T (p.Leu1344=)
NM_000260.4(MYO7A):c.4033TTC[1] (p.Phe1346del) rs1437625274
NM_000260.4(MYO7A):c.4035C>G (p.Phe1345Leu)
NM_000260.4(MYO7A):c.4039C>A (p.Arg1347Ser) rs111534474
NM_000260.4(MYO7A):c.4039C>T (p.Arg1347Cys) rs111534474
NM_000260.4(MYO7A):c.4051T>C (p.Phe1351Leu)
NM_000260.4(MYO7A):c.4066A>T (p.Ser1356Cys) rs201195495
NM_000260.4(MYO7A):c.4074C>T (p.Ser1358=) rs78996818
NM_000260.4(MYO7A):c.4108_4111del (p.Gln1370fs) rs1480697910
NM_000260.4(MYO7A):c.4115T>G (p.Val1372Gly) rs869312181
NM_000260.4(MYO7A):c.4117C>T (p.Arg1373Ter) rs766641715
NM_000260.4(MYO7A):c.4118G>A (p.Arg1373Gln) rs886048677
NM_000260.4(MYO7A):c.4126A>T (p.Lys1376Ter)
NM_000260.4(MYO7A):c.4128G>C (p.Lys1376Asn)
NM_000260.4(MYO7A):c.4153-10C>G rs397516306
NM_000260.4(MYO7A):c.4153-11C>T rs727503330
NM_000260.4(MYO7A):c.4153-7C>A rs369489756
NM_000260.4(MYO7A):c.4153-8C>G rs143216377
NM_000260.4(MYO7A):c.4153-8C>T rs143216377
NM_000260.4(MYO7A):c.4153G>T (p.Glu1385Ter)
NM_000260.4(MYO7A):c.4171C>G (p.Leu1391Val) rs727504594
NM_000260.4(MYO7A):c.4184dup (p.Tyr1396fs) rs1555095933
NM_000260.4(MYO7A):c.4194A>G (p.Val1398=) rs1591438864
NM_000260.4(MYO7A):c.4195G>C (p.Asp1399His) rs373080197
NM_000260.4(MYO7A):c.4219G>T (p.Glu1407Ter)
NM_000260.4(MYO7A):c.4254del (p.Asp1419fs) rs1555096070
NM_000260.4(MYO7A):c.4280C>T (p.Thr1427Met) rs547006116
NM_000260.4(MYO7A):c.4297del (p.Gln1433fs) rs1555096223
NM_000260.4(MYO7A):c.4321A>T (p.Lys1441Ter)
NM_000260.4(MYO7A):c.4338GAG[1] (p.Arg1448del) rs1432069074
NM_000260.4(MYO7A):c.4360G>A (p.Val1454Ile) rs397516309
NM_000260.4(MYO7A):c.4362C>A (p.Val1454=) rs374492441
NM_000260.4(MYO7A):c.4387C>T (p.Arg1463Cys)
NM_000260.4(MYO7A):c.4423G>T (p.Glu1475Ter)
NM_000260.4(MYO7A):c.4432A>C (p.Lys1478Gln)
NM_000260.4(MYO7A):c.4432A>T (p.Lys1478Ter)
NM_000260.4(MYO7A):c.4441+7C>T rs372493678
NM_000260.4(MYO7A):c.444C>T (p.Asn148=) rs1253765162
NM_000260.4(MYO7A):c.4450C>T (p.Leu1484Phe) rs200416912
NM_000260.4(MYO7A):c.4461C>T (p.Asn1487=) rs56174006
NM_000260.4(MYO7A):c.4476C>T (p.Ala1492=)
NM_000260.4(MYO7A):c.448C>A (p.Arg150=) rs121965079
NM_000260.4(MYO7A):c.448C>T (p.Arg150Ter) rs121965079
NM_000260.4(MYO7A):c.449G>A (p.Arg150Gln) rs202245413
NM_000260.4(MYO7A):c.4502_4503del (p.Val1501fs) rs1555099541
NM_000260.4(MYO7A):c.4507G>T (p.Glu1503Ter)
NM_000260.4(MYO7A):c.4512G>A (p.Gln1504=) rs767236447
NM_000260.4(MYO7A):c.4568+12C>G rs72933642
NM_000260.4(MYO7A):c.4568+13G>A rs532356676
NM_000260.4(MYO7A):c.4569-1G>A rs775792432
NM_000260.4(MYO7A):c.4576del (p.Arg1526fs) rs1555100200
NM_000260.4(MYO7A):c.4577G>A (p.Arg1526His) rs397516311
NM_000260.4(MYO7A):c.4589C>T (p.Ser1530Leu) rs111033183
NM_000260.4(MYO7A):c.4593G>T (p.Leu1531=)
NM_000260.4(MYO7A):c.4619C>T (p.Ala1540Val) rs111033511
NM_000260.4(MYO7A):c.4620G>A (p.Ala1540=) rs41298745
NM_000260.4(MYO7A):c.4630G>A (p.Gly1544Ser) rs886048678
NM_000260.4(MYO7A):c.4642del (p.Gly1547_Leu1548insTer) rs1555100273
NM_000260.4(MYO7A):c.4647C>A (p.Thr1549=) rs757971917
NM_000260.4(MYO7A):c.4659_4660del (p.Cys1554fs) rs1555100315
NM_000260.4(MYO7A):c.4668G>A (p.Pro1556=) rs376892582
NM_000260.4(MYO7A):c.4689G>A (p.Ala1563=)
NM_000260.4(MYO7A):c.468C>T (p.Ile156=) rs12420129
NM_000260.4(MYO7A):c.4697C>T (p.Thr1566Met) rs41298747
NM_000260.4(MYO7A):c.4698G>A (p.Thr1566=) rs200207753
NM_000260.4(MYO7A):c.470+1G>A rs797044510
NM_000260.4(MYO7A):c.471-1G>A rs548172627
NM_000260.4(MYO7A):c.4728G>A (p.Lys1576=) rs758921557
NM_000260.4(MYO7A):c.4739A>G (p.Tyr1580Cys) rs370232066
NM_000260.4(MYO7A):c.4755C>T (p.Ser1585=) rs7927472
NM_000260.4(MYO7A):c.4757A>G (p.Asn1586Ser) rs201251963
NM_000260.4(MYO7A):c.4762G>A (p.Glu1588Lys)
NM_000260.4(MYO7A):c.4762G>T (p.Glu1588Ter)
NM_000260.4(MYO7A):c.4768A>G (p.Ile1590Val)
NM_000260.4(MYO7A):c.4791C>A (p.Phe1597Leu)
NM_000260.4(MYO7A):c.47T>A (p.Leu16Ter) rs1052030
NM_000260.4(MYO7A):c.47T>C (p.Leu16Ser) rs1052030
NM_000260.4(MYO7A):c.4804C>T (p.Arg1602Trp)
NM_000260.4(MYO7A):c.4805G>A (p.Arg1602Gln) rs139889944
NM_000260.4(MYO7A):c.4821T>A (p.Tyr1607Ter) rs397516315
NM_000260.4(MYO7A):c.4828dup (p.Ala1610fs) rs1555100603
NM_000260.4(MYO7A):c.4837_4839dup (p.Asp1613dup) rs1555100610
NM_000260.4(MYO7A):c.4838del (p.Asp1613fs) rs1199012623
NM_000260.4(MYO7A):c.4842C>A (p.Asn1614Lys) rs749146420
NM_000260.4(MYO7A):c.4844C>T (p.Pro1615Leu) rs201321140
NM_000260.4(MYO7A):c.4845C>A (p.Pro1615=) rs61900036
NM_000260.4(MYO7A):c.4845del (p.Asn1616fs) rs1555100625
NM_000260.4(MYO7A):c.484G>A (p.Ala162Thr) rs111033485
NM_000260.4(MYO7A):c.4851C>T (p.Pro1617=) rs372535399
NM_000260.4(MYO7A):c.4852+1G>A
NM_000260.4(MYO7A):c.4868G>A (p.Gly1623Asp)
NM_000260.4(MYO7A):c.486C>T (p.Ala162=) rs367687624
NM_000260.4(MYO7A):c.487G>A (p.Gly163Arg) rs1472566324
NM_000260.4(MYO7A):c.4894del (p.Leu1632fs) rs1188637368
NM_000260.4(MYO7A):c.4919del (p.Gly1640fs) rs1555101858
NM_000260.4(MYO7A):c.4921G>A (p.Glu1641Lys) rs767975012
NM_000260.4(MYO7A):c.4927G>A (p.Val1643Ile) rs1591467534
NM_000260.4(MYO7A):c.4950C>T (p.Asn1650=) rs80033599
NM_000260.4(MYO7A):c.4953C>G (p.Gly1651=)
NM_000260.4(MYO7A):c.495G>A (p.Thr165=)
NM_000260.4(MYO7A):c.4978G>A (p.Gly1660Arg) rs771889662
NM_000260.4(MYO7A):c.4983C>T (p.Asp1661=) rs111033331
NM_000260.4(MYO7A):c.4992C>T (p.Thr1664=) rs181573957
NM_000260.4(MYO7A):c.4996A>T (p.Ser1666Cys) rs2276288
NM_000260.4(MYO7A):c.4996_4997del (p.Ser1666fs) rs1591467894
NM_000260.4(MYO7A):c.5001_5002del (p.Tyr1668fs) rs1591467918
NM_000260.4(MYO7A):c.5005G>A (p.Val1669Ile) rs374655803
NM_000260.4(MYO7A):c.5013del (p.Thr1672fs) rs1555102041
NM_000260.4(MYO7A):c.5018T>A (p.Val1673Asp)
NM_000260.4(MYO7A):c.5021C>A (p.Thr1674Asn)
NM_000260.4(MYO7A):c.5029C>T (p.Pro1677Ser)
NM_000260.4(MYO7A):c.5037G>A (p.Glu1679=) rs886048679
NM_000260.4(MYO7A):c.5043+1G>T rs1555102147
NM_000260.4(MYO7A):c.5065G>A (p.Asp1689Asn) rs544639673
NM_000260.4(MYO7A):c.5069_5070insC (p.Gln1690fs) rs1591470904
NM_000260.4(MYO7A):c.5075A>G (p.Gln1692Arg)
NM_000260.4(MYO7A):c.5087G>A (p.Arg1696Gln)
NM_000260.4(MYO7A):c.5088G>T (p.Arg1696=) rs886048680
NM_000260.4(MYO7A):c.5095C>G (p.Gln1699Glu) rs530520654
NM_000260.4(MYO7A):c.5098C>T (p.Leu1700=)
NM_000260.4(MYO7A):c.5101C>T (p.Arg1701Ter) rs111033182
NM_000260.4(MYO7A):c.5108C>T (p.Ala1703Val) rs199561332
NM_000260.4(MYO7A):c.5109G>A (p.Ala1703=) rs374162462
NM_000260.4(MYO7A):c.510G>A (p.Leu170=) rs34477144
NM_000260.4(MYO7A):c.5122C>T (p.Arg1708Cys)
NM_000260.4(MYO7A):c.5146G>A (p.Glu1716Lys)
NM_000260.4(MYO7A):c.514C>T (p.Leu172=) rs368246776
NM_000260.4(MYO7A):c.5156A>G (p.Tyr1719Cys) rs77625410
NM_000260.4(MYO7A):c.5168+2T>C rs1192104600
NM_000260.4(MYO7A):c.5169-5G>A rs727505232
NM_000260.4(MYO7A):c.5169-6C>T rs768594224
NM_000260.4(MYO7A):c.5172C>G (p.Pro1724=) rs727505004
NM_000260.4(MYO7A):c.5177C>T (p.Pro1726Leu) rs1478464275
NM_000260.4(MYO7A):c.517C>T (p.Gln173Ter)
NM_000260.4(MYO7A):c.5186C>T (p.Thr1729Met)
NM_000260.4(MYO7A):c.5195G>A (p.Arg1732His)
NM_000260.4(MYO7A):c.519G>A (p.Gln173=) rs369757929
NM_000260.4(MYO7A):c.5209A>T (p.Lys1737Ter)
NM_000260.4(MYO7A):c.5214C>A (p.Ala1738=) rs886048681
NM_000260.4(MYO7A):c.5215C>A (p.Arg1739=) rs111033477
NM_000260.4(MYO7A):c.5227C>T (p.Arg1743Trp) rs111033287
NM_000260.4(MYO7A):c.5228G>A (p.Arg1743Gln)
NM_000260.4(MYO7A):c.5229del (p.Leu1744fs) rs1555103458
NM_000260.4(MYO7A):c.5245C>T (p.Arg1749Trp)
NM_000260.4(MYO7A):c.5246G>A (p.Arg1749Gln) rs781537330
NM_000260.4(MYO7A):c.5253G>A (p.Pro1751=) rs377388669
NM_000260.4(MYO7A):c.5253G>T (p.Pro1751=) rs377388669
NM_000260.4(MYO7A):c.5259del (p.Lys1753fs) rs1555103532
NM_000260.4(MYO7A):c.5263G>A (p.Ala1755Thr) rs762131185
NM_000260.4(MYO7A):c.5265G>A (p.Ala1755=) rs773557376
NM_000260.4(MYO7A):c.52C>T (p.Gln18Ter) rs1555051455
NM_000260.4(MYO7A):c.5326+13C>T rs114157944
NM_000260.4(MYO7A):c.5327-10C>G
NM_000260.4(MYO7A):c.5327-5C>G
NM_000260.4(MYO7A):c.5368C>T (p.Arg1790Cys)
NM_000260.4(MYO7A):c.5373C>T (p.Ser1791=) rs376301325
NM_000260.4(MYO7A):c.5380G>A (p.Glu1794Lys) rs762836180
NM_000260.4(MYO7A):c.5388C>T (p.Thr1796=) rs372062718
NM_000260.4(MYO7A):c.5392C>T (p.Gln1798Ter) rs397516317
NM_000260.4(MYO7A):c.5397C>A (p.Ile1799=)
NM_000260.4(MYO7A):c.5418C>T (p.Ala1806=) rs368749248
NM_000260.4(MYO7A):c.5442T>A (p.Tyr1814Ter)
NM_000260.4(MYO7A):c.5445G>A (p.Val1815=) rs910989813
NM_000260.4(MYO7A):c.5466C>T (p.Thr1822=) rs548620787
NM_000260.4(MYO7A):c.5480+10G>A rs768513428
NM_000260.4(MYO7A):c.5481-14G>A rs113075052
NM_000260.4(MYO7A):c.5481-1G>C rs1555105118
NM_000260.4(MYO7A):c.5488G>T (p.Glu1830Ter)
NM_000260.4(MYO7A):c.5488dup (p.Glu1830fs) rs1555105135
NM_000260.4(MYO7A):c.548C>T (p.Ser183Leu)
NM_000260.4(MYO7A):c.5494C>A (p.Arg1832=) rs748080151
NM_000260.4(MYO7A):c.5494C>T (p.Arg1832Trp) rs748080151
NM_000260.4(MYO7A):c.549G>A (p.Ser183=) rs188198404
NM_000260.4(MYO7A):c.5507T>C (p.Leu1836Pro) rs1164918878
NM_000260.4(MYO7A):c.5510T>C (p.Leu1837Pro) rs1385324903
NM_000260.4(MYO7A):c.5528T>G (p.Leu1843Arg) rs397516319
NM_000260.4(MYO7A):c.5543del (p.Asn1848fs) rs1555105202
NM_000260.4(MYO7A):c.5559C>T (p.His1853=) rs373612656
NM_000260.4(MYO7A):c.5560G>A (p.Val1854Met) rs754761542
NM_000260.4(MYO7A):c.5573T>C (p.Leu1858Pro) rs368657015
NM_000260.4(MYO7A):c.5581C>T (p.Arg1861Ter) rs878864531
NM_000260.4(MYO7A):c.5589C>T (p.His1863=)
NM_000260.4(MYO7A):c.5598C>A (p.Leu1866=) rs111033504
NM_000260.4(MYO7A):c.5598C>T (p.Leu1866=) rs111033504
NM_000260.4(MYO7A):c.5610C>A (p.Cys1870Ter)
NM_000260.4(MYO7A):c.5617C>T (p.Arg1873Trp) rs397516321
NM_000260.4(MYO7A):c.5619G>A (p.Arg1873=) rs45450893
NM_000260.4(MYO7A):c.562C>G (p.Gln188Glu) rs572959359
NM_000260.4(MYO7A):c.5632del (p.Ala1877_Leu1878insTer) rs1299898646
NM_000260.4(MYO7A):c.5637-173C>T rs207472020
NM_000260.4(MYO7A):c.5640C>T (p.Asn1880=) rs140664109
NM_000260.4(MYO7A):c.5641G>A (p.Gly1881Arg) rs373886432
NM_000260.4(MYO7A):c.5648G>A (p.Arg1883Gln) rs111033215
NM_000260.4(MYO7A):c.5655C>A (p.Tyr1885Ter)
NM_000260.4(MYO7A):c.5660C>T (p.Pro1887Leu) rs199606180
NM_000260.4(MYO7A):c.5661G>A (p.Pro1887=) rs375627342
NM_000260.4(MYO7A):c.5665C>T (p.Leu1889=) rs778051833
NM_000260.4(MYO7A):c.5667G>A (p.Leu1889=) rs747516555
NM_000260.4(MYO7A):c.5667G>C (p.Leu1889=) rs747516555
NM_000260.4(MYO7A):c.5688G>A (p.Gln1896=) rs570316231
NM_000260.4(MYO7A):c.5701C>T (p.Gln1901Ter)
NM_000260.4(MYO7A):c.5715A>G (p.Lys1905=) rs2276293
NM_000260.4(MYO7A):c.571G>C (p.Glu191Gln) rs886048672
NM_000260.4(MYO7A):c.5743-12T>C rs2276291
NM_000260.4(MYO7A):c.5753T>A (p.Val1918Glu) rs1555106562
NM_000260.4(MYO7A):c.5771C>A (p.Ala1924Asp)
NM_000260.4(MYO7A):c.5772C>A (p.Ala1924=) rs749438001
NM_000260.4(MYO7A):c.578C>A (p.Thr193Asn)
NM_000260.4(MYO7A):c.578C>T (p.Thr193Ile) rs1188616455
NM_000260.4(MYO7A):c.5797del (p.Thr1933fs) rs1555106609
NM_000260.4(MYO7A):c.5804T>C (p.Leu1935Pro) rs397516323
NM_000260.4(MYO7A):c.5820A>G (p.Ser1940=) rs886048682
NM_000260.4(MYO7A):c.5824G>A (p.Gly1942Arg) rs111033192
NM_000260.4(MYO7A):c.5824G>T (p.Gly1942Ter) rs111033192
NM_000260.4(MYO7A):c.5826A>G (p.Gly1942=)
NM_000260.4(MYO7A):c.5835C>T (p.Leu1945=) rs111033476
NM_000260.4(MYO7A):c.5842A>T (p.Lys1948Ter)
NM_000260.4(MYO7A):c.5851G>C (p.Asp1951His) rs767931313
NM_000260.4(MYO7A):c.5856G>A (p.Lys1952=) rs1453053718
NM_000260.4(MYO7A):c.5857-2A>G rs1555107286
NM_000260.4(MYO7A):c.5857-3C>A rs727505114
NM_000260.4(MYO7A):c.5857-7A>T rs1320703
NM_000260.4(MYO7A):c.5860C>A (p.Leu1954Ile) rs948962
NM_000260.4(MYO7A):c.5860C>G (p.Leu1954Val) rs948962
NM_000260.4(MYO7A):c.5866G>A (p.Val1956Ile) rs142293185
NM_000260.4(MYO7A):c.5879A>T (p.Asp1960Val)
NM_000260.4(MYO7A):c.5880CTT[2] (p.Phe1963del) rs111033232
NM_000260.4(MYO7A):c.5886_5889del (p.Phe1962fs) rs1397834886
NM_000260.4(MYO7A):c.5896G>A (p.Val1966Ile) rs371313080
NM_000260.4(MYO7A):c.5899C>G (p.Arg1967Gly)
NM_000260.4(MYO7A):c.5899C>T (p.Arg1967Ter) rs376764423
NM_000260.4(MYO7A):c.5904C>T (p.His1968=) rs41298753
NM_000260.4(MYO7A):c.593-4G>A rs876657534
NM_000260.4(MYO7A):c.593-5C>T rs762666
NM_000260.4(MYO7A):c.5930G>A (p.Arg1977Gln) rs762420918
NM_000260.4(MYO7A):c.5943C>T (p.Asp1981=)
NM_000260.4(MYO7A):c.5945-1G>A rs1268984037
NM_000260.4(MYO7A):c.5945-9G>C
NM_000260.4(MYO7A):c.5950G>A (p.Val1984Met) rs377517717
NM_000260.4(MYO7A):c.5950G>T (p.Val1984Leu)
NM_000260.4(MYO7A):c.5960_5963dup (p.Tyr1989fs) rs1555107555
NM_000260.4(MYO7A):c.5963C>T (p.Thr1988Ile)
NM_000260.4(MYO7A):c.5967C>A (p.Tyr1989Ter)
NM_000260.4(MYO7A):c.5968C>T (p.Gln1990Ter) rs773844428
NM_000260.4(MYO7A):c.5969A>G (p.Gln1990Arg) rs560293591
NM_000260.4(MYO7A):c.6002C>T (p.Thr2001Met) rs532542968
NM_000260.4(MYO7A):c.6013A>T (p.Lys2005Ter)
NM_000260.4(MYO7A):c.6025del (p.Ala2009fs) rs397516326
NM_000260.4(MYO7A):c.6026C>A (p.Ala2009Asp) rs1173853484
NM_000260.4(MYO7A):c.6028G>A (p.Asp2010Asn) rs755934966
NM_000260.4(MYO7A):c.6048C>T (p.Tyr2016=)
NM_000260.4(MYO7A):c.6051+1G>A rs1403288739
NM_000260.4(MYO7A):c.6052-11G>C rs112564978
NM_000260.4(MYO7A):c.6062A>G (p.Lys2021Arg) rs876657655
NM_000260.4(MYO7A):c.6063G>A (p.Lys2021=) rs111033209
NM_000260.4(MYO7A):c.6070C>T (p.Arg2024Ter) rs111033198
NM_000260.4(MYO7A):c.6071G>C (p.Arg2024Pro)
NM_000260.4(MYO7A):c.6089C>T (p.Thr2030Met)
NM_000260.4(MYO7A):c.6090G>A (p.Thr2030=) rs1381141633
NM_000260.4(MYO7A):c.6092G>A (p.Arg2031Gln) rs762258869
NM_000260.4(MYO7A):c.6106C>T (p.Gln2036Ter)
NM_000260.4(MYO7A):c.6111G>A (p.Leu2037=)
NM_000260.4(MYO7A):c.6145G>A (p.Asp2049Asn)
NM_000260.4(MYO7A):c.614T>C (p.Ile205Thr) rs200241993
NM_000260.4(MYO7A):c.6154T>G (p.Tyr2052Asp)
NM_000260.4(MYO7A):c.6165C>T (p.Ser2055=) rs397516327
NM_000260.4(MYO7A):c.616C>T (p.Arg206Cys) rs782361954
NM_000260.4(MYO7A):c.617G>A (p.Arg206His) rs781998354
NM_000260.4(MYO7A):c.6181C>T (p.Arg2061Trp)
NM_000260.4(MYO7A):c.6184G>T (p.Glu2062Ter)
NM_000260.4(MYO7A):c.618C>T (p.Arg206=) rs375851346
NM_000260.4(MYO7A):c.6196C>T (p.Gln2066Ter) rs1060499801
NM_000260.4(MYO7A):c.61G>A (p.Asp21Asn)
NM_000260.4(MYO7A):c.6214G>A (p.Val2072Ile) rs200313391
NM_000260.4(MYO7A):c.6220C>T (p.Pro2074Ser) rs747131589
NM_000260.4(MYO7A):c.6231G>A (p.Trp2077Ter)
NM_000260.4(MYO7A):c.6235C>T (p.Arg2079Trp) rs759614902
NM_000260.4(MYO7A):c.6236G>A (p.Arg2079Gln) rs765083332
NM_000260.4(MYO7A):c.6238-2A>C rs1555109612
NM_000260.4(MYO7A):c.6240C>T (p.Ser2080=) rs41298757
NM_000260.4(MYO7A):c.6247G>A (p.Ala2083Thr) rs41298759
NM_000260.4(MYO7A):c.6252C>A (p.Tyr2084Ter)
NM_000260.4(MYO7A):c.6252C>G (p.Tyr2084Ter)
NM_000260.4(MYO7A):c.6272A>G (p.Lys2091Arg) rs781713344
NM_000260.4(MYO7A):c.6318G>A (p.Lys2106=) rs11237123
NM_000260.4(MYO7A):c.631A>G (p.Ser211Gly) rs111033486
NM_000260.4(MYO7A):c.6321G>A (p.Trp2107Ter) rs773945008
NM_000260.4(MYO7A):c.6345C>T (p.Phe2115=) rs397516329
NM_000260.4(MYO7A):c.6346G>A (p.Glu2116Lys)
NM_000260.4(MYO7A):c.6349G>T (p.Val2117Leu) rs1555109788
NM_000260.4(MYO7A):c.634C>T (p.Arg212Cys) rs121965080
NM_000260.4(MYO7A):c.6350T>C (p.Val2117Ala) rs1555109806
NM_000260.4(MYO7A):c.6352A>G (p.Lys2118Glu)
NM_000260.4(MYO7A):c.6355C>A (p.Gln2119Lys)
NM_000260.4(MYO7A):c.635G>A (p.Arg212His) rs28934610
NM_000260.4(MYO7A):c.6363G>A (p.Thr2121=) rs367738288
NM_000260.4(MYO7A):c.6381G>A (p.Glu2127=)
NM_000260.4(MYO7A):c.6384CCT[1] (p.Leu2130del)
NM_000260.4(MYO7A):c.640G>A (p.Gly214Arg) rs111033283
NM_000260.4(MYO7A):c.6412G>A (p.Val2138Ile)
NM_000260.4(MYO7A):c.6424G>A (p.Asp2142Asn) rs1132036
NM_000260.4(MYO7A):c.6426T>A (p.Asp2142Glu)
NM_000260.4(MYO7A):c.6431A>G (p.Lys2144Arg)
NM_000260.4(MYO7A):c.6433del (p.Thr2145fs) rs1555110680
NM_000260.4(MYO7A):c.6439-2A>G rs397516330
NM_000260.4(MYO7A):c.6441T>C (p.Asp2147=)
NM_000260.4(MYO7A):c.6459del (p.Phe2154fs) rs1555111077
NM_000260.4(MYO7A):c.6478T>G (p.Trp2160Gly) rs1003695470
NM_000260.4(MYO7A):c.6486C>T (p.Ser2162=) rs778498696
NM_000260.4(MYO7A):c.6509C>T (p.Thr2170Ile) rs544709413
NM_000260.4(MYO7A):c.6512T>C (p.Ile2171Thr)
NM_000260.4(MYO7A):c.6519C>T (p.Asn2173=) rs111033230
NM_000260.4(MYO7A):c.6520T>C (p.Leu2174=) rs377251326
NM_000260.4(MYO7A):c.652G>A (p.Asp218Asn) rs201539845
NM_000260.4(MYO7A):c.652_657del (p.Asp218_Ile219del) rs1555062984
NM_000260.4(MYO7A):c.6546C>T (p.Cys2182=) rs185748200
NM_000260.4(MYO7A):c.6552G>A (p.Thr2184=) rs370866578
NM_000260.4(MYO7A):c.6557T>C (p.Leu2186Pro) rs876657417
NM_000260.4(MYO7A):c.6559-11C>T rs34517202
NM_000260.4(MYO7A):c.6560G>A (p.Gly2187Asp) rs397516332
NM_000260.4(MYO7A):c.658C>T (p.His220Tyr)
NM_000260.4(MYO7A):c.6600G>C (p.Gln2200His) rs779431269
NM_000260.4(MYO7A):c.6628_6643del (p.Gly2210fs) rs1555111501
NM_000260.4(MYO7A):c.6632C>T (p.Ser2211Phe)
NM_000260.4(MYO7A):c.6640G>A (p.Gly2214Ser) rs111033231
NM_000260.4(MYO7A):c.676G>A (p.Ala226Thr) rs201753022
NM_000260.4(MYO7A):c.687C>T (p.Gly229=) rs371142158
NM_000260.4(MYO7A):c.700C>T (p.Gln234Ter) rs41298133
NM_000260.4(MYO7A):c.712G>T (p.Glu238Ter)
NM_000260.4(MYO7A):c.721C>T (p.Arg241Cys) rs782166819
NM_000260.4(MYO7A):c.735+3G>A
NM_000260.4(MYO7A):c.736-3C>T rs1555063792
NM_000260.4(MYO7A):c.73G>A (p.Gly25Arg) rs782252317
NM_000260.4(MYO7A):c.741G>A (p.Leu247=)
NM_000260.4(MYO7A):c.759C>T (p.His253=) rs182220009
NM_000260.4(MYO7A):c.767A>G (p.Tyr256Cys)
NM_000260.4(MYO7A):c.778G>T (p.Glu260Ter)
NM_000260.4(MYO7A):c.779A>C (p.Glu260Ala) rs782636303
NM_000260.4(MYO7A):c.783T>C (p.Gly261=) rs762667
NM_000260.4(MYO7A):c.78G>A (p.Ala26=) rs373517098
NM_000260.4(MYO7A):c.803A>G (p.Lys268Arg) rs184866544
NM_000260.4(MYO7A):c.813C>T (p.Gly271=)
NM_000260.4(MYO7A):c.842T>A (p.Leu281Ter)
NM_000260.4(MYO7A):c.849+5G>A rs1060499716
NM_000260.4(MYO7A):c.858C>A (p.Cys286Ter)
NM_000260.4(MYO7A):c.874C>T (p.Arg292Trp) rs782505601
NM_000260.4(MYO7A):c.875G>A (p.Arg292Gln) rs535205981
NM_000260.4(MYO7A):c.895G>A (p.Ala299Thr) rs372344870
NM_000260.4(MYO7A):c.905G>A (p.Arg302His) rs41298135
NM_000260.4(MYO7A):c.93C>A (p.Cys31Ter) rs35689081
NM_000260.4(MYO7A):c.93C>T (p.Cys31=) rs35689081
NM_000260.4(MYO7A):c.956C>A (p.Ser319Ter)
NM_000260.4(MYO7A):c.968C>G (p.Ala323Gly)
NM_000260.4(MYO7A):c.977T>A (p.Leu326Gln) rs797044491
NM_000260.4(MYO7A):c.999T>G (p.Tyr333Ter) rs111033285
NM_001142763.1:c.-189197_c.610-5166del
NM_001142769.3(PCDH15):c.4450C>A (p.Pro1484Thr) rs1554816211
NM_001142769.3(PCDH15):c.4492_4503del (p.Ala1498_Glu1501del) rs1554816165
NM_001142769.3(PCDH15):c.4864A>G (p.Ser1622Gly) rs372184022
NM_001142771.2(PCDH15):c.4497+1257_4497+1258del rs1554815781
NM_001142771.2(PCDH15):c.4497+1297_4497+1300dup rs1343032451
NM_001142771.2(PCDH15):c.4497+1355_4497+1359dup rs1588874677
NM_001142771.2(PCDH15):c.4497+1412G>T rs1467453189
NM_001142771.2(PCDH15):c.4497+1420del rs778088114
NM_001142771.2(PCDH15):c.4497+1511_4497+1519del rs1554815654
NM_001142771.2(PCDH15):c.4497+1523G>T rs755005336
NM_001142771.2(PCDH15):c.4497+1708_4497+1711dup rs1554815534
NM_001142771.2(PCDH15):c.4498-1564T>C rs193186244
NM_001142771.2(PCDH15):c.4498-1648_4498-1644dup rs1554815468
NM_001142771.2(PCDH15):c.4498-1666G>T rs1297423576
NM_001142771.2(PCDH15):c.4498-1709_4498-1706dup rs1554815527
NM_001142771.2(PCDH15):c.4498-2A>G rs1554814991
NM_001142771.2(PCDH15):c.4514_4517dup (p.Lys1507fs) rs1589057333
NM_001142771.2(PCDH15):c.4548del (p.Ser1517fs) rs778963761
NM_001142771.2(PCDH15):c.4555_4560dup (p.Thr1519_Gly1520dup) rs1554814938
NM_001142771.2(PCDH15):c.4565_4568dup (p.Ser1523fs) rs1554814927
NM_001142771.2(PCDH15):c.4654_4661del (p.Ser1552fs) rs750833316
NM_001142771.2(PCDH15):c.4666A>G (p.Thr1556Ala)
NM_001142771.2(PCDH15):c.4740del (p.Asp1581fs) rs1554814800
NM_001142771.2(PCDH15):c.4814_4817dup (p.Met1606fs) rs760669176
NM_001142771.2(PCDH15):c.4816dup (p.Met1606fs) rs766484375
NM_001142771.2(PCDH15):c.4869_4871dup (p.Asn1624dup) rs1554814729
NM_001142771.2(PCDH15):c.4871A>G (p.Asn1624Ser)
NM_001142771.2(PCDH15):c.4908_4915del (p.Ser1636fs) rs1554814684
NM_001142771.2(PCDH15):c.4918C>T (p.Gln1640Ter) rs1554814683
NM_001142771.2(PCDH15):c.4932_4935dup (p.Ser1646Ter) rs1198732380
NM_001142771.2(PCDH15):c.4982A>C (p.Gln1661Pro) rs17704703
NM_001384140.1(PCDH15):c.1003C>G (p.Pro335Ala)
NM_001384140.1(PCDH15):c.1140T>C (p.Gly380=)
NM_001384140.1(PCDH15):c.1213C>T (p.Leu405=)
NM_001384140.1(PCDH15):c.1268C>T (p.Pro423Leu)
NM_001384140.1(PCDH15):c.1306A>G (p.Thr436Ala)
NM_001384140.1(PCDH15):c.1327C>G (p.Leu443Val)
NM_001384140.1(PCDH15):c.1637_1638del (p.Thr545_Tyr546insTer) rs1554816541
NM_001384140.1(PCDH15):c.1697_1699del (p.Thr566del)
NM_001384140.1(PCDH15):c.1799C>G (p.Thr600Ser)
NM_001384140.1(PCDH15):c.1897G>A (p.Ala633Thr)
NM_001384140.1(PCDH15):c.1978G>C (p.Val660Leu)
NM_001384140.1(PCDH15):c.1998-21GTTT[2]
NM_001384140.1(PCDH15):c.2291G>T (p.Arg764Leu)
NM_001384140.1(PCDH15):c.2361TGT[2] (p.Val790del) rs483352837
NM_001384140.1(PCDH15):c.2713A>G (p.Met905Val)
NM_001384140.1(PCDH15):c.2751+7G>T
NM_001384140.1(PCDH15):c.2981T>A (p.Leu994His)
NM_001384140.1(PCDH15):c.3012G>A (p.Leu1004=)
NM_001384140.1(PCDH15):c.3225T>C (p.Asn1075=)
NM_001384140.1(PCDH15):c.3382G>A (p.Ala1128Thr)
NM_001384140.1(PCDH15):c.3404A>G (p.Gln1135Arg)
NM_001384140.1(PCDH15):c.3410A>G (p.Glu1137Gly)
NM_001384140.1(PCDH15):c.3416ATC[1] (p.His1140del) rs1554852410
NM_001384140.1(PCDH15):c.3502-13dup
NM_001384140.1(PCDH15):c.3667_3668del (p.Ile1223fs)
NM_001384140.1(PCDH15):c.3813G>C (p.Leu1271Phe)
NM_001384140.1(PCDH15):c.3987T>G (p.Phe1329Leu)
NM_001384140.1(PCDH15):c.4265C>G (p.Ala1422Gly)
NM_001384140.1(PCDH15):c.4308GCC[2] (p.Pro1441_Pro1443del) rs559130985
NM_001384140.1(PCDH15):c.4308GCC[6] (p.Pro1443dup) rs559130985
NM_001384140.1(PCDH15):c.4308GCC[7] (p.Pro1442_Pro1443dup) rs559130985
NM_001384140.1(PCDH15):c.4308GCC[9] (p.Pro1440_Pro1443dup) rs559130985
NM_001384140.1(PCDH15):c.4311G>A (p.Pro1437=)
NM_001384140.1(PCDH15):c.4318C>G (p.Pro1440Ala)
NM_001384140.1(PCDH15):c.4328C>T (p.Pro1443Leu)
NM_001384140.1(PCDH15):c.4368-1649C>G
NM_001384140.1(PCDH15):c.4368-1827_4368-1825del
NM_001384140.1(PCDH15):c.4368-1868GA[2] rs794727570
NM_001384140.1(PCDH15):c.4368-1895_4368-1893del rs113363047
NM_001384140.1(PCDH15):c.4368-1897A>G
NM_001384140.1(PCDH15):c.4368-1899C>G
NM_001384140.1(PCDH15):c.4368-1983_4368-1982del rs1554819767
NM_001384140.1(PCDH15):c.4368-2116A>C
NM_001384140.1(PCDH15):c.4368-2133TTCCTC[3] rs779691085
NM_001384140.1(PCDH15):c.4368-2209_4368-2204del rs397517465
NM_001384140.1(PCDH15):c.4368-2221_4368-2216del rs754779351
NM_001384140.1(PCDH15):c.4368-2224CCT[4] rs754779351
NM_001384140.1(PCDH15):c.4368-2318C>T
NM_001384140.1(PCDH15):c.4368-2362CT[5] rs1554820255
NM_001384140.1(PCDH15):c.4368-2532CT[3] rs1491078644
NM_001384140.1(PCDH15):c.4368-2598_4368-2595dup
NM_001384140.1(PCDH15):c.4368-2768G>A
NM_001384140.1(PCDH15):c.4368-2771TCAG[4] rs770063261
NM_001384140.1(PCDH15):c.4368-2900C>T
NM_001384140.1(PCDH15):c.4368-3058_4368-3056del rs1358121247
NM_001384140.1(PCDH15):c.4504G>A (p.Glu1502Lys) rs1554816509
NM_001384140.1(PCDH15):c.4607C>T (p.Pro1536Leu) rs1554816210
NM_001384140.1(PCDH15):c.4618G>T (p.Glu1540Ter) rs1554816196
NM_001384140.1(PCDH15):c.4671+1009G>A rs1554815909
NM_001384140.1(PCDH15):c.4671+1077_4671+1082del rs1588876049
NM_001384140.1(PCDH15):c.4671+1403GAG[5] rs1272584101
NM_001384140.1(PCDH15):c.4671+1550C>T rs765589050
NM_001384140.1(PCDH15):c.4671+1559C>T rs368397508
NM_001384140.1(PCDH15):c.4671+1577GAA[3] rs774006219
NM_001384140.1(PCDH15):c.4671+1617_4671+1637del rs769671738
NM_001384140.1(PCDH15):c.4672-1662del rs1554815484
NM_001384140.1(PCDH15):c.4708C>T (p.Arg1570Ter) rs770416107
NM_001384140.1(PCDH15):c.4866_4869dup (p.Lys1624fs) rs757520086
NM_001384140.1(PCDH15):c.5054T>C (p.Val1685Ala) rs755487351
NM_001384140.1(PCDH15):c.5084_5085del (p.Thr1695fs) rs1320916581
NM_001384140.1(PCDH15):c.5108_5111dup (p.Ser1704fs) rs1554814669
NM_001384140.1(PCDH15):c.5160TGA[2] (p.Asp1722del) rs1554814635
NM_001384140.1(PCDH15):c.5215A>T (p.Lys1739Ter) rs1554814611
NM_001384140.1(PCDH15):c.705T>C (p.Asn235=)
NM_001384140.1(PCDH15):c.876+7A>G
NM_002778.4(PSAP):c.*238G>C
NM_005709.3(USH1C):c.238dupC (p.Arg80Profs) rs397515359
NM_005709.4(USH1C):c.1284+6880del rs745622612
NM_006383.4(CIB2):c.192G>C (p.Glu64Asp) rs145415848
NM_006383.4(CIB2):c.556C>T (p.Arg186Trp) rs370359511
NM_022124.6(CDH23):c.*104G>C rs377312107
NM_022124.6(CDH23):c.*141G>A rs535544696
NM_022124.6(CDH23):c.*173C>T
NM_022124.6(CDH23):c.*1C>G rs768199443
NM_022124.6(CDH23):c.*204A>G rs2290022
NM_022124.6(CDH23):c.*247C>T
NM_022124.6(CDH23):c.*349A>G rs1867978
NM_022124.6(CDH23):c.*361C>A rs115033851
NM_022124.6(CDH23):c.*408G>A
NM_022124.6(CDH23):c.*430A>T rs562268606
NM_022124.6(CDH23):c.*434G>A rs529522213
NM_022124.6(CDH23):c.*439C>T rs140312023
NM_022124.6(CDH23):c.*478G>C rs564392413
NM_022124.6(CDH23):c.*481G>A
NM_022124.6(CDH23):c.*509C>T
NM_022124.6(CDH23):c.*510G>A rs1054635
NM_022124.6(CDH23):c.*515C>A rs16929375
NM_022124.6(CDH23):c.*56G>A
NM_022124.6(CDH23):c.*612G>A rs886047147
NM_022124.6(CDH23):c.*68G>C rs527311705
NM_022124.6(CDH23):c.*76G>A
NM_022124.6(CDH23):c.*80G>A rs75715348
NM_022124.6(CDH23):c.*83G>A rs886047143
NM_022124.6(CDH23):c.*85G>A rs886047144
NM_022124.6(CDH23):c.-15C>A rs760922529
NM_022124.6(CDH23):c.-168C>T rs886047126
NM_022124.6(CDH23):c.-185G>C rs545081281
NM_022124.6(CDH23):c.-1C>T rs41281302
NM_022124.6(CDH23):c.-258G>A rs139742443
NM_022124.6(CDH23):c.-276G>A rs886047123
NM_022124.6(CDH23):c.-346G>T rs886047122
NM_022124.6(CDH23):c.-353C>G rs886047121
NM_022124.6(CDH23):c.-38G>C rs886047128
NM_022124.6(CDH23):c.-55G>A
NM_022124.6(CDH23):c.-6+13A>C
NM_022124.6(CDH23):c.10010T>C (p.Leu3337Pro) rs746750273
NM_022124.6(CDH23):c.10026C>T (p.Asp3342=) rs377118941
NM_022124.6(CDH23):c.10027G>A (p.Val3343Met) rs756425157
NM_022124.6(CDH23):c.10036G>C (p.Glu3346Gln) rs562525508
NM_022124.6(CDH23):c.10041C>A (p.Thr3347=) rs538081113
NM_022124.6(CDH23):c.10042C>A (p.Pro3348Thr) rs745358868
NM_022124.6(CDH23):c.10044C>G (p.Pro3348=) rs370568585
NM_022124.6(CDH23):c.1038G>A (p.Pro346=) rs74608315
NM_022124.6(CDH23):c.1053C>T (p.Ser351=) rs7903475
NM_022124.6(CDH23):c.1061G>A (p.Ser354Asn) rs200792189
NM_022124.6(CDH23):c.1062C>T (p.Ser354=) rs775091135
NM_022124.6(CDH23):c.1068C>T (p.Ala356=) rs141247813
NM_022124.6(CDH23):c.1078C>T (p.Leu360=) rs185917383
NM_022124.6(CDH23):c.1089C>T (p.Val363=) rs556135873
NM_022124.6(CDH23):c.1096G>A (p.Ala366Thr) rs143282422
NM_022124.6(CDH23):c.1134+13A>G rs7903502
NM_022124.6(CDH23):c.1140+14T>C
NM_022124.6(CDH23):c.1141-12C>T
NM_022124.6(CDH23):c.1141-3C>T
NM_022124.6(CDH23):c.1168T>C (p.Leu390=) rs369803887
NM_022124.6(CDH23):c.1205C>T (p.Pro402Leu) rs373168635
NM_022124.6(CDH23):c.1213G>A (p.Val405Ile)
NM_022124.6(CDH23):c.1263C>T (p.Tyr421=) rs528720730
NM_022124.6(CDH23):c.1281C>T (p.Tyr427=) rs1349593079
NM_022124.6(CDH23):c.1282G>A (p.Asp428Asn) rs188376296
NM_022124.6(CDH23):c.1301A>G (p.Asn434Ser) rs139287714
NM_022124.6(CDH23):c.1307G>A (p.Ser436Asn) rs111033369
NM_022124.6(CDH23):c.1317C>T (p.Asp439=) rs748828988
NM_022124.6(CDH23):c.1342A>T (p.Ile448Phe)
NM_022124.6(CDH23):c.1363G>A (p.Asp455Asn) rs727502920
NM_022124.6(CDH23):c.137C>A (p.Thr46Lys) rs727504613
NM_022124.6(CDH23):c.137C>T (p.Thr46Met) rs727504613
NM_022124.6(CDH23):c.1421C>T (p.Thr474Ile)
NM_022124.6(CDH23):c.1423G>A (p.Val475Met) rs62622410
NM_022124.6(CDH23):c.1446C>A (p.Val482=) rs200324241
NM_022124.6(CDH23):c.1450-10G>A rs751220612
NM_022124.6(CDH23):c.1469G>C (p.Gly490Ala) rs1227049
NM_022124.6(CDH23):c.1472C>T (p.Thr491Ile) rs397517307
NM_022124.6(CDH23):c.1487G>A (p.Ser496Asn) rs10999947
NM_022124.6(CDH23):c.1502A>G (p.Asp501Gly)
NM_022124.6(CDH23):c.1504G>A (p.Asp502Asn) rs200459094
NM_022124.6(CDH23):c.1515-12G>A rs369396703
NM_022124.6(CDH23):c.1520C>T (p.Ser507Leu) rs201584731
NM_022124.6(CDH23):c.1566C>T (p.Asp522=)
NM_022124.6(CDH23):c.1584C>T (p.Arg528=) rs397517309
NM_022124.6(CDH23):c.158C>A (p.Thr53Asn)
NM_022124.6(CDH23):c.1595C>T (p.Thr532Met) rs201297042
NM_022124.6(CDH23):c.1607G>A (p.Arg536Gln) rs376414013
NM_022124.6(CDH23):c.160C>G (p.Gln54Glu)
NM_022124.6(CDH23):c.1618G>A (p.Gly540Ser)
NM_022124.6(CDH23):c.1665C>T (p.Asn555=) rs397517310
NM_022124.6(CDH23):c.1672G>A (p.Val558Met) rs780661396
NM_022124.6(CDH23):c.1699G>A (p.Val567Met)
NM_022124.6(CDH23):c.1719C>T (p.Asn573=) rs761913744
NM_022124.6(CDH23):c.173A>G (p.Gln58Arg) rs61732490
NM_022124.6(CDH23):c.1750C>T (p.Arg584Trp) rs375781856
NM_022124.6(CDH23):c.1751G>A (p.Arg584Gln) rs776970952
NM_022124.6(CDH23):c.1756A>G (p.Thr586Ala)
NM_022124.6(CDH23):c.1778A>C (p.Asn593Thr) rs756958499
NM_022124.6(CDH23):c.1803C>G (p.Val601=) rs201024982
NM_022124.6(CDH23):c.1814C>T (p.Ala605Val) rs201475055
NM_022124.6(CDH23):c.1858+6T>C rs745522676
NM_022124.6(CDH23):c.190C>T (p.Pro64Ser)
NM_022124.6(CDH23):c.1919C>T (p.Thr640Met) rs199796910
NM_022124.6(CDH23):c.1936G>A (p.Ala646Thr)
NM_022124.6(CDH23):c.193del (p.Leu65fs) rs796051861
NM_022124.6(CDH23):c.1963G>A (p.Val655Ile) rs374805957
NM_022124.6(CDH23):c.1978G>A (p.Glu660Lys)
NM_022124.6(CDH23):c.1986+10C>A
NM_022124.6(CDH23):c.1987-1G>A rs1060499714
NM_022124.6(CDH23):c.198G>A (p.Val66=) rs111033288
NM_022124.6(CDH23):c.1990G>A (p.Glu664Lys)
NM_022124.6(CDH23):c.2038G>A (p.Val680Met)
NM_022124.6(CDH23):c.204C>T (p.Gly68=) rs116624130
NM_022124.6(CDH23):c.2059+10C>T
NM_022124.6(CDH23):c.2059+6G>A rs727502923
NM_022124.6(CDH23):c.205G>A (p.Val69Met)
NM_022124.6(CDH23):c.2104C>T (p.Arg702Trp) rs528779319
NM_022124.6(CDH23):c.2112C>T (p.Tyr704=) rs565266663
NM_022124.6(CDH23):c.2162T>A (p.Ile721Asn)
NM_022124.6(CDH23):c.2163C>T (p.Ile721=)
NM_022124.6(CDH23):c.2170C>G (p.Arg724Gly)
NM_022124.6(CDH23):c.2176+12C>T rs371967419
NM_022124.6(CDH23):c.2182A>G (p.Ile728Val)
NM_022124.6(CDH23):c.2189C>T (p.Thr730Ile)
NM_022124.6(CDH23):c.2193G>A (p.Thr731=) rs397517315
NM_022124.6(CDH23):c.2206C>T (p.Arg736Ter) rs1230303971
NM_022124.6(CDH23):c.2235C>T (p.Ile745=) rs368841307
NM_022124.6(CDH23):c.2236G>A (p.Val746Ile) rs550384315
NM_022124.6(CDH23):c.2239C>T (p.Arg747Cys) rs200649500
NM_022124.6(CDH23):c.2263C>T (p.His755Tyr) rs181255269
NM_022124.6(CDH23):c.2283C>T (p.Ile761=) rs267602568
NM_022124.6(CDH23):c.2289+1G>A rs769433759
NM_022124.6(CDH23):c.2289C>T (p.Thr763=)
NM_022124.6(CDH23):c.2290-3C>T
NM_022124.6(CDH23):c.2310C>T (p.Asp770=) rs886047131
NM_022124.6(CDH23):c.2316T>C (p.Asn772=) rs3752752
NM_022124.6(CDH23):c.2330C>A (p.Thr777Lys) rs199709482
NM_022124.6(CDH23):c.2330C>T (p.Thr777Met)
NM_022124.6(CDH23):c.2337G>A (p.Lys779=) rs111033461
NM_022124.6(CDH23):c.2341G>A (p.Ala781Thr) rs375918283
NM_022124.6(CDH23):c.2353A>C (p.Ile785Leu) rs886047132
NM_022124.6(CDH23):c.2388T>C (p.Asp796=) rs3752751
NM_022124.6(CDH23):c.2394C>T (p.Thr798=) rs373269394
NM_022124.6(CDH23):c.2410G>A (p.Asp804Asn) rs1554857840
NM_022124.6(CDH23):c.2424G>A (p.Gly808=) rs76601590
NM_022124.6(CDH23):c.2524C>T (p.Arg842Trp) rs368496658
NM_022124.6(CDH23):c.2525G>A (p.Arg842Gln)
NM_022124.6(CDH23):c.255C>T (p.Gly85=)
NM_022124.6(CDH23):c.2560C>T (p.Arg854Cys)
NM_022124.6(CDH23):c.2568C>G (p.Ile856Met) rs188498736
NM_022124.6(CDH23):c.256G>A (p.Val86Met)
NM_022124.6(CDH23):c.2572G>A (p.Val858Ile) rs181275139
NM_022124.6(CDH23):c.2592C>G (p.Gly864=)
NM_022124.6(CDH23):c.259G>T (p.Val87Leu) rs759917997
NM_022124.6(CDH23):c.2711C>T (p.Pro904Leu) rs199894395
NM_022124.6(CDH23):c.2712G>A (p.Pro904=) rs570110527
NM_022124.6(CDH23):c.2715G>A (p.Ala905=)
NM_022124.6(CDH23):c.271C>T (p.Gln91Ter)
NM_022124.6(CDH23):c.2745C>T (p.Ile915=) rs183220886
NM_022124.6(CDH23):c.2766C>T (p.Asn922=) rs371670151
NM_022124.6(CDH23):c.276A>G (p.Pro92=)
NM_022124.6(CDH23):c.2789C>T (p.Pro930Leu)
NM_022124.6(CDH23):c.2792T>C (p.Val931Ala)
NM_022124.6(CDH23):c.2794G>A (p.Gly932Ser) rs373305209
NM_022124.6(CDH23):c.2814C>T (p.Phe938=) rs749588146
NM_022124.6(CDH23):c.2830A>G (p.Ser944Gly) rs188098974
NM_022124.6(CDH23):c.2846C>T (p.Thr949Ile)
NM_022124.6(CDH23):c.2863C>A (p.Arg955Ser)
NM_022124.6(CDH23):c.2869C>T (p.Arg957Cys) rs532018311
NM_022124.6(CDH23):c.2876C>T (p.Ala959Val) rs779133533
NM_022124.6(CDH23):c.2878G>A (p.Glu960Lys) rs111033458
NM_022124.6(CDH23):c.2891G>A (p.Arg964Gln) rs376560330
NM_022124.6(CDH23):c.28C>T (p.His10Tyr)
NM_022124.6(CDH23):c.2909C>T (p.Ala970Val)
NM_022124.6(CDH23):c.2915C>T (p.Thr972Met) rs762772276
NM_022124.6(CDH23):c.2940G>A (p.Thr980=) rs373631099
NM_022124.6(CDH23):c.2953+10C>T rs781572688
NM_022124.6(CDH23):c.2954-14G>A rs191534381
NM_022124.6(CDH23):c.2954-15C>T rs376377077
NM_022124.6(CDH23):c.2958G>A (p.Leu986=) rs74702249
NM_022124.6(CDH23):c.2970C>T (p.Asp990=) rs56216952
NM_022124.6(CDH23):c.2971G>A (p.Glu991Lys)
NM_022124.6(CDH23):c.2975C>T (p.Thr992Met)
NM_022124.6(CDH23):c.3009T>C (p.Ser1003=) rs10823829
NM_022124.6(CDH23):c.3010G>A (p.Val1004Met) rs79705488
NM_022124.6(CDH23):c.3016G>A (p.Glu1006Lys) rs745571683
NM_022124.6(CDH23):c.3021C>T (p.Asp1007=)
NM_022124.6(CDH23):c.3022G>A (p.Val1008Met) rs201053044
NM_022124.6(CDH23):c.3067G>A (p.Asp1023Asn) rs1064796283
NM_022124.6(CDH23):c.3069C>T (p.Asp1023=)
NM_022124.6(CDH23):c.3074G>A (p.Gly1025Asp) rs143179070
NM_022124.6(CDH23):c.3092G>C (p.Ser1031Thr) rs397517320
NM_022124.6(CDH23):c.3093C>T (p.Ser1031=)
NM_022124.6(CDH23):c.3106+11G>A
NM_022124.6(CDH23):c.3118G>T (p.Asp1040Tyr) rs200177873
NM_022124.6(CDH23):c.3162C>G (p.Thr1054=) rs377259987
NM_022124.6(CDH23):c.3172C>G (p.Leu1058Val) rs748462315
NM_022124.6(CDH23):c.3176A>T (p.Asp1059Val)
NM_022124.6(CDH23):c.3178C>T (p.Arg1060Trp) rs201536811
NM_022124.6(CDH23):c.3186C>A (p.Thr1062=) rs201589645
NM_022124.6(CDH23):c.3192C>T (p.Ala1064=) rs767119185
NM_022124.6(CDH23):c.3213G>A (p.Glu1071=) rs140255091
NM_022124.6(CDH23):c.321C>G (p.Val107=) rs761122371
NM_022124.6(CDH23):c.3221-7C>T rs776427467
NM_022124.6(CDH23):c.3248C>T (p.Thr1083Met)
NM_022124.6(CDH23):c.3249G>A (p.Thr1083=) rs79805606
NM_022124.6(CDH23):c.324C>T (p.Ser108=) rs373668614
NM_022124.6(CDH23):c.3262G>A (p.Val1088Met) rs200632520
NM_022124.6(CDH23):c.3293A>G (p.Asn1098Ser) rs41281310
NM_022124.6(CDH23):c.3301A>G (p.Ile1101Val) rs199510686
NM_022124.6(CDH23):c.3328A>G (p.Ser1110Gly) rs757508152
NM_022124.6(CDH23):c.3330C>G (p.Ser1110Arg)
NM_022124.6(CDH23):c.3331G>A (p.Val1111Ile) rs397517321
NM_022124.6(CDH23):c.3337G>C (p.Glu1113Gln) rs397517322
NM_022124.6(CDH23):c.3351A>G (p.Glu1117=)
NM_022124.6(CDH23):c.3352G>A (p.Gly1118Ser) rs562052236
NM_022124.6(CDH23):c.3361A>T (p.Ile1121Phe) rs200542052
NM_022124.6(CDH23):c.3364T>G (p.Leu1122Val) rs77821631
NM_022124.6(CDH23):c.3369+12G>A rs187975106
NM_022124.6(CDH23):c.3397G>A (p.Glu1133Lys) rs111033509
NM_022124.6(CDH23):c.3407G>A (p.Arg1136His)
NM_022124.6(CDH23):c.3428dup (p.His1143fs) rs1253419936
NM_022124.6(CDH23):c.3431-6A>T rs377614198
NM_022124.6(CDH23):c.3452G>A (p.Arg1151Gln)
NM_022124.6(CDH23):c.3467A>G (p.Asn1156Ser)
NM_022124.6(CDH23):c.3480G>T (p.Met1160Ile) rs111033519
NM_022124.6(CDH23):c.3491G>A (p.Arg1164Gln)
NM_022124.6(CDH23):c.3508C>T (p.Arg1170Trp)
NM_022124.6(CDH23):c.3522C>T (p.His1174=) rs750705577
NM_022124.6(CDH23):c.3547C>A (p.His1183Asn)
NM_022124.6(CDH23):c.3574G>A (p.Val1192Ile) rs80028391
NM_022124.6(CDH23):c.3580-12C>T rs73275848
NM_022124.6(CDH23):c.3580-13C>T rs150894638
NM_022124.6(CDH23):c.3613G>T (p.Ala1205Ser) rs886047134
NM_022124.6(CDH23):c.3614C>T (p.Ala1205Val) rs886047135
NM_022124.6(CDH23):c.3619G>A (p.Val1207Met) rs111033488
NM_022124.6(CDH23):c.3625A>G (p.Thr1209Ala) rs41281314
NM_022124.6(CDH23):c.3664G>A (p.Ala1222Thr) rs41281316
NM_022124.6(CDH23):c.366T>C (p.Val122=) rs3802720
NM_022124.6(CDH23):c.3678G>A (p.Thr1226=)
NM_022124.6(CDH23):c.367G>A (p.Gly123Arg) rs727504513
NM_022124.6(CDH23):c.367G>C (p.Gly123Arg) rs727504513
NM_022124.6(CDH23):c.3688G>A (p.Val1230Met)
NM_022124.6(CDH23):c.3695A>G (p.Gln1232Arg)
NM_022124.6(CDH23):c.3739C>T (p.Arg1247Cys) rs202204597
NM_022124.6(CDH23):c.3764A>T (p.Lys1255Met) rs372158876
NM_022124.6(CDH23):c.3801C>T (p.Thr1267=) rs56107171
NM_022124.6(CDH23):c.3839TGA[1] (p.Met1281del) rs796051860
NM_022124.6(CDH23):c.3845A>G (p.Asn1282Ser) rs149073355
NM_022124.6(CDH23):c.3847G>A (p.Val1283Met) rs758413650
NM_022124.6(CDH23):c.3852G>A (p.Ser1284=) rs372172457
NM_022124.6(CDH23):c.385G>A (p.Ala129Thr) rs200328570
NM_022124.6(CDH23):c.386C>T (p.Ala129Val) rs183046743
NM_022124.6(CDH23):c.387G>A (p.Ala129=) rs201919232
NM_022124.6(CDH23):c.3880C>T (p.Gln1294Ter) rs121908350
NM_022124.6(CDH23):c.3895G>A (p.Val1299Ile) rs201610096
NM_022124.6(CDH23):c.3915C>T (p.Asn1305=) rs568924674
NM_022124.6(CDH23):c.3927G>A (p.Glu1309=) rs115398922
NM_022124.6(CDH23):c.3929C>A (p.Ala1310Asp) rs483353051
NM_022124.6(CDH23):c.3972G>A (p.Glu1324=)
NM_022124.6(CDH23):c.3986G>A (p.Gly1329Asp) rs201877610
NM_022124.6(CDH23):c.3999G>A (p.Val1333=) rs111033453
NM_022124.6(CDH23):c.4000C>T (p.Arg1334Trp) rs373276722
NM_022124.6(CDH23):c.4005C>G (p.Val1335=) rs886047136
NM_022124.6(CDH23):c.4021G>A (p.Asp1341Asn) rs121908351
NM_022124.6(CDH23):c.4040C>T (p.Thr1347Met)
NM_022124.6(CDH23):c.4041G>C (p.Thr1347=)
NM_022124.6(CDH23):c.4045C>T (p.Arg1349Cys) rs41281318
NM_022124.6(CDH23):c.4051A>G (p.Asn1351Asp) rs1227065
NM_022124.6(CDH23):c.4068C>G (p.Thr1356=) rs143136329
NM_022124.6(CDH23):c.4070A>G (p.Gln1357Arg)
NM_022124.6(CDH23):c.4103C>T (p.Thr1368Met) rs762247872
NM_022124.6(CDH23):c.4104+4A>T rs483353052
NM_022124.6(CDH23):c.4105-2A>T
NM_022124.6(CDH23):c.4116A>G (p.Thr1372=)
NM_022124.6(CDH23):c.4146C>T (p.Gly1382=) rs201008425
NM_022124.6(CDH23):c.4179C>T (p.Asp1393=) rs571668370
NM_022124.6(CDH23):c.4203C>T (p.Thr1401=) rs202166096
NM_022124.6(CDH23):c.4210-12G>A
NM_022124.6(CDH23):c.4210-2A>G rs557620034
NM_022124.6(CDH23):c.4210-7C>T rs79271090
NM_022124.6(CDH23):c.4275G>A (p.Ala1425=)
NM_022124.6(CDH23):c.429+13G>A rs3802719
NM_022124.6(CDH23):c.429+4G>A rs397517328
NM_022124.6(CDH23):c.4299T>A (p.Pro1433=) rs12218559
NM_022124.6(CDH23):c.42T>C (p.Leu14=)
NM_022124.6(CDH23):c.4309C>T (p.Arg1437Ter) rs397517329
NM_022124.6(CDH23):c.4310G>A (p.Arg1437Gln) rs56181447
NM_022124.6(CDH23):c.4341T>C (p.Asp1447=) rs12218564
NM_022124.6(CDH23):c.4346G>A (p.Gly1449Asp) rs544278944
NM_022124.6(CDH23):c.4356G>A (p.Gly1452=)
NM_022124.6(CDH23):c.4359+11G>A rs12242607
NM_022124.6(CDH23):c.4390G>A (p.Ala1464Thr) rs756674688
NM_022124.6(CDH23):c.4390G>T (p.Ala1464Ser)
NM_022124.6(CDH23):c.4391C>T (p.Ala1464Val) rs374362883
NM_022124.6(CDH23):c.4405A>G (p.Ile1469Val) rs200635365
NM_022124.6(CDH23):c.4418A>G (p.Asn1473Ser)
NM_022124.6(CDH23):c.4431C>T (p.Gly1477=) rs763102268
NM_022124.6(CDH23):c.4451C>T (p.Pro1484Leu) rs371145622
NM_022124.6(CDH23):c.4488G>C (p.Gln1496His) rs121908347
NM_022124.6(CDH23):c.4509C>T (p.Gly1503=) rs10999978
NM_022124.6(CDH23):c.4519C>T (p.Arg1507Trp)
NM_022124.6(CDH23):c.4520G>A (p.Arg1507Gln)
NM_022124.6(CDH23):c.4543G>T (p.Val1515Leu)
NM_022124.6(CDH23):c.4582G>A (p.Glu1528Lys) rs201533282
NM_022124.6(CDH23):c.4589C>T (p.Pro1530Leu) rs554938323
NM_022124.6(CDH23):c.4620C>T (p.Asn1540=) rs111033490
NM_022124.6(CDH23):c.4662C>A (p.Asp1554Glu) rs771353319
NM_022124.6(CDH23):c.4687C>A (p.Leu1563Met)
NM_022124.6(CDH23):c.4723G>A (p.Ala1575Thr) rs1227051
NM_022124.6(CDH23):c.4729C>T (p.Arg1577Cys)
NM_022124.6(CDH23):c.4746C>T (p.Ser1582=)
NM_022124.6(CDH23):c.4762C>T (p.Arg1588Trp)
NM_022124.6(CDH23):c.4780C>T (p.Arg1594Cys) rs200664666
NM_022124.6(CDH23):c.4781G>A (p.Arg1594His)
NM_022124.6(CDH23):c.4793G>A (p.Ser1598Asn)
NM_022124.6(CDH23):c.4795T>C (p.Phe1599Leu) rs886047137
NM_022124.6(CDH23):c.4842G>C (p.Leu1614=) rs368377560
NM_022124.6(CDH23):c.4853C>T (p.Thr1618Met)
NM_022124.6(CDH23):c.4854G>A (p.Thr1618=) rs376538879
NM_022124.6(CDH23):c.4857C>T (p.His1619=) rs369817589
NM_022124.6(CDH23):c.4858G>A (p.Val1620Met) rs41281330
NM_022124.6(CDH23):c.4863C>T (p.Tyr1621=) rs374797859
NM_022124.6(CDH23):c.4864G>A (p.Val1622Met)
NM_022124.6(CDH23):c.4875G>A (p.Val1625=) rs149664909
NM_022124.6(CDH23):c.4884T>C (p.Asn1628=) rs777745599
NM_022124.6(CDH23):c.4892C>T (p.Ala1631Val) rs370762269
NM_022124.6(CDH23):c.4897A>G (p.Met1633Val)
NM_022124.6(CDH23):c.4913A>C (p.His1638Pro) rs886047138
NM_022124.6(CDH23):c.4937G>A (p.Gly1646Asp) rs759019656
NM_022124.6(CDH23):c.4978C>T (p.Leu1660=)
NM_022124.6(CDH23):c.4984C>T (p.Leu1662=) rs886047139
NM_022124.6(CDH23):c.499G>A (p.Val167Ile) rs772995621
NM_022124.6(CDH23):c.5002G>A (p.Gly1668Ser)
NM_022124.6(CDH23):c.5004C>T (p.Gly1668=)
NM_022124.6(CDH23):c.5009T>A (p.Val1670Asp) rs397517333
NM_022124.6(CDH23):c.5022C>T (p.Ile1674=) rs376952695
NM_022124.6(CDH23):c.5023G>A (p.Val1675Ile) rs17712523
NM_022124.6(CDH23):c.5026G>A (p.Ala1676Thr) rs56043301
NM_022124.6(CDH23):c.5037C>T (p.Ile1679=) rs757049933
NM_022124.6(CDH23):c.5050C>T (p.Arg1684Cys) rs111033522
NM_022124.6(CDH23):c.5055C>T (p.Ile1685=) rs377269771
NM_022124.6(CDH23):c.5056G>A (p.Asp1686Asn)
NM_022124.6(CDH23):c.5066T>C (p.Met1689Thr) rs397517334
NM_022124.6(CDH23):c.5067+15G>A rs367928867
NM_022124.6(CDH23):c.5100C>T (p.Tyr1700=) rs10762480
NM_022124.6(CDH23):c.510C>T (p.Ser170=) rs143341423
NM_022124.6(CDH23):c.5112C>T (p.His1704=) rs774919846
NM_022124.6(CDH23):c.5116C>T (p.Arg1706Cys)
NM_022124.6(CDH23):c.5117G>A (p.Arg1706His)
NM_022124.6(CDH23):c.5130C>A (p.Ile1710=) rs111033487
NM_022124.6(CDH23):c.5131G>A (p.Val1711Ile) rs181611778
NM_022124.6(CDH23):c.5132T>C (p.Val1711Ala)
NM_022124.6(CDH23):c.5187+4G>A
NM_022124.6(CDH23):c.5228C>A (p.Thr1743Asn) rs191021194
NM_022124.6(CDH23):c.5236C>T (p.Arg1746Trp) rs201763918
NM_022124.6(CDH23):c.5237G>A (p.Arg1746Gln) rs111033270
NM_022124.6(CDH23):c.5248G>A (p.Gly1750Arg) rs372822465
NM_022124.6(CDH23):c.5257G>A (p.Glu1753Lys) rs759706770
NM_022124.6(CDH23):c.5297T>C (p.Phe1766Ser) rs114745089
NM_022124.6(CDH23):c.5311C>T (p.Arg1771Ter) rs750027965
NM_022124.6(CDH23):c.5312G>A (p.Arg1771Gln) rs111033480
NM_022124.6(CDH23):c.5328C>A (p.Asn1776Lys) rs371522191
NM_022124.6(CDH23):c.5328C>T (p.Asn1776=) rs371522191
NM_022124.6(CDH23):c.5385T>C (p.Ser1795=)
NM_022124.6(CDH23):c.5397G>A (p.Gly1799=) rs749913488
NM_022124.6(CDH23):c.5410C>T (p.Arg1804Trp) rs376271562
NM_022124.6(CDH23):c.5411G>A (p.Arg1804Gln) rs3802711
NM_022124.6(CDH23):c.5418C>G (p.Asp1806Glu) rs74145660
NM_022124.6(CDH23):c.5442C>T (p.Ile1814=) rs373768157
NM_022124.6(CDH23):c.5443G>A (p.Ala1815Thr)
NM_022124.6(CDH23):c.5471G>A (p.Arg1824His) rs111033491
NM_022124.6(CDH23):c.5477G>A (p.Arg1826Gln)
NM_022124.6(CDH23):c.5503-10A>G rs2394839
NM_022124.6(CDH23):c.5505G>A (p.Met1835Ile) rs200786014
NM_022124.6(CDH23):c.5519G>A (p.Arg1840Gln) rs375083901
NM_022124.6(CDH23):c.5523G>A (p.Val1841=) rs369513655
NM_022124.6(CDH23):c.5541C>T (p.Asn1847=) rs148632119
NM_022124.6(CDH23):c.5542G>A (p.Asp1848Asn) rs188078418
NM_022124.6(CDH23):c.5544C>T (p.Asp1848=) rs142131750
NM_022124.6(CDH23):c.559G>A (p.Val187Ile)
NM_022124.6(CDH23):c.5627G>A (p.Ser1876Asn)
NM_022124.6(CDH23):c.5647A>C (p.Asn1883His) rs747488431
NM_022124.6(CDH23):c.5653C>T (p.Arg1885Cys) rs368848049
NM_022124.6(CDH23):c.5660C>T (p.Thr1887Ile) rs397517340
NM_022124.6(CDH23):c.5668A>T (p.Ile1890Phe)
NM_022124.6(CDH23):c.5686G>C (p.Glu1896Gln)
NM_022124.6(CDH23):c.5689C>T (p.Arg1897Trp)
NM_022124.6(CDH23):c.570C>G (p.Ile190Met)
NM_022124.6(CDH23):c.5711C>T (p.Thr1904Met) rs372981760
NM_022124.6(CDH23):c.5719A>T (p.Ile1907Phe)
NM_022124.6(CDH23):c.5721C>A (p.Ile1907=)
NM_022124.6(CDH23):c.5722G>A (p.Val1908Ile) rs368828743
NM_022124.6(CDH23):c.5735G>A (p.Arg1912Gln)
NM_022124.6(CDH23):c.5743G>A (p.Asp1915Asn)
NM_022124.6(CDH23):c.574G>C (p.Glu192Gln) rs199514829
NM_022124.6(CDH23):c.5753G>A (p.Arg1918Gln) rs115113440
NM_022124.6(CDH23):c.5796G>A (p.Pro1932=) rs370965108
NM_022124.6(CDH23):c.5810T>C (p.Ile1937Thr)
NM_022124.6(CDH23):c.5821-13C>T rs117317626
NM_022124.6(CDH23):c.5865C>T (p.Asn1955=) rs762382800
NM_022124.6(CDH23):c.5871C>G (p.Pro1957=) rs368122233
NM_022124.6(CDH23):c.588G>A (p.Glu196=) rs886047129
NM_022124.6(CDH23):c.5931T>C (p.Pro1977=) rs373457993
NM_022124.6(CDH23):c.5937G>A (p.Thr1979=) rs397517347
NM_022124.6(CDH23):c.5945A>G (p.Asn1982Ser) rs555432123
NM_022124.6(CDH23):c.5970A>G (p.Ala1990=)
NM_022124.6(CDH23):c.5985C>T (p.Tyr1995=) rs370762205
NM_022124.6(CDH23):c.5996C>G (p.Thr1999Ser) rs11592462
NM_022124.6(CDH23):c.6000C>A (p.Tyr2000Ter) rs1564794944
NM_022124.6(CDH23):c.6004C>G (p.Leu2002Val) rs756459547
NM_022124.6(CDH23):c.6049G>A (p.Gly2017Ser) rs183431253
NM_022124.6(CDH23):c.6050-9G>A rs367928692
NM_022124.6(CDH23):c.6081T>G (p.Ile2027Met)
NM_022124.6(CDH23):c.6091G>A (p.Ala2031Thr) rs368381520
NM_022124.6(CDH23):c.6098C>T (p.Ser2033Leu) rs537971045
NM_022124.6(CDH23):c.612G>A (p.Thr204=) rs200200488
NM_022124.6(CDH23):c.6130G>A (p.Glu2044Lys) rs10466026
NM_022124.6(CDH23):c.6138C>T (p.Ile2046=) rs568741210
NM_022124.6(CDH23):c.6140G>A (p.Gly2047Glu)
NM_022124.6(CDH23):c.6163C>T (p.Leu2055=) rs536022792
NM_022124.6(CDH23):c.6169A>G (p.Ile2057Val) rs573057228
NM_022124.6(CDH23):c.6197G>A (p.Arg2066Gln) rs201887949
NM_022124.6(CDH23):c.6249G>A (p.Pro2083=) rs55964031
NM_022124.6(CDH23):c.625-10G>A
NM_022124.6(CDH23):c.6285dup (p.Glu2096Ter) rs1564796487
NM_022124.6(CDH23):c.6320G>A (p.Arg2107Gln)
NM_022124.6(CDH23):c.6320G>T (p.Arg2107Leu)
NM_022124.6(CDH23):c.6322A>G (p.Ile2108Val)
NM_022124.6(CDH23):c.6329C>T (p.Ala2110Val) rs111033492
NM_022124.6(CDH23):c.6333G>A (p.Gly2111=) rs368155422
NM_022124.6(CDH23):c.6366C>T (p.Thr2122=) rs368440578
NM_022124.6(CDH23):c.6367G>A (p.Gly2123Arg) rs727504894
NM_022124.6(CDH23):c.6375C>A (p.Ile2125=)
NM_022124.6(CDH23):c.6376C>T (p.Arg2126Cys) rs776269225
NM_022124.6(CDH23):c.6377G>A (p.Arg2126His) rs201942629
NM_022124.6(CDH23):c.6421A>G (p.Arg2141Gly) rs376414352
NM_022124.6(CDH23):c.6426A>G (p.Leu2142=) rs371932558
NM_022124.6(CDH23):c.6429G>A (p.Thr2143=) rs142788731
NM_022124.6(CDH23):c.6440C>A (p.Thr2147Asn) rs769241730
NM_022124.6(CDH23):c.6442G>A (p.Asp2148Asn) rs111033271
NM_022124.6(CDH23):c.6446G>A (p.Arg2149Gln) rs377376107
NM_022124.6(CDH23):c.6449del (p.Gly2150fs) rs1564796673
NM_022124.6(CDH23):c.6492C>T (p.Ile2164=) rs41281332
NM_022124.6(CDH23):c.6547G>A (p.Val2183Met) rs370794439
NM_022124.6(CDH23):c.662A>C (p.Asn221Thr)
NM_022124.6(CDH23):c.6648C>T (p.Ala2216=) rs186394654
NM_022124.6(CDH23):c.6649A>G (p.Lys2217Glu)
NM_022124.6(CDH23):c.6654C>A (p.Asp2218Glu) rs537236734
NM_022124.6(CDH23):c.6664C>T (p.Arg2222Cys) rs761082272
NM_022124.6(CDH23):c.6678C>T (p.Asn2226=) rs372120764
NM_022124.6(CDH23):c.6687C>T (p.Asp2229=) rs76463072
NM_022124.6(CDH23):c.67+12C>T rs74144963
NM_022124.6(CDH23):c.67+8C>T rs186548927
NM_022124.6(CDH23):c.6705C>T (p.Ile2235=) rs114827737
NM_022124.6(CDH23):c.6713-8G>A rs369946986
NM_022124.6(CDH23):c.6718G>A (p.Val2240Ile) rs727504694
NM_022124.6(CDH23):c.68-3C>T rs142456469
NM_022124.6(CDH23):c.6808C>T (p.Arg2270Cys)
NM_022124.6(CDH23):c.6830-7A>C rs200587627
NM_022124.6(CDH23):c.6847G>A (p.Val2283Ile) rs41281334
NM_022124.6(CDH23):c.6852G>C (p.Leu2284=) rs56013867
NM_022124.6(CDH23):c.6855C>T (p.Asp2285=) rs750385396
NM_022124.6(CDH23):c.6856G>A (p.Val2286Ile)
NM_022124.6(CDH23):c.6911G>A (p.Arg2304Gln) rs201434373
NM_022124.6(CDH23):c.6918G>A (p.Leu2306=) rs146819206
NM_022124.6(CDH23):c.6980T>A (p.Leu2327His)
NM_022124.6(CDH23):c.6990G>T (p.Leu2330=) rs111033495
NM_022124.6(CDH23):c.699C>T (p.Asp233=)
NM_022124.6(CDH23):c.7022C>G (p.Pro2341Arg)
NM_022124.6(CDH23):c.7049C>T (p.Ser2350Leu) rs371522435
NM_022124.6(CDH23):c.7050G>A (p.Ser2350=)
NM_022124.6(CDH23):c.7054+6T>C
NM_022124.6(CDH23):c.7055-15G>A rs371872394
NM_022124.6(CDH23):c.7073G>A (p.Arg2358Gln) rs4747194
NM_022124.6(CDH23):c.7086C>T (p.Tyr2362=) rs1287792582
NM_022124.6(CDH23):c.7091A>G (p.Glu2364Gly) rs758727384
NM_022124.6(CDH23):c.7113C>T (p.Thr2371=) rs747544364
NM_022124.6(CDH23):c.7114G>A (p.Val2372Met)
NM_022124.6(CDH23):c.7131C>T (p.Asn2377=)
NM_022124.6(CDH23):c.7132G>A (p.Gly2378Arg) rs181197242
NM_022124.6(CDH23):c.7139C>T (p.Pro2380Leu) rs4747195
NM_022124.6(CDH23):c.719C>T (p.Pro240Leu) rs121908354
NM_022124.6(CDH23):c.7225-11C>G
NM_022124.6(CDH23):c.7263C>A (p.Ile2421=)
NM_022124.6(CDH23):c.7295G>A (p.Gly2432Asp)
NM_022124.6(CDH23):c.7362+14G>A rs78158757
NM_022124.6(CDH23):c.7362+5G>A rs727502931
NM_022124.6(CDH23):c.7362G>A (p.Thr2454=) rs370983472
NM_022124.6(CDH23):c.7382C>T (p.Ser2461Phe)
NM_022124.6(CDH23):c.738C>T (p.Tyr246=) rs745668474
NM_022124.6(CDH23):c.7393C>T (p.Arg2465Trp)
NM_022124.6(CDH23):c.7461C>T (p.Asn2487=)
NM_022124.6(CDH23):c.7467C>T (p.Arg2489=) rs111033289
NM_022124.6(CDH23):c.7468G>A (p.Glu2490Lys) rs41281336
NM_022124.6(CDH23):c.7482+12C>A rs370000472
NM_022124.6(CDH23):c.7517G>A (p.Arg2506Gln) rs727502932
NM_022124.6(CDH23):c.7551C>T (p.Ser2517=) rs886047140
NM_022124.6(CDH23):c.7552G>A (p.Val2518Met) rs376617494
NM_022124.6(CDH23):c.7569G>A (p.Pro2523=) rs533989797
NM_022124.6(CDH23):c.7572G>A (p.Ala2524=) rs10823849
NM_022124.6(CDH23):c.7581G>A (p.Ser2527=)
NM_022124.6(CDH23):c.7630T>C (p.Leu2544=) rs114819374
NM_022124.6(CDH23):c.7661-8A>G rs754067214
NM_022124.6(CDH23):c.7685C>T (p.Ser2562Leu) rs538435711
NM_022124.6(CDH23):c.7720T>C (p.Tyr2574His) rs886047141
NM_022124.6(CDH23):c.7722C>T (p.Tyr2574=) rs111033483
NM_022124.6(CDH23):c.772A>G (p.Ile258Val) rs370782827
NM_022124.6(CDH23):c.7762G>C (p.Glu2588Gln) rs41281338
NM_022124.6(CDH23):c.777C>A (p.Thr259=) rs542798557
NM_022124.6(CDH23):c.7823G>A (p.Arg2608His) rs202052174
NM_022124.6(CDH23):c.7838G>A (p.Arg2613His)
NM_022124.6(CDH23):c.7872+1G>A
NM_022124.6(CDH23):c.7872G>A (p.Glu2624=) rs1292050472
NM_022124.6(CDH23):c.7873-4A>G
NM_022124.6(CDH23):c.7893C>T (p.Asn2631=)
NM_022124.6(CDH23):c.789G>A (p.Gln263=)
NM_022124.6(CDH23):c.7978del (p.Asp2660fs)
NM_022124.6(CDH23):c.7999G>C (p.Asp2667His) rs200251748
NM_022124.6(CDH23):c.79C>T (p.Arg27Trp)
NM_022124.6(CDH23):c.7C>T (p.Arg3Cys) rs7902757
NM_022124.6(CDH23):c.8009G>A (p.Ser2670Asn) rs749342092
NM_022124.6(CDH23):c.8022G>A (p.Gln2674=) rs201733315
NM_022124.6(CDH23):c.8062A>G (p.Ser2688Gly)
NM_022124.6(CDH23):c.8064+13C>A
NM_022124.6(CDH23):c.8065-5C>A
NM_022124.6(CDH23):c.806G>A (p.Arg269Gln)
NM_022124.6(CDH23):c.8121G>T (p.Pro2707=) rs377535432
NM_022124.6(CDH23):c.8154C>T (p.Asn2718=)
NM_022124.6(CDH23):c.8167G>C (p.Val2723Leu) rs142857685
NM_022124.6(CDH23):c.8178A>T (p.Pro2726=)
NM_022124.6(CDH23):c.8225C>G (p.Pro2742Arg)
NM_022124.6(CDH23):c.8225C>T (p.Pro2742Leu) rs758360283
NM_022124.6(CDH23):c.8229C>T (p.Arg2743=) rs372996083
NM_022124.6(CDH23):c.8239del (p.Val2747fs) rs1554877007
NM_022124.6(CDH23):c.8244C>T (p.Gly2748=)
NM_022124.6(CDH23):c.8256C>T (p.Gly2752=) rs372846962
NM_022124.6(CDH23):c.8257G>A (p.Ala2753Thr) rs397517356
NM_022124.6(CDH23):c.8257G>T (p.Ala2753Ser)
NM_022124.6(CDH23):c.8283C>T (p.Asn2761=) rs397517357
NM_022124.6(CDH23):c.8290G>A (p.Val2764Met) rs556148352
NM_022124.6(CDH23):c.8304C>T (p.Ile2768=) rs760929762
NM_022124.6(CDH23):c.8309-3C>T rs371910002
NM_022124.6(CDH23):c.8310C>T (p.Ala2770=) rs749582906
NM_022124.6(CDH23):c.8311G>A (p.Gly2771Ser) rs201076440
NM_022124.6(CDH23):c.8316C>T (p.Asn2772=) rs368145346
NM_022124.6(CDH23):c.8317G>A (p.Glu2773Lys)
NM_022124.6(CDH23):c.8344G>A (p.Asp2782Asn)
NM_022124.6(CDH23):c.8344G>C (p.Asp2782His)
NM_022124.6(CDH23):c.836A>G (p.Asn279Ser) rs886047130
NM_022124.6(CDH23):c.8378G>A (p.Arg2793Gln) rs547034667
NM_022124.6(CDH23):c.8401T>G (p.Phe2801Val) rs3802707
NM_022124.6(CDH23):c.8406C>T (p.Ile2802=) rs752125151
NM_022124.6(CDH23):c.8407G>A (p.Val2803Ile) rs369697366
NM_022124.6(CDH23):c.8421C>T (p.Ser2807=) rs755841293
NM_022124.6(CDH23):c.8425C>T (p.Arg2809Cys)
NM_022124.6(CDH23):c.8437C>T (p.Pro2813Ser)
NM_022124.6(CDH23):c.8444G>A (p.Arg2815His) rs376835293
NM_022124.6(CDH23):c.8463C>T (p.Leu2821=)
NM_022124.6(CDH23):c.8479C>T (p.Leu2827Phe)
NM_022124.6(CDH23):c.8533C>T (p.Arg2845Cys) rs727505254
NM_022124.6(CDH23):c.8534G>A (p.Arg2845His) rs199668532
NM_022124.6(CDH23):c.856C>T (p.Leu286=) rs727502918
NM_022124.6(CDH23):c.8570C>T (p.Thr2857Ile)
NM_022124.6(CDH23):c.8624T>C (p.Ile2875Thr)
NM_022124.6(CDH23):c.8644T>C (p.Phe2882Leu) rs761210350
NM_022124.6(CDH23):c.8672T>G (p.Phe2891Cys)
NM_022124.6(CDH23):c.8693C>A (p.Ser2898Tyr)
NM_022124.6(CDH23):c.8726G>A (p.Ser2909Asn) rs397517361
NM_022124.6(CDH23):c.8729T>C (p.Met2910Thr) rs374171450
NM_022124.6(CDH23):c.8743C>T (p.Arg2915Cys) rs185818081
NM_022124.6(CDH23):c.8775C>T (p.Pro2925=) rs766541944
NM_022124.6(CDH23):c.8784C>T (p.Phe2928=)
NM_022124.6(CDH23):c.8785G>A (p.Val2929Met)
NM_022124.6(CDH23):c.8803C>T (p.Arg2935Ter) rs1190307769
NM_022124.6(CDH23):c.8823C>T (p.Asn2941=) rs370184182
NM_022124.6(CDH23):c.8824G>A (p.Asp2942Asn) rs371286324
NM_022124.6(CDH23):c.8859C>T (p.Asp2953=) rs11000008
NM_022124.6(CDH23):c.8869G>A (p.Val2957Ile)
NM_022124.6(CDH23):c.8878G>A (p.Val2960Ile) rs748152139
NM_022124.6(CDH23):c.8886C>A (p.Asn2962Lys)
NM_022124.6(CDH23):c.8886C>T (p.Asn2962=) rs376881824
NM_022124.6(CDH23):c.8895C>T (p.Pro2965=) rs11000009
NM_022124.6(CDH23):c.8899C>T (p.Arg2967Cys) rs373602652
NM_022124.6(CDH23):c.8900G>A (p.Arg2967His)
NM_022124.6(CDH23):c.8901T>G (p.Arg2967=) rs375720093
NM_022124.6(CDH23):c.8907C>T (p.Arg2969=) rs11000010
NM_022124.6(CDH23):c.8914G>A (p.Glu2972Lys) rs746716712
NM_022124.6(CDH23):c.8931C>T (p.His2977=) rs781099726
NM_022124.6(CDH23):c.8957T>C (p.Ile2986Thr)
NM_022124.6(CDH23):c.8979+13C>T rs886047142
NM_022124.6(CDH23):c.8980-12C>T rs111583276
NM_022124.6(CDH23):c.8980-14C>A rs45522532
NM_022124.6(CDH23):c.8986G>A (p.Val2996Met)
NM_022124.6(CDH23):c.9014C>G (p.Ala3005Gly) rs188966938
NM_022124.6(CDH23):c.9014C>T (p.Ala3005Val) rs188966938
NM_022124.6(CDH23):c.9015G>A (p.Ala3005=) rs376497158
NM_022124.6(CDH23):c.901C>A (p.Arg301=)
NM_022124.6(CDH23):c.901C>T (p.Arg301Trp) rs397517364
NM_022124.6(CDH23):c.9077+7C>T rs76114420
NM_022124.6(CDH23):c.9077+8G>A rs11818398
NM_022124.6(CDH23):c.9108G>A (p.Glu3036=) rs768198017
NM_022124.6(CDH23):c.9116G>A (p.Arg3039Gln)
NM_022124.6(CDH23):c.9127C>T (p.Arg3043Trp) rs375907609
NM_022124.6(CDH23):c.9137A>G (p.Asn3046Ser)
NM_022124.6(CDH23):c.9198+10G>A
NM_022124.6(CDH23):c.9198+7G>A rs761980521
NM_022124.6(CDH23):c.9238G>A (p.Ala3080Thr) rs369395479
NM_022124.6(CDH23):c.9284dup (p.Arg3096fs) rs1564808024
NM_022124.6(CDH23):c.9291G>T (p.Lys3097Asn) rs368441850
NM_022124.6(CDH23):c.9319+11G>A rs11000013
NM_022124.6(CDH23):c.9326G>A (p.Arg3109His) rs200188029
NM_022124.6(CDH23):c.9337G>C (p.Asp3113His)
NM_022124.6(CDH23):c.9349A>G (p.Met3117Val)
NM_022124.6(CDH23):c.9373T>C (p.Phe3125Leu) rs45583140
NM_022124.6(CDH23):c.945+1G>A rs727502919
NM_022124.6(CDH23):c.9458C>T (p.Pro3153Leu)
NM_022124.6(CDH23):c.9501G>A (p.Thr3167=) rs144906721
NM_022124.6(CDH23):c.9503G>A (p.Arg3168His) rs754557923
NM_022124.6(CDH23):c.9510+13C>T rs183692794
NM_022124.6(CDH23):c.9510+14G>A
NM_022124.6(CDH23):c.9510+14G>T
NM_022124.6(CDH23):c.9510+19_9510+25del rs149704197
NM_022124.6(CDH23):c.9511-7T>C rs531195164
NM_022124.6(CDH23):c.9524G>A (p.Arg3175His) rs140884994
NM_022124.6(CDH23):c.9538G>A (p.Val3180Ile)
NM_022124.6(CDH23):c.9565C>T (p.Arg3189Trp) rs121908353
NM_022124.6(CDH23):c.9569C>T (p.Ala3190Val) rs111033536
NM_022124.6(CDH23):c.9606C>A (p.Gly3202=) rs193244823
NM_022124.6(CDH23):c.960C>T (p.Asn320=) rs756644736
NM_022124.6(CDH23):c.9616C>T (p.Arg3206Cys) rs778711089
NM_022124.6(CDH23):c.9629T>C (p.Ile3210Thr) rs144688588
NM_022124.6(CDH23):c.9633+14G>A
NM_022124.6(CDH23):c.9670C>T (p.Arg3224Trp) rs111033457
NM_022124.6(CDH23):c.968G>A (p.Arg323His)
NM_022124.6(CDH23):c.9694C>T (p.Arg3232Trp)
NM_022124.6(CDH23):c.9726del (p.Ser3243fs)
NM_022124.6(CDH23):c.9739-12G>A rs200638595
NM_022124.6(CDH23):c.9758A>C (p.Asp3253Ala) rs140463385
NM_022124.6(CDH23):c.9771A>C (p.Gly3257=)
NM_022124.6(CDH23):c.9799C>T (p.Arg3267Cys) rs201727938
NM_022124.6(CDH23):c.9805C>G (p.Arg3269Gly)
NM_022124.6(CDH23):c.9806G>A (p.Arg3269His)
NM_022124.6(CDH23):c.982G>A (p.Ala328Thr) rs374545987
NM_022124.6(CDH23):c.9832G>A (p.Gly3278Arg)
NM_022124.6(CDH23):c.9858C>T (p.His3286=) rs761835004
NM_022124.6(CDH23):c.9860G>A (p.Gly3287Asp) rs562590210
NM_022124.6(CDH23):c.9870C>A (p.Gly3290=)
NM_022124.6(CDH23):c.9873G>A (p.Thr3291=) rs2290021
NM_022124.6(CDH23):c.9885C>T (p.Thr3295=)
NM_022124.6(CDH23):c.9886G>A (p.Asp3296Asn) rs372388344
NM_022124.6(CDH23):c.9903C>T (p.Pro3301=) rs55717455
NM_022124.6(CDH23):c.9928C>T (p.Arg3310Cys) rs200124827
NM_022124.6(CDH23):c.9933G>A (p.Ser3311=)
NM_022124.6(CDH23):c.9942G>A (p.Thr3314=) rs376804660
NM_022124.6(CDH23):c.9955G>A (p.Glu3319Lys)
NM_022124.6(CDH23):c.9978C>T (p.Asn3326=) rs73277900
NM_022124.6(CDH23):c.9979G>A (p.Ala3327Thr) rs200733236
NM_022124.6(CDH23):c.9983G>A (p.Arg3328His) rs148475933
NM_031475.3(ESPN):c.2369_2386del (p.Arg790_Arg795del) rs1557720377
NM_032119.4(ADGRV1):c.14119G>T (p.Asp4707Tyr) rs1057519383
NM_032119.4(ADGRV1):c.16377G>T (p.Gln5459His) rs371947306
NM_033056.3(PCDH15):c.4368-13_4368-10dup rs530804327
NM_033056.4(PCDH15):c.*109A>G
NM_033056.4(PCDH15):c.*135T>C rs886047058
NM_033056.4(PCDH15):c.*366G>A rs187860910
NM_033056.4(PCDH15):c.*389G>A rs886047055
NM_033056.4(PCDH15):c.*414G>C rs16937780
NM_033056.4(PCDH15):c.*421C>T rs74134797
NM_033056.4(PCDH15):c.*459A>G
NM_033056.4(PCDH15):c.*486G>A rs549184328
NM_033056.4(PCDH15):c.*510T>C
NM_033056.4(PCDH15):c.*512G>C rs571779869
NM_033056.4(PCDH15):c.*558T>A rs886047054
NM_033056.4(PCDH15):c.*600C>A
NM_033056.4(PCDH15):c.*64A>T rs188426462
NM_033056.4(PCDH15):c.*73C>T
NM_033056.4(PCDH15):c.*93T>C
NM_033056.4(PCDH15):c.-126G>A rs551107079
NM_033056.4(PCDH15):c.-155G>C rs886047069
NM_033056.4(PCDH15):c.-180C>T rs375866561
NM_033056.4(PCDH15):c.-288T>C rs566733932
NM_033056.4(PCDH15):c.-5A>G rs142016527
NM_033056.4(PCDH15):c.-5_-3AGA[1] (p.Met1del) rs1555135527
NM_033056.4(PCDH15):c.1006C>T (p.Arg336Ter) rs370261904
NM_033056.4(PCDH15):c.1039C>T (p.Leu347Phe) rs111033436
NM_033056.4(PCDH15):c.1088del (p.Leu363fs) rs199469706
NM_033056.4(PCDH15):c.1098+14A>G rs764625426
NM_033056.4(PCDH15):c.1138G>A (p.Gly380Ser) rs10825269
NM_033056.4(PCDH15):c.1169A>G (p.Asn390Ser) rs397517450
NM_033056.4(PCDH15):c.1172A>G (p.Gln391Arg) rs758680936
NM_033056.4(PCDH15):c.1179A>G (p.Pro393=)
NM_033056.4(PCDH15):c.1185T>C (p.Phe395=) rs1427922641
NM_033056.4(PCDH15):c.1205G>C (p.Gly402Ala) rs145017164
NM_033056.4(PCDH15):c.1256A>G (p.Asn419Ser) rs143827620
NM_033056.4(PCDH15):c.1263T>C (p.Thr421=) rs7921598
NM_033056.4(PCDH15):c.1304A>C (p.Asp435Ala) rs4935502
NM_033056.4(PCDH15):c.1305+1G>A rs758947077
NM_033056.4(PCDH15):c.1305+1G>C rs758947077
NM_033056.4(PCDH15):c.1305+1del rs1554833699
NM_033056.4(PCDH15):c.131T>C (p.Val44Ala) rs750302536
NM_033056.4(PCDH15):c.1339G>A (p.Asp447Asn) rs150509146
NM_033056.4(PCDH15):c.1360G>A (p.Val454Ile) rs61735473
NM_033056.4(PCDH15):c.1362C>T (p.Val454=) rs61735479
NM_033056.4(PCDH15):c.1373G>A (p.Gly458Asp)
NM_033056.4(PCDH15):c.1377T>C (p.Ile459=) rs763593526
NM_033056.4(PCDH15):c.139del (p.Asp47fs) rs1555032952
NM_033056.4(PCDH15):c.1440+11T>G
NM_033056.4(PCDH15):c.1440+7A>C rs540070936
NM_033056.4(PCDH15):c.1456G>A (p.Gly486Ser) rs1196401374
NM_033056.4(PCDH15):c.145G>T (p.Glu49Ter) rs1168400018
NM_033056.4(PCDH15):c.146A>G (p.Glu49Gly)
NM_033056.4(PCDH15):c.1494A>G (p.Gln498=) rs145141405
NM_033056.4(PCDH15):c.157+1G>C rs1057516770
NM_033056.4(PCDH15):c.157+3A>G rs41274636
NM_033056.4(PCDH15):c.157+59097T>C rs75443986
NM_033056.4(PCDH15):c.158-16930T>C rs207470941
NM_033056.4(PCDH15):c.158-1G>A rs876657418
NM_033056.4(PCDH15):c.158-2A>T rs1304228309
NM_033056.4(PCDH15):c.1590+15A>G rs565203752
NM_033056.4(PCDH15):c.1591C>T (p.Leu531Phe) rs750009006
NM_033056.4(PCDH15):c.1627del (p.Glu543fs) rs1057516892
NM_033056.4(PCDH15):c.1631T>G (p.Ile544Ser) rs886047066
NM_033056.4(PCDH15):c.1643T>G (p.Ile548Ser)
NM_033056.4(PCDH15):c.1649T>G (p.Val550Gly) rs61735482
NM_033056.4(PCDH15):c.16del (p.Tyr6fs) rs397517451
NM_033056.4(PCDH15):c.1702G>A (p.Ala568Thr) rs61730754
NM_033056.4(PCDH15):c.1737C>G (p.Tyr579Ter) rs1057517251
NM_033056.4(PCDH15):c.1757C>T (p.Ala586Val)
NM_033056.4(PCDH15):c.1770_1771del (p.Pro591fs) rs1057517150
NM_033056.4(PCDH15):c.1780C>A (p.Arg594=)
NM_033056.4(PCDH15):c.1785-2A>C rs1057516474
NM_033056.4(PCDH15):c.1806T>G (p.Tyr602Ter) rs1057517443
NM_033056.4(PCDH15):c.1808T>C (p.Ile603Thr)
NM_033056.4(PCDH15):c.1812A>C (p.Glu604Asp)
NM_033056.4(PCDH15):c.1830_1833del (p.Asn610fs) rs1057517261
NM_033056.4(PCDH15):c.1863T>G (p.Tyr621Ter) rs1590691343
NM_033056.4(PCDH15):c.1900G>A (p.Val634Ile) rs146199636
NM_033056.4(PCDH15):c.1910A>G (p.Asn637Ser) rs61731389
NM_033056.4(PCDH15):c.1915C>T (p.Gln639Ter) rs138983888
NM_033056.4(PCDH15):c.1917+2T>C rs1554806149
NM_033056.4(PCDH15):c.1924G>A (p.Asp642Asn) rs1455035148
NM_033056.4(PCDH15):c.1927C>T (p.Arg643Ter) rs727504301
NM_033056.4(PCDH15):c.1934G>T (p.Gly645Val) rs763226433
NM_033056.4(PCDH15):c.1940C>G (p.Ser647Ter) rs137853004
NM_033056.4(PCDH15):c.1979T>A (p.Val660Asp)
NM_033056.4(PCDH15):c.1997+1G>T rs763797356
NM_033056.4(PCDH15):c.1997C>T (p.Thr666Ile)
NM_033056.4(PCDH15):c.1998-2A>G rs397517452
NM_033056.4(PCDH15):c.1A>G (p.Met1Val) rs1040514625
NM_033056.4(PCDH15):c.2000C>T (p.Thr667Met)
NM_033056.4(PCDH15):c.2001G>A (p.Thr667=)
NM_033056.4(PCDH15):c.2047C>T (p.Arg683Cys) rs573043647
NM_033056.4(PCDH15):c.2051A>G (p.Tyr684Cys) rs372076259
NM_033056.4(PCDH15):c.2052C>A (p.Tyr684Ter) rs1554956088
NM_033056.4(PCDH15):c.2082G>A (p.Arg694=) rs756484846
NM_033056.4(PCDH15):c.2091+2T>C rs1554956023
NM_033056.4(PCDH15):c.2102C>T (p.Ala701Val) rs199537178
NM_033056.4(PCDH15):c.2138A>G (p.Asn713Ser) rs190878515
NM_033056.4(PCDH15):c.2148_2155del (p.Phe717fs)
NM_033056.4(PCDH15):c.2194G>A (p.Ala732Thr) rs148162562
NM_033056.4(PCDH15):c.2202C>T (p.Ala734=) rs201636125
NM_033056.4(PCDH15):c.2220+9A>G rs886047065
NM_033056.4(PCDH15):c.2290C>T (p.Arg764Cys) rs192813057
NM_033056.4(PCDH15):c.2325G>A (p.Val775=) rs200792575
NM_033056.4(PCDH15):c.2419dup (p.Ile807fs) rs781148814
NM_033056.4(PCDH15):c.2424G>C (p.Lys808Asn) rs375855445
NM_033056.4(PCDH15):c.2435T>C (p.Ile812Thr) rs61731363
NM_033056.4(PCDH15):c.2439T>A (p.Asp813Glu) rs397517453
NM_033056.4(PCDH15):c.243G>A (p.Val81=) rs151119732
NM_033056.4(PCDH15):c.2445C>T (p.Asn815=) rs768200772
NM_033056.4(PCDH15):c.2487dup (p.Glu830fs) rs757027638
NM_033056.4(PCDH15):c.2539G>A (p.Asp847Asn) rs751941551
NM_033056.4(PCDH15):c.2550A>C (p.Ala850=) rs140893140
NM_033056.4(PCDH15):c.2563C>T (p.Arg855Trp) rs138010738
NM_033056.4(PCDH15):c.2581G>A (p.Val861Met) rs142512524
NM_033056.4(PCDH15):c.2619A>G (p.Glu873=) rs150784450
NM_033056.4(PCDH15):c.2624C>A (p.Ser875Ter) rs201328768
NM_033056.4(PCDH15):c.2625G>A (p.Ser875=) rs111033516
NM_033056.4(PCDH15):c.2645_2646del (p.Asp881_Tyr882insTer) rs1589950125
NM_033056.4(PCDH15):c.2685G>C (p.Leu895=)
NM_033056.4(PCDH15):c.2709A>G (p.Gly903=) rs886047064
NM_033056.4(PCDH15):c.2717C>T (p.Pro906Leu) rs374205826
NM_033056.4(PCDH15):c.2723G>A (p.Gly908Asp)
NM_033056.4(PCDH15):c.2728G>T (p.Ala910Ser) rs139175351
NM_033056.4(PCDH15):c.2731A>G (p.Thr911Ala)
NM_033056.4(PCDH15):c.274C>T (p.Gln92Ter) rs143842048
NM_033056.4(PCDH15):c.2751+2T>C rs754543131
NM_033056.4(PCDH15):c.2768C>T (p.Pro923Leu) rs191577774
NM_033056.4(PCDH15):c.2785C>T (p.Arg929Ter) rs1057516342
NM_033056.4(PCDH15):c.2786G>A (p.Arg929Gln) rs2135720
NM_033056.4(PCDH15):c.2807C>T (p.Ala936Val) rs369029215
NM_033056.4(PCDH15):c.2823G>T (p.Lys941Asn) rs773599066
NM_033056.4(PCDH15):c.2825del (p.Gly942fs) rs758685587
NM_033056.4(PCDH15):c.2869-1G>T rs1554883705
NM_033056.4(PCDH15):c.2884C>T (p.Arg962Cys) rs201816080
NM_033056.4(PCDH15):c.2885G>A (p.Arg962His) rs45483395
NM_033056.4(PCDH15):c.2885G>T (p.Arg962Leu) rs45483395
NM_033056.4(PCDH15):c.2971C>T (p.Arg991Ter) rs754391973
NM_033056.4(PCDH15):c.298G>A (p.Gly100Arg)
NM_033056.4(PCDH15):c.2992C>G (p.Pro998Ala) rs397517454
NM_033056.4(PCDH15):c.299del (p.Gly100fs) rs1554940316
NM_033056.4(PCDH15):c.29del (p.Cys10fs) rs1555135419
NM_033056.4(PCDH15):c.3009+7G>A rs201161336
NM_033056.4(PCDH15):c.3018G>T (p.Val1006=) rs41307518
NM_033056.4(PCDH15):c.3023del (p.Ala1008fs) rs1057517284
NM_033056.4(PCDH15):c.3082del (p.His1028fs) rs1057517325
NM_033056.4(PCDH15):c.3122+2T>A rs1554882546
NM_033056.4(PCDH15):c.3123-1G>A rs1554873550
NM_033056.4(PCDH15):c.3195A>G (p.Gln1065=) rs776720353
NM_033056.4(PCDH15):c.3211del (p.Ile1071fs) rs1057516974
NM_033056.4(PCDH15):c.321A>C (p.Pro107=) rs1345969752
NM_033056.4(PCDH15):c.3233-2A>G rs1554872194
NM_033056.4(PCDH15):c.323del (p.Pro108fs) rs1554934073
NM_033056.4(PCDH15):c.3313C>A (p.Leu1105Ile)
NM_033056.4(PCDH15):c.3316C>T (p.Arg1106Ter) rs202033121
NM_033056.4(PCDH15):c.3328G>A (p.Asp1110Asn)
NM_033056.4(PCDH15):c.333dup (p.His112fs) rs1057516992
NM_033056.4(PCDH15):c.3341del (p.Val1114fs) rs1057516656
NM_033056.4(PCDH15):c.3374-1G>T rs1554852472
NM_033056.4(PCDH15):c.3374-4C>T rs111739360
NM_033056.4(PCDH15):c.3441dup (p.Phe1148fs) rs770832663
NM_033056.4(PCDH15):c.3450C>A (p.Ile1150=) rs146374856
NM_033056.4(PCDH15):c.3450C>T (p.Ile1150=) rs146374856
NM_033056.4(PCDH15):c.3451G>A (p.Gly1151Arg) rs149478475
NM_033056.4(PCDH15):c.3456T>C (p.Gly1152=) rs202091131
NM_033056.4(PCDH15):c.3501+13A>G rs727503365
NM_033056.4(PCDH15):c.3501+1G>T rs1402893508
NM_033056.4(PCDH15):c.3501+7G>T rs756402556
NM_033056.4(PCDH15):c.3502-2A>G rs1554836566
NM_033056.4(PCDH15):c.3502-6G>A rs749897896
NM_033056.4(PCDH15):c.3502-7C>T rs757876538
NM_033056.4(PCDH15):c.3502-8C>T rs184144118
NM_033056.4(PCDH15):c.3522C>A (p.Gly1174=) rs753725514
NM_033056.4(PCDH15):c.3532G>A (p.Val1178Ile) rs147835286
NM_033056.4(PCDH15):c.3555A>G (p.Ile1185Met)
NM_033056.4(PCDH15):c.358_359del (p.Cys120fs) rs1057517264
NM_033056.4(PCDH15):c.3653del (p.Phe1218fs) rs1057516268
NM_033056.4(PCDH15):c.3700G>A (p.Gly1234Ser)
NM_033056.4(PCDH15):c.3711T>C (p.Asp1237=) rs61731382
NM_033056.4(PCDH15):c.3717+1G>A rs748706627
NM_033056.4(PCDH15):c.3717+2dup rs1248401224
NM_033056.4(PCDH15):c.3724G>A (p.Val1242Met) rs201137087
NM_033056.4(PCDH15):c.3731_3734del (p.Asn1244fs) rs1554833314
NM_033056.4(PCDH15):c.3753T>C (p.Ile1251=) rs139873638
NM_033056.4(PCDH15):c.3782A>C (p.Glu1261Ala) rs201106387
NM_033056.4(PCDH15):c.3791_3794del (p.Ile1264fs) rs1554833249
NM_033056.4(PCDH15):c.3792_3798dup (p.Leu1267fs) rs1554833242
NM_033056.4(PCDH15):c.3795A>T (p.Glu1265Asp) rs111033496
NM_033056.4(PCDH15):c.3806+1G>C rs1554833227
NM_033056.4(PCDH15):c.3806+2T>C rs756692340
NM_033056.4(PCDH15):c.3807-2A>G rs1328440878
NM_033056.4(PCDH15):c.3807-6T>G rs727504791
NM_033056.4(PCDH15):c.3817C>A (p.Arg1273Ser) rs111033363
NM_033056.4(PCDH15):c.3857T>A (p.Val1286Glu) rs375292203
NM_033056.4(PCDH15):c.3862T>C (p.Ser1288Pro) rs1554827269
NM_033056.4(PCDH15):c.3885_3889dup (p.Ala1297fs) rs1057516780
NM_033056.4(PCDH15):c.394dup (p.Glu132fs) rs397515566
NM_033056.4(PCDH15):c.3951C>T (p.Thr1317=) rs144955298
NM_033056.4(PCDH15):c.3983+12T>C rs149867749
NM_033056.4(PCDH15):c.3983+1G>T rs758921360
NM_033056.4(PCDH15):c.3983+2dup rs1554827124
NM_033056.4(PCDH15):c.3984-1G>C rs1057520709
NM_033056.4(PCDH15):c.3984-2A>G rs1554824185
NM_033056.4(PCDH15):c.4006_4008dup (p.Asp1336dup) rs1554824158
NM_033056.4(PCDH15):c.400C>A (p.Arg134=)
NM_033056.4(PCDH15):c.400C>T (p.Arg134Ter) rs137853003
NM_033056.4(PCDH15):c.4024C>A (p.Gln1342Lys) rs61731387
NM_033056.4(PCDH15):c.4048C>T (p.Arg1350Cys)
NM_033056.4(PCDH15):c.4049G>A (p.Arg1350His) rs752356781
NM_033056.4(PCDH15):c.4080G>A (p.Val1360=) rs111033499
NM_033056.4(PCDH15):c.4103A>G (p.Glu1368Gly) rs111033449
NM_033056.4(PCDH15):c.4114_4119del (p.Tyr1372_Thr1373del) rs1394411772
NM_033056.4(PCDH15):c.4118C>T (p.Thr1373Ile) rs756490783
NM_033056.4(PCDH15):c.4127C>A (p.Ala1376Asp) rs752371584
NM_033056.4(PCDH15):c.4147del (p.Ile1383fs) rs1554824058
NM_033056.4(PCDH15):c.416_444del (p.Asp139fs) rs1057517182
NM_033056.4(PCDH15):c.4197_4198insGTAG (p.Arg1400fs) rs1057516821
NM_033056.4(PCDH15):c.4202+5G>A rs886047063
NM_033056.4(PCDH15):c.4211+1G>A rs1554823229
NM_033056.4(PCDH15):c.4211+1del rs1554823231
NM_033056.4(PCDH15):c.4211+2T>G rs753832779
NM_033056.4(PCDH15):c.4211+2dup rs1057517419
NM_033056.4(PCDH15):c.4214G>A (p.Arg1405His) rs143538460
NM_033056.4(PCDH15):c.4227T>A (p.Cys1409Ter) rs1057516472
NM_033056.4(PCDH15):c.4231_4234dup (p.Thr1412fs) rs1554822897
NM_033056.4(PCDH15):c.4237_4238del (p.Ala1413fs) rs1554822891
NM_033056.4(PCDH15):c.4247_4258del (p.Gln1416_Leu1419del) rs1296979751
NM_033056.4(PCDH15):c.4260C>T (p.Pro1420=) rs775658931
NM_033056.4(PCDH15):c.4272A>G (p.Pro1424=) rs759109238
NM_033056.4(PCDH15):c.4275A>C (p.Ala1425=)
NM_033056.4(PCDH15):c.4305_4310dup (p.Pro1442_Pro1443dup) rs1327987212
NM_033056.4(PCDH15):c.4313del (p.Pro1438fs) rs1057516351
NM_033056.4(PCDH15):c.4316C>T (p.Pro1439Leu) rs374714898
NM_033056.4(PCDH15):c.4317_4328dup (p.Pro1440_Pro1443dup) rs1554822754
NM_033056.4(PCDH15):c.4334C>G (p.Ala1445Gly) rs146745502
NM_033056.4(PCDH15):c.4367+1G>A rs1057516613
NM_033056.4(PCDH15):c.4367+2T>C rs1554822703
NM_033056.4(PCDH15):c.4368-14TCTTT[3] rs1452730552
NM_033056.4(PCDH15):c.4368-15_4368-2del rs1057516560
NM_033056.4(PCDH15):c.4368-1_4369dup rs1554821139
NM_033056.4(PCDH15):c.4368-2A>T rs989521806
NM_033056.4(PCDH15):c.4368-3_4379dup rs1554821131
NM_033056.4(PCDH15):c.4368-76C>T rs375657329
NM_033056.4(PCDH15):c.4368-77G>A rs776152870
NM_033056.4(PCDH15):c.4368-77del rs1554821197
NM_033056.4(PCDH15):c.4368-79_4368-76del rs1554821194
NM_033056.4(PCDH15):c.4383C>A (p.Tyr1461Ter) rs1033803342
NM_033056.4(PCDH15):c.4385A>G (p.His1462Arg)
NM_033056.4(PCDH15):c.4399_4410dup (p.Arg1467_Asn1470dup) rs1554821093
NM_033056.4(PCDH15):c.4409_4413dup (p.Val1472fs) rs749884609
NM_033056.4(PCDH15):c.4410_4420del (p.Asn1470fs) rs767621707
NM_033056.4(PCDH15):c.4542A>G (p.Thr1514=) rs369183721
NM_033056.4(PCDH15):c.4546_4553dup (p.Glu1519fs) rs1554820916
NM_033056.4(PCDH15):c.4548_4551del (p.Ser1517fs) rs1233449433
NM_033056.4(PCDH15):c.4553A>T (p.Asp1518Val)
NM_033056.4(PCDH15):c.4556_4557dup (p.Asp1520fs) rs1554820902
NM_033056.4(PCDH15):c.4561_4565dup (p.Ser1523fs) rs1554820894
NM_033056.4(PCDH15):c.4563_4566dup (p.Ser1523fs) rs1554820891
NM_033056.4(PCDH15):c.4575T>C (p.His1525=) rs746377416
NM_033056.4(PCDH15):c.4581C>A (p.Pro1527=) rs10825114
NM_033056.4(PCDH15):c.4603_4607del (p.Gln1535fs) rs771473483
NM_033056.4(PCDH15):c.4618del (p.Ser1540fs) rs1554820847
NM_033056.4(PCDH15):c.4621_4624dup (p.Ile1542fs) rs1363726588
NM_033056.4(PCDH15):c.4639_4656dup (p.Asp1547_Phe1552dup) rs1554820809
NM_033056.4(PCDH15):c.466G>A (p.Val156Met) rs534173969
NM_033056.4(PCDH15):c.466G>C (p.Val156Leu) rs534173969
NM_033056.4(PCDH15):c.4681_4684dup (p.Ser1562Ter) rs730880357
NM_033056.4(PCDH15):c.4705_4708dup (p.Ile1570fs) rs1554820749
NM_033056.4(PCDH15):c.4724_4726dup (p.Gln1576_Ser1577insArg) rs762814533
NM_033056.4(PCDH15):c.4726C>T (p.Gln1576Ter) rs758204385
NM_033056.4(PCDH15):c.4749G>A (p.Arg1583=) rs767811568
NM_033056.4(PCDH15):c.475-3C>T rs41304641
NM_033056.4(PCDH15):c.4754dup (p.Met1585fs) rs1554820712
NM_033056.4(PCDH15):c.4768_4771dup (p.Arg1591delinsLysTer) rs1554820690
NM_033056.4(PCDH15):c.4769_4771dup (p.Asn1590dup) rs1554820687
NM_033056.4(PCDH15):c.4770T>C (p.Asn1590=) rs372095792
NM_033056.4(PCDH15):c.4772G>A (p.Arg1591Lys) rs149384350
NM_033056.4(PCDH15):c.4783A>C (p.Ile1595Leu) rs397517461
NM_033056.4(PCDH15):c.4792C>T (p.Gln1598Ter) rs1554820663
NM_033056.4(PCDH15):c.4794G>A (p.Gln1598=) rs372440971
NM_033056.4(PCDH15):c.4812G>T (p.Arg1604Ser) rs148718874
NM_033056.4(PCDH15):c.4812del (p.Arg1604fs) rs1554820651
NM_033056.4(PCDH15):c.4813C>T (p.Gln1605Ter) rs1554820648
NM_033056.4(PCDH15):c.4831_4834dup (p.Thr1612fs) rs545191822
NM_033056.4(PCDH15):c.4832del (p.Asn1611fs) rs1554820630
NM_033056.4(PCDH15):c.4834dup (p.Thr1612fs) rs1554820628
NM_033056.4(PCDH15):c.4850A>G (p.Asn1617Ser) rs111033362
NM_033056.4(PCDH15):c.4853_4864dup (p.Lys1618_Ser1621dup) rs1554820580
NM_033056.4(PCDH15):c.4875_4894del (p.Leu1626fs) rs772393186
NM_033056.4(PCDH15):c.4875_4896del (p.Leu1625fs) rs1240582095
NM_033056.4(PCDH15):c.4892C>A (p.Ala1631Glu) rs56332160
NM_033056.4(PCDH15):c.4895_4897dup (p.Leu1633_Thr1634insTyr) rs1554820541
NM_033056.4(PCDH15):c.4905_4907dup (p.Lys1636dup) rs750133663
NM_033056.4(PCDH15):c.4907_4908del (p.Lys1636fs) rs1491209806
NM_033056.4(PCDH15):c.4915_4918dup (p.Arg1640fs) rs780945310
NM_033056.4(PCDH15):c.4919G>A (p.Arg1640Lys)
NM_033056.4(PCDH15):c.4921C>T (p.Gln1641Ter) rs1484672299
NM_033056.4(PCDH15):c.4925del (p.Gly1642fs) rs1554820498
NM_033056.4(PCDH15):c.4928_4945dup (p.Glu1643_Glu1648dup)
NM_033056.4(PCDH15):c.4936A>G (p.Met1646Val) rs141103437
NM_033056.4(PCDH15):c.4955_4963dup (p.Ser1655Ter) rs1554820445
NM_033056.4(PCDH15):c.4968_4970dup (p.Ser1658dup) rs1554820428
NM_033056.4(PCDH15):c.4973C>A (p.Ser1658Ter) rs902963615
NM_033056.4(PCDH15):c.4974A>C (p.Ser1658=) rs147993163
NM_033056.4(PCDH15):c.4983_4986dup (p.Cys1663fs) rs1554820394
NM_033056.4(PCDH15):c.4987dup (p.Cys1663fs) rs775238614
NM_033056.4(PCDH15):c.4993C>A (p.Pro1665Thr) rs886047062
NM_033056.4(PCDH15):c.5003_5007dup (p.Ser1670fs) rs1554820378
NM_033056.4(PCDH15):c.5014_5022dup (p.Ser1672_Leu1674dup) rs1554820353
NM_033056.4(PCDH15):c.5029_5032dup (p.Ser1678fs) rs773160902
NM_033056.4(PCDH15):c.5033C>T (p.Ser1678Leu) rs143438666
NM_033056.4(PCDH15):c.5044G>A (p.Glu1682Lys)
NM_033056.4(PCDH15):c.5047_5050dup (p.Lys1684fs) rs1554820332
NM_033056.4(PCDH15):c.5048T>G (p.Leu1683Arg) rs727504812
NM_033056.4(PCDH15):c.5061_5067dup (p.Ile1690Ter) rs1554820318
NM_033056.4(PCDH15):c.5109_5129del (p.Arg1704_Ser1710del) rs1554820270
NM_033056.4(PCDH15):c.5152C>T (p.Pro1718Ser)
NM_033056.4(PCDH15):c.5161_5162del (p.Met1721fs) rs1554820230
NM_033056.4(PCDH15):c.5177C>T (p.Thr1726Ile) rs772619593
NM_033056.4(PCDH15):c.5193dup (p.Glu1732Ter) rs1554820212
NM_033056.4(PCDH15):c.521A>G (p.Asn174Ser) rs145037203
NM_033056.4(PCDH15):c.5252_5259del (p.Pro1751fs) rs1554820145
NM_033056.4(PCDH15):c.5254_5280del (p.Pro1752_Pro1760del) rs767526540
NM_033056.4(PCDH15):c.5257_5262del (p.Ile1753_Ser1754del) rs1554820140
NM_033056.4(PCDH15):c.5257_5268dup (p.Ile1753_Pro1756dup) rs756858099
NM_033056.4(PCDH15):c.5257_5277del (p.Ile1753_Pro1759del) rs752658191
NM_033056.4(PCDH15):c.5266_5319del (p.Pro1756_Pro1773del) rs1554820050
NM_033056.4(PCDH15):c.5269_5295del (p.Ser1757_Leu1765del) rs957797299
NM_033056.4(PCDH15):c.526G>A (p.Ala176Thr)
NM_033056.4(PCDH15):c.5274_5278del (p.Pro1759fs) rs1554820127
NM_033056.4(PCDH15):c.5278_5286del (p.Pro1760_Pro1762del) rs373916538
NM_033056.4(PCDH15):c.5283T>A (p.Ala1761=) rs375134176
NM_033056.4(PCDH15):c.5286T>A (p.Pro1762=) rs58461416
NM_033056.4(PCDH15):c.5294_5302dup (p.Leu1765_Pro1767dup) rs557936064
NM_033056.4(PCDH15):c.5296_5304del (p.Ala1766_Pro1768del) rs397517466
NM_033056.4(PCDH15):c.5308_5310del (p.Asp1770del) rs1554820073
NM_033056.4(PCDH15):c.5313T>G (p.Ile1771Met) rs886047061
NM_033056.4(PCDH15):c.5317_5319del (p.Pro1773del) rs1415161284
NM_033056.4(PCDH15):c.5318C>G (p.Pro1773Arg) rs745583797
NM_033056.4(PCDH15):c.5332dup (p.Cys1778fs) rs1338600699
NM_033056.4(PCDH15):c.5336del (p.Pro1779fs) rs1554820022
NM_033056.4(PCDH15):c.5343del (p.Ser1782fs) rs1554820009
NM_033056.4(PCDH15):c.5347_5363del (p.Pro1783fs) rs748086016
NM_033056.4(PCDH15):c.5349_5359del (p.Pro1784fs) rs1554819982
NM_033056.4(PCDH15):c.5353T>C (p.Ser1785Pro) rs144261647
NM_033056.4(PCDH15):c.5355_5365del (p.Ile1786fs) rs1554819970
NM_033056.4(PCDH15):c.5357dup (p.Leu1788fs) rs1376879405
NM_033056.4(PCDH15):c.5359C>T (p.Pro1787Ser) rs61862390
NM_033056.4(PCDH15):c.5361_5376del (p.Pro1789fs) rs1554819957
NM_033056.4(PCDH15):c.5364_5373del (p.Pro1789fs) rs753690225
NM_033056.4(PCDH15):c.5388dup (p.Pro1797fs) rs1554819925
NM_033056.4(PCDH15):c.5398G>A (p.Val1800Ile) rs111033463
NM_033056.4(PCDH15):c.5414C>T (p.Pro1805Leu) rs114137983
NM_033056.4(PCDH15):c.5430_5438del (p.Leu1811_Pro1813del) rs1554819833
NM_033056.4(PCDH15):c.5435C>T (p.Pro1812Leu) rs139668636
NM_033056.4(PCDH15):c.5439A>C (p.Pro1813=) rs150303579
NM_033056.4(PCDH15):c.5445_5456del (p.Thr1816_Pro1819del) rs764759018
NM_033056.4(PCDH15):c.5450C>T (p.Pro1817Leu) rs759208006
NM_033056.4(PCDH15):c.5463_5489del (p.Pro1823_Pro1831del) rs1554819787
NM_033056.4(PCDH15):c.546A>G (p.Gly182=) rs34164469
NM_033056.4(PCDH15):c.5472_5495del (p.Ile1825_Ser1832del) rs763534924
NM_033056.4(PCDH15):c.5480G>T (p.Cys1827Phe) rs776844300
NM_033056.4(PCDH15):c.5510C>T (p.Ser1837Phe)
NM_033056.4(PCDH15):c.5520dup (p.Val1841fs) rs1554819761
NM_033056.4(PCDH15):c.5547G>A (p.Thr1849=) rs767304005
NM_033056.4(PCDH15):c.5550C>A (p.Thr1850=) rs112097891
NM_033056.4(PCDH15):c.5557A>C (p.Met1853Leu) rs145903555
NM_033056.4(PCDH15):c.5565C>A (p.Ala1855=) rs111033445
NM_033056.4(PCDH15):c.5565C>T (p.Ala1855=) rs111033445
NM_033056.4(PCDH15):c.5566G>A (p.Glu1856Lys) rs371269732
NM_033056.4(PCDH15):c.5566G>T (p.Glu1856Ter) rs371269732
NM_033056.4(PCDH15):c.556C>T (p.Gln186Ter) rs1384677442
NM_033056.4(PCDH15):c.5573_5576dup (p.Lys1859delinsAsnTer)
NM_033056.4(PCDH15):c.55T>G (p.Ser19Ala) rs11004439
NM_033056.4(PCDH15):c.5600_5603delinsT (p.Thr1867_Thr1868delinsMet) rs1554819686
NM_033056.4(PCDH15):c.5603C>T (p.Thr1868Met) rs191736346
NM_033056.4(PCDH15):c.5614A>G (p.Lys1872Glu) rs147727092
NM_033056.4(PCDH15):c.5617dup (p.Thr1873fs) rs1554819653
NM_033056.4(PCDH15):c.5619_5623dup (p.Pro1875fs) rs1418472770
NM_033056.4(PCDH15):c.5626C>T (p.Gln1876Ter) rs750274894
NM_033056.4(PCDH15):c.5650A>G (p.Arg1884Gly)
NM_033056.4(PCDH15):c.5653C>T (p.His1885Tyr) rs886047060
NM_033056.4(PCDH15):c.5682dup (p.Ser1895fs) rs1287068204
NM_033056.4(PCDH15):c.5684C>G (p.Ser1895Ter) rs1554819599
NM_033056.4(PCDH15):c.5702_5705dup (p.Ile1903fs) rs1554819570
NM_033056.4(PCDH15):c.5707A>G (p.Ile1903Val) rs79854148
NM_033056.4(PCDH15):c.5710_5711del (p.Glu1904fs) rs1554819558
NM_033056.4(PCDH15):c.5713A>T (p.Lys1905Ter) rs780553426
NM_033056.4(PCDH15):c.5721_5724dup (p.Arg1909fs) rs568470164
NM_033056.4(PCDH15):c.5726G>A (p.Arg1909His) rs145851144
NM_033056.4(PCDH15):c.5726G>T (p.Arg1909Leu) rs145851144
NM_033056.4(PCDH15):c.5743_5766del (p.Leu1915_Glu1922del) rs1554819513
NM_033056.4(PCDH15):c.5753del (p.Met1918fs) rs1554819525
NM_033056.4(PCDH15):c.5755T>A (p.Cys1919Ser)
NM_033056.4(PCDH15):c.575A>G (p.Gln192Arg) rs201496062
NM_033056.4(PCDH15):c.5798_5816dup (p.Asn1939fs) rs755876430
NM_033056.4(PCDH15):c.5806_5807del (p.Ser1936fs) rs1554819488
NM_033056.4(PCDH15):c.5806del (p.Ser1936fs) rs1554819493
NM_033056.4(PCDH15):c.5818_5820dup (p.Ile1940dup) rs750168790
NM_033056.4(PCDH15):c.5824G>A (p.Glu1942Lys)
NM_033056.4(PCDH15):c.5838_5841del (p.Lys1946fs) rs1368908688
NM_033056.4(PCDH15):c.5849_5852dup (p.Thr1953fs) rs757543551
NM_033056.4(PCDH15):c.5863del (p.Leu1955fs) rs1554819436
NM_033056.4(PCDH15):c.5864T>C (p.Leu1955Pro) rs751586980
NM_033056.4(PCDH15):c.593C>T (p.Pro198Leu) rs145232643
NM_033056.4(PCDH15):c.594+1G>T rs1057516470
NM_033056.4(PCDH15):c.594G>A (p.Pro198=) rs368308772
NM_033056.4(PCDH15):c.647T>G (p.Leu216Ter) rs1554903979
NM_033056.4(PCDH15):c.665A>G (p.Tyr222Cys) rs755845400
NM_033056.4(PCDH15):c.679C>T (p.Arg227Cys) rs565693539
NM_033056.4(PCDH15):c.705+1G>A rs1554903842
NM_033056.4(PCDH15):c.705+2_705+3insTT rs1554903836
NM_033056.4(PCDH15):c.706-8C>T rs10740579
NM_033056.4(PCDH15):c.733C>T (p.Arg245Ter) rs111033260
NM_033056.4(PCDH15):c.7C>T (p.Arg3Ter) rs137853001
NM_033056.4(PCDH15):c.803G>A (p.Cys268Tyr) rs1283739647
NM_033056.4(PCDH15):c.833G>A (p.Arg278His)
NM_033056.4(PCDH15):c.84T>A (p.Tyr28Ter) rs903145299
NM_033056.4(PCDH15):c.851C>T (p.Ala284Val) rs777071595
NM_033056.4(PCDH15):c.875C>G (p.Pro292Arg) rs138744579
NM_033056.4(PCDH15):c.882A>G (p.Glu294=) rs181232514
NM_033056.4(PCDH15):c.8G>A (p.Arg3Gln)
NM_033056.4(PCDH15):c.901dup (p.Thr301fs) rs1057517048
NM_033056.4(PCDH15):c.92-515T>G rs1283842168
NM_033056.4(PCDH15):c.92-528C>T
NM_033056.4(PCDH15):c.942A>G (p.Gln314=) rs149481989
NM_033056.4(PCDH15):c.944C>T (p.Pro315Leu)
NM_033056.4(PCDH15):c.952G>C (p.Asp318His)
NM_033056.4(PCDH15):c.960A>G (p.Pro320=) rs41274634
NM_033056.4(PCDH15):c.986-11A>G
NM_153676.4(USH1C):c.*110C>G
NM_153676.4(USH1C):c.*117C>G
NM_153676.4(USH1C):c.*131G>C
NM_153676.4(USH1C):c.*140C>T rs886048058
NM_153676.4(USH1C):c.*186C>T rs1055577
NM_153676.4(USH1C):c.*211A>G rs1055581
NM_153676.4(USH1C):c.*241C>G
NM_153676.4(USH1C):c.*376A>C rs886048057
NM_153676.4(USH1C):c.*405C>G rs11827649
NM_153676.4(USH1C):c.*427T>C
NM_153676.4(USH1C):c.*42C>T rs16934270
NM_153676.4(USH1C):c.*46T>C rs1055574
NM_153676.4(USH1C):c.*95C>T rs552838747
NM_153676.4(USH1C):c.-109A>T
NM_153676.4(USH1C):c.-60T>C rs371444878
NM_153676.4(USH1C):c.-60T>G
NM_153676.4(USH1C):c.-71T>G rs571065113
NM_153676.4(USH1C):c.1013A>C (p.Glu338Ala) rs876658109
NM_153676.4(USH1C):c.1016G>A (p.Arg339Gln) rs765571023
NM_153676.4(USH1C):c.101A>G (p.His34Arg) rs75157409
NM_153676.4(USH1C):c.1020-2A>C rs147956944
NM_153676.4(USH1C):c.1039C>T (p.Gln347Ter) rs762551629
NM_153676.4(USH1C):c.104+1G>A rs1287021691
NM_153676.4(USH1C):c.105-4A>G rs201374986
NM_153676.4(USH1C):c.1053G>C (p.Glu351Asp)
NM_153676.4(USH1C):c.1064G>T (p.Arg355Ile)
NM_153676.4(USH1C):c.1069C>T (p.Arg357Trp) rs140934960
NM_153676.4(USH1C):c.1085+7A>G
NM_153676.4(USH1C):c.1086-12G>A rs11024318
NM_153676.4(USH1C):c.1086-13G>T rs200490320
NM_153676.4(USH1C):c.1101A>G (p.Glu367=) rs764975771
NM_153676.4(USH1C):c.1136G>A (p.Gly379Asp) rs202174251
NM_153676.4(USH1C):c.1139del (p.Gly379_Ser380insTer) rs1554960390
NM_153676.4(USH1C):c.1146dup (p.Gln383fs) rs1554960388
NM_153676.4(USH1C):c.114C>T (p.Asp38=) rs137962152
NM_153676.4(USH1C):c.1183C>T (p.His395Tyr)
NM_153676.4(USH1C):c.1188A>G (p.Pro396=) rs2240487
NM_153676.4(USH1C):c.1210+5G>A rs372285784
NM_153676.4(USH1C):c.1211-1106G>A
NM_153676.4(USH1C):c.1211-1129G>A rs35188020
NM_153676.4(USH1C):c.1211-1134G>A rs115931035
NM_153676.4(USH1C):c.1211-1140G>A
NM_153676.4(USH1C):c.1211-1152G>A rs116996553
NM_153676.4(USH1C):c.1211-1175G>A rs143923730
NM_153676.4(USH1C):c.1211-1175G>C
NM_153676.4(USH1C):c.1211-1175del rs1207247951
NM_153676.4(USH1C):c.1211-1177G>T
NM_153676.4(USH1C):c.1216G>T (p.Gly406Ter) rs1554959148
NM_153676.4(USH1C):c.1233C>T (p.Tyr411=) rs377439949
NM_153676.4(USH1C):c.1265del (p.Gly422fs) rs1554957912
NM_153676.4(USH1C):c.127G>A (p.Val43Met) rs145500807
NM_153676.4(USH1C):c.1290T>G (p.Tyr430Ter) rs1406224812
NM_153676.4(USH1C):c.1292G>T (p.Gly431Val) rs751388655
NM_153676.4(USH1C):c.1351AAAGAG[1] (p.451KE[1]) rs1554957867
NM_153676.4(USH1C):c.135C>T (p.Asp45=) rs140319839
NM_153676.4(USH1C):c.1363G>T (p.Glu455Ter) rs148115969
NM_153676.4(USH1C):c.1413+2T>C rs1344670523
NM_153676.4(USH1C):c.1414-2_1414-1insCTG rs769675063
NM_153676.4(USH1C):c.1415_1416insCTGAGACCCCCTGG (p.Ser473_Glu474insTer) rs781176348
NM_153676.4(USH1C):c.1531-11A>G rs397517872
NM_153676.4(USH1C):c.1543CCCCCGCCT[3] (p.Pro518_Pro520dup) rs777764626
NM_153676.4(USH1C):c.1548G>A (p.Pro516=) rs780428813
NM_153676.4(USH1C):c.1556C>T (p.Pro519Leu) rs778703128
NM_153676.4(USH1C):c.1559dup (p.Ser521fs) rs1554957167
NM_153676.4(USH1C):c.164G>A (p.Arg55His) rs1042393529
NM_153676.4(USH1C):c.1654_1660del (p.Tyr552fs) rs758580540
NM_153676.4(USH1C):c.1712_1716dup (p.Pro573fs) rs1554957020
NM_153676.4(USH1C):c.1739_1744del (p.Pro580_Val581del) rs1175090344
NM_153676.4(USH1C):c.1806del (p.Ile603fs) rs765346539
NM_153676.4(USH1C):c.1806dup (p.Ile603fs) rs765346539
NM_153676.4(USH1C):c.1807dup (p.Ile603fs) rs1554956941
NM_153676.4(USH1C):c.1822C>T (p.Pro608Ser) rs727505247
NM_153676.4(USH1C):c.1823C>G (p.Pro608Arg) rs41282932
NM_153676.4(USH1C):c.1824del (p.Pro609fs) rs1389725640
NM_153676.4(USH1C):c.1840C>T (p.Gln614Ter) rs1554956913
NM_153676.4(USH1C):c.1840del (p.Gln614fs) rs1554956916
NM_153676.4(USH1C):c.186T>C (p.Ile62=) rs200239508
NM_153676.4(USH1C):c.1871C>A (p.Ser624Ter) rs778700091
NM_153676.4(USH1C):c.1874C>T (p.Ala625Val) rs727505187
NM_153676.4(USH1C):c.187C>T (p.Arg63Trp) rs375741564
NM_153676.4(USH1C):c.188G>A (p.Arg63Gln) rs372497947
NM_153676.4(USH1C):c.192G>A (p.Pro64=) rs1040470628
NM_153676.4(USH1C):c.1956_1957del (p.His652fs) rs766725582
NM_153676.4(USH1C):c.1A>G (p.Met1Val) rs1554965967
NM_153676.4(USH1C):c.2006_2010del (p.Thr669fs) rs1554956821
NM_153676.4(USH1C):c.200C>T (p.Pro67Leu)
NM_153676.4(USH1C):c.2014-1G>A rs150567427
NM_153676.4(USH1C):c.2041C>T (p.Arg681Ter) rs369369849
NM_153676.4(USH1C):c.2089G>T (p.Glu697Ter) rs139116036
NM_153676.4(USH1C):c.2124T>C (p.Ser708=) rs369021714
NM_153676.4(USH1C):c.2167C>T (p.Gln723Ter) rs146451547
NM_153676.4(USH1C):c.216G>A (p.Val72=) rs151045328
NM_153676.4(USH1C):c.2185-2A>G rs1358056232
NM_153676.4(USH1C):c.2191C>T (p.Arg731Trp) rs397517874
NM_153676.4(USH1C):c.2192G>A (p.Arg731Gln) rs371626423
NM_153676.4(USH1C):c.2194A>G (p.Lys732Glu) rs148168494
NM_153676.4(USH1C):c.2226+12C>T rs17703528
NM_153676.4(USH1C):c.2227-1G>A rs778110397
NM_153676.4(USH1C):c.2227-1G>T rs778110397
NM_153676.4(USH1C):c.2240A>G (p.Gln747Arg) rs201600193
NM_153676.4(USH1C):c.2253G>A (p.Lys751=)
NM_153676.4(USH1C):c.225T>C (p.Asp75=) rs111033279
NM_153676.4(USH1C):c.2260C>T (p.Arg754Trp)
NM_153676.4(USH1C):c.2265C>G (p.Leu755=) rs151251262
NM_153676.4(USH1C):c.2270G>A (p.Arg757His)
NM_153676.4(USH1C):c.2280+15G>A rs886048059
NM_153676.4(USH1C):c.2280+2T>C rs1554954681
NM_153676.4(USH1C):c.2281-1G>A rs1554954574
NM_153676.4(USH1C):c.2281-2A>G rs921755529
NM_153676.4(USH1C):c.2281G>A (p.Glu761Lys)
NM_153676.4(USH1C):c.2321C>T (p.Ser774Phe)
NM_153676.4(USH1C):c.2326dup (p.Ile776fs) rs758555088
NM_153676.4(USH1C):c.2327T>A (p.Ile776Asn)
NM_153676.4(USH1C):c.2340C>T (p.Val780=) rs10832796
NM_153676.4(USH1C):c.2341G>A (p.Val781Ile) rs397517875
NM_153676.4(USH1C):c.2362G>A (p.Gly788Arg)
NM_153676.4(USH1C):c.2374C>A (p.Arg792=) rs200428926
NM_153676.4(USH1C):c.2374C>T (p.Arg792Trp)
NM_153676.4(USH1C):c.2378A>G (p.His793Arg) rs868121889
NM_153676.4(USH1C):c.2381-10C>T rs765925104
NM_153676.4(USH1C):c.2381-2A>G rs1465352266
NM_153676.4(USH1C):c.2410G>A (p.Ala804Thr) rs150593932
NM_153676.4(USH1C):c.2418C>A (p.Asn806Lys) rs397517876
NM_153676.4(USH1C):c.2418C>T (p.Asn806=) rs397517876
NM_153676.4(USH1C):c.2419G>A (p.Gly807Ser) rs142652588
NM_153676.4(USH1C):c.241C>T (p.Arg81Cys) rs876658111
NM_153676.4(USH1C):c.2431_2451del (p.Thr811_Glu817del) rs779253356
NM_153676.4(USH1C):c.2437T>G (p.Tyr813Asp)
NM_153676.4(USH1C):c.2441C>A (p.Thr814Asn) rs397517877
NM_153676.4(USH1C):c.2457G>C (p.Glu819Asp) rs1064074
NM_153676.4(USH1C):c.2458G>A (p.Ala820Thr) rs397517878
NM_153676.4(USH1C):c.245C>G (p.Ser82Cys) rs769021971
NM_153676.4(USH1C):c.248+1G>A rs1482487617
NM_153676.4(USH1C):c.2487C>T (p.Gly829=) rs142801489
NM_153676.4(USH1C):c.2490+12G>C rs2072232
NM_153676.4(USH1C):c.2490+1G>T rs1554953746
NM_153676.4(USH1C):c.2490+1del rs1366154374
NM_153676.4(USH1C):c.2490+2T>C rs1554953745
NM_153676.4(USH1C):c.2490+6A>C
NM_153676.4(USH1C):c.2499C>T (p.Ile833=) rs34581703
NM_153676.4(USH1C):c.2528dup (p.Glu844fs) rs1554953360
NM_153676.4(USH1C):c.2541T>C (p.Asp847=)
NM_153676.4(USH1C):c.2546+1G>T rs1554953350
NM_153676.4(USH1C):c.2547-1G>T rs571304936
NM_153676.4(USH1C):c.2590C>T (p.Arg864Ter) rs767767573
NM_153676.4(USH1C):c.2611G>A (p.Ala871Thr) rs56165709
NM_153676.4(USH1C):c.2617G>A (p.Val873Met) rs201533059
NM_153676.4(USH1C):c.2655+12G>A rs727504552
NM_153676.4(USH1C):c.2656-1G>A rs747133793
NM_153676.4(USH1C):c.2661TCT[1] (p.Leu889del) rs1474458620
NM_153676.4(USH1C):c.266G>A (p.Arg89His) rs749647539
NM_153676.4(USH1C):c.2681del (p.Gly894fs) rs1554952757
NM_153676.4(USH1C):c.2688_2695dup (p.Arg899fs) rs1554952752
NM_153676.4(USH1C):c.294C>T (p.Leu98=) rs34055234
NM_153676.4(USH1C):c.308G>A (p.Arg103His) rs397514500
NM_153676.4(USH1C):c.311G>A (p.Gly104Asp) rs1317951509
NM_153676.4(USH1C):c.324T>C (p.Phe108=) rs549758189
NM_153676.4(USH1C):c.341T>C (p.Ile114Thr)
NM_153676.4(USH1C):c.36+1G>T rs1403777293
NM_153676.4(USH1C):c.360C>T (p.Gly120=) rs140869579
NM_153676.4(USH1C):c.379G>A (p.Gly127Arg) rs768207716
NM_153676.4(USH1C):c.381G>T (p.Gly127=) rs41282942
NM_153676.4(USH1C):c.388-8T>A rs777486804
NM_153676.4(USH1C):c.388G>A (p.Val130Ile) rs55843567
NM_153676.4(USH1C):c.403G>A (p.Val135Ile) rs145013633
NM_153676.4(USH1C):c.405C>G (p.Val135=)
NM_153676.4(USH1C):c.406C>T (p.Arg136Trp) rs368903400
NM_153676.4(USH1C):c.412A>G (p.Asn138Asp)
NM_153676.4(USH1C):c.440A>G (p.His147Arg) rs777591673
NM_153676.4(USH1C):c.442G>A (p.Glu148Lys)
NM_153676.4(USH1C):c.463C>T (p.Arg155Ter) rs377145777
NM_153676.4(USH1C):c.464G>C (p.Arg155Pro) rs142730611
NM_153676.4(USH1C):c.496+1G>A rs138138689
NM_153676.4(USH1C):c.496+1G>T rs138138689
NM_153676.4(USH1C):c.496+21GCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGGGAGCAGG[9] rs55983148
NM_153676.4(USH1C):c.496C>T (p.His166Tyr) rs367996370
NM_153676.4(USH1C):c.497-2del rs1480243085
NM_153676.4(USH1C):c.497-4G>A rs397517881
NM_153676.4(USH1C):c.501C>T (p.Ile167=)
NM_153676.4(USH1C):c.513C>T (p.Pro171=) rs199739341
NM_153676.4(USH1C):c.514G>T (p.Val172Leu)
NM_153676.4(USH1C):c.540C>T (p.Leu180=) rs145510974
NM_153676.4(USH1C):c.567G>T (p.Val189=)
NM_153676.4(USH1C):c.569C>G (p.Ser190Trp)
NM_153676.4(USH1C):c.569C>T (p.Ser190Leu) rs200319849
NM_153676.4(USH1C):c.570G>A (p.Ser190=) rs756709989
NM_153676.4(USH1C):c.579+1G>C rs1283092935
NM_153676.4(USH1C):c.582C>T (p.Gly194=) rs397517882
NM_153676.4(USH1C):c.598G>A (p.Gly200Ser) rs770543827
NM_153676.4(USH1C):c.600C>T (p.Gly200=)
NM_153676.4(USH1C):c.629A>C (p.Lys210Thr) rs372789934
NM_153676.4(USH1C):c.634G>A (p.Val212Ile) rs886048060
NM_153676.4(USH1C):c.648G>A (p.Leu216=) rs77137413
NM_153676.4(USH1C):c.651A>G (p.Val217=) rs75977878
NM_153676.4(USH1C):c.669C>A (p.Gly223=) rs144761543
NM_153676.4(USH1C):c.66G>A (p.Glu22=) rs768165881
NM_153676.4(USH1C):c.672C>A (p.Cys224Ter) rs1223763703
NM_153676.4(USH1C):c.674+1G>A rs775496999
NM_153676.4(USH1C):c.674+1del rs1554961872
NM_153676.4(USH1C):c.674+2T>G rs1298596518
NM_153676.4(USH1C):c.674+4G>A rs202095395
NM_153676.4(USH1C):c.684C>T (p.Ser228=) rs149172005
NM_153676.4(USH1C):c.748_759+5del rs1355262412
NM_153676.4(USH1C):c.759+10G>T rs368528034
NM_153676.4(USH1C):c.760-1G>T rs1187887456
NM_153676.4(USH1C):c.76C>T (p.Leu26Phe) rs267602805
NM_153676.4(USH1C):c.776T>G (p.Val259Gly)
NM_153676.4(USH1C):c.789C>G (p.Gly263=) rs376197674
NM_153676.4(USH1C):c.790G>A (p.Val264Ile) rs79875849
NM_153676.4(USH1C):c.793G>A (p.Asp265Asn) rs199537187
NM_153676.4(USH1C):c.7C>T (p.Arg3Ter) rs876657624
NM_153676.4(USH1C):c.819+10G>C rs41282936
NM_153676.4(USH1C):c.819+1G>A rs1554961152
NM_153676.4(USH1C):c.841_848del (p.Ser281fs) rs1064797153
NM_153676.4(USH1C):c.845G>A (p.Arg282His) rs779111365
NM_153676.4(USH1C):c.851T>A (p.Leu284Gln) rs756485601
NM_153676.4(USH1C):c.864T>G (p.Ile288Met)
NM_153676.4(USH1C):c.875C>G (p.Ala292Gly)
NM_153676.4(USH1C):c.877-1G>A rs771279169
NM_153676.4(USH1C):c.880C>T (p.Arg294Trp) rs555152976
NM_153676.4(USH1C):c.881G>A (p.Arg294Gln) rs773481791
NM_153676.4(USH1C):c.883G>A (p.Glu295Lys) rs200127622
NM_153676.4(USH1C):c.915_920del (p.Glu306_Ala307del) rs1554960929
NM_153676.4(USH1C):c.91C>T (p.Arg31Ter) rs121908370
NM_153676.4(USH1C):c.921G>A (p.Ala307=) rs778447994
NM_153676.4(USH1C):c.923G>A (p.Arg308Gln)
NM_153676.4(USH1C):c.92G>A (p.Arg31Gln) rs776511246
NM_153676.4(USH1C):c.946G>C (p.Glu316Gln) rs35336155
NM_153676.4(USH1C):c.965G>A (p.Arg322Gln) rs140424216
NM_173477.5(USH1G):c.*1018G>A rs780234900
NM_173477.5(USH1G):c.*1052C>T
NM_173477.5(USH1G):c.*1053G>A rs113583471
NM_173477.5(USH1G):c.*1093= rs690566
NM_173477.5(USH1G):c.*1098T>A
NM_173477.5(USH1G):c.*1112C>T
NM_173477.5(USH1G):c.*1119G>A rs182142592
NM_173477.5(USH1G):c.*1130T>C
NM_173477.5(USH1G):c.*1154T>A
NM_173477.5(USH1G):c.*1174T>G
NM_173477.5(USH1G):c.*1191G>A
NM_173477.5(USH1G):c.*1224A>C rs111922548
NM_173477.5(USH1G):c.*1303C>T rs1013013
NM_173477.5(USH1G):c.*1376G>A
NM_173477.5(USH1G):c.*1447C>T
NM_173477.5(USH1G):c.*1656T>C rs8067775
NM_173477.5(USH1G):c.*1719G>T rs886053384
NM_173477.5(USH1G):c.*1732C>T rs886053383
NM_173477.5(USH1G):c.*1821C>G
NM_173477.5(USH1G):c.*1900G>C rs1568448
NM_173477.5(USH1G):c.*1922A>G
NM_173477.5(USH1G):c.*1987C>T rs886053381
NM_173477.5(USH1G):c.*198T>C
NM_173477.5(USH1G):c.*202G>A rs557845589
NM_173477.5(USH1G):c.*233C>G
NM_173477.5(USH1G):c.*256C>T
NM_173477.5(USH1G):c.*279G>T rs886053387
NM_173477.5(USH1G):c.*482C>T
NM_173477.5(USH1G):c.*498G>A rs569461974
NM_173477.5(USH1G):c.*49C>T rs199648830
NM_173477.5(USH1G):c.*553A>C rs111899313
NM_173477.5(USH1G):c.*567C>G
NM_173477.5(USH1G):c.*571T>A rs111611253
NM_173477.5(USH1G):c.*63C>T rs113765180
NM_173477.5(USH1G):c.*680C>G
NM_173477.5(USH1G):c.*704G>A
NM_173477.5(USH1G):c.*776G>A
NM_173477.5(USH1G):c.*809C>A rs886053386
NM_173477.5(USH1G):c.*831C>T
NM_173477.5(USH1G):c.*940C>G
NM_173477.5(USH1G):c.*95C>G rs886053388
NM_173477.5(USH1G):c.-173G>C rs570755897
NM_173477.5(USH1G):c.-2C>T rs758940726
NM_173477.5(USH1G):c.-76A>G
NM_173477.5(USH1G):c.-8C>T rs769903865
NM_173477.5(USH1G):c.1057G>A (p.Asp353Asn)
NM_173477.5(USH1G):c.1060G>T (p.Asp354Tyr) rs1316299165
NM_173477.5(USH1G):c.113G>A (p.Trp38Ter) rs104894652
NM_173477.5(USH1G):c.1142T>C (p.Leu381Ser)
NM_173477.5(USH1G):c.1152C>T (p.Asp384=) rs569032124
NM_173477.5(USH1G):c.1170C>T (p.Ser390=) rs199724052
NM_173477.5(USH1G):c.1258C>G (p.Leu420Val) rs139897506
NM_173477.5(USH1G):c.126T>C (p.His42=)
NM_173477.5(USH1G):c.1311del (p.Lys438fs) rs886043626
NM_173477.5(USH1G):c.143T>C (p.Leu48Pro) rs104894651
NM_173477.5(USH1G):c.186_187del (p.Ile63fs) rs730880268
NM_173477.5(USH1G):c.205dup (p.Leu69fs) rs1598584825
NM_173477.5(USH1G):c.208_209insTC (p.His70fs) rs1555627787
NM_173477.5(USH1G):c.327C>T (p.Gly109=)
NM_173477.5(USH1G):c.344G>A (p.Arg115His) rs775117744
NM_173477.5(USH1G):c.348C>T (p.Tyr116=) rs886053390
NM_173477.5(USH1G):c.388A>G (p.Lys130Glu) rs111033465
NM_173477.5(USH1G):c.394dup (p.Val132fs) rs587776546
NM_173477.5(USH1G):c.424G>A (p.Glu142Lys) rs111033466
NM_173477.5(USH1G):c.424G>C (p.Glu142Gln)
NM_173477.5(USH1G):c.436C>T (p.Arg146Cys) rs141791769
NM_173477.5(USH1G):c.46C>G (p.Leu16Val) rs876657419
NM_173477.5(USH1G):c.474C>G (p.His158Gln) rs765860407
NM_173477.5(USH1G):c.478C>G (p.Arg160Gly) rs376527217
NM_173477.5(USH1G):c.501C>G (p.Arg167=) rs141688757
NM_173477.5(USH1G):c.511G>T (p.Glu171Ter) rs201866631
NM_173477.5(USH1G):c.563G>T (p.Arg188Leu) rs201123735
NM_173477.5(USH1G):c.566G>A (p.Arg189Gln) rs201644674
NM_173477.5(USH1G):c.635G>C (p.Gly212Ala)
NM_173477.5(USH1G):c.644del (p.Lys215fs) rs1567940040
NM_173477.5(USH1G):c.753C>T (p.Ser251=) rs886053389
NM_173477.5(USH1G):c.832_851del (p.Ser278fs) rs397515345
NM_173477.5(USH1G):c.837C>G (p.Asp279Glu) rs142486910
NM_173477.5(USH1G):c.83C>T (p.Pro28Leu) rs145448362
NM_206933.2(USH2A):c.3902G>T (p.Gly1301Val) rs111033524
NM_206933.3(USH2A):c.9921T>G (p.Cys3307Trp) rs1057519382
NP_000251.3(MYO7A):p.Tyr1302fsTer97
NP_005700.2(USH1C):p.Arg357Trp
PCDH15, 3-BP DEL, 5601AAC
PCDH15, IVS27, A-G, -2
USH1C, 1-BP DEL, 1220G
USH1C, IVS5DS, G-A, +1
USH1G, 15-BP DEL, NT163

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.