ClinVar Miner

List of variants reported as pathogenic for Usher syndrome type 1

Included ClinVar conditions (15):
Minimum submission review status: Collection method:
Minimum conflict level:
ClinVar version:
Total variants: 133
Download table as spreadsheet
HGVS dbSNP
MYO7A, IVS27AS, G-C, -1
NM_000260.3(MYO7A):c.1969C>T rs878853236
NM_000260.4(MYO7A):c.1134_1146dup (p.Ser383fs) rs1591286671
NM_000260.4(MYO7A):c.1258A>T (p.Lys420Ter) rs782539587
NM_000260.4(MYO7A):c.133-2A>G rs782064437
NM_000260.4(MYO7A):c.1344-2A>G rs111033415
NM_000260.4(MYO7A):c.1556G>A (p.Gly519Asp) rs111033206
NM_000260.4(MYO7A):c.1623dup (p.Lys542fs) rs782077721
NM_000260.4(MYO7A):c.1797G>A (p.Met599Ile) rs121965082
NM_000260.4(MYO7A):c.1845del (p.Lys615fs) rs886037762
NM_000260.4(MYO7A):c.1884C>A (p.Cys628Ter) rs121965083
NM_000260.4(MYO7A):c.19-2A>G rs1555051384
NM_000260.4(MYO7A):c.1900C>T (p.Arg634Ter) rs111033180
NM_000260.4(MYO7A):c.1952T>C (p.Leu651Pro) rs876657416
NM_000260.4(MYO7A):c.1976C>A (p.Ser659Ter) rs878853378
NM_000260.4(MYO7A):c.1996C>T (p.Arg666Ter) rs121965085
NM_000260.4(MYO7A):c.2005C>T (p.Arg669Ter) rs111033201
NM_000260.4(MYO7A):c.2187+1G>A rs111033290
NM_000260.4(MYO7A):c.2187+1G>T rs111033290
NM_000260.4(MYO7A):c.223del (p.Asp75fs) rs876657415
NM_000260.4(MYO7A):c.2283-1G>T rs397516295
NM_000260.4(MYO7A):c.2307del (p.Asn769fs) rs1060499800
NM_000260.4(MYO7A):c.2311G>T (p.Ala771Ser) rs782384464
NM_000260.4(MYO7A):c.2461C>T (p.Gln821Ter) rs1279918132
NM_000260.4(MYO7A):c.2476G>A (p.Ala826Thr) rs368341987
NM_000260.4(MYO7A):c.285+2T>G rs782292032
NM_000260.4(MYO7A):c.3262C>T (p.Gln1088Ter) rs376535635
NM_000260.4(MYO7A):c.3504-1G>C rs1555090171
NM_000260.4(MYO7A):c.3508G>A (p.Glu1170Lys) rs111033214
NM_000260.4(MYO7A):c.3594C>A (p.Cys1198Ter) rs782694195
NM_000260.4(MYO7A):c.3719G>A (p.Arg1240Gln) rs111033178
NM_000260.4(MYO7A):c.3724C>T (p.Gln1242Ter) rs1057517857
NM_000260.4(MYO7A):c.3764del (p.Lys1255fs) rs111033347
NM_000260.4(MYO7A):c.3872_3873TC[3] (p.Leu1293fs) rs760251968
NM_000260.4(MYO7A):c.3892G>A (p.Gly1298Arg) rs727503329
NM_000260.4(MYO7A):c.4006C>T (p.Gln1336Ter) rs750647872
NM_000260.4(MYO7A):c.4117C>T (p.Arg1373Ter) rs766641715
NM_000260.4(MYO7A):c.4297del (p.Gln1433fs) rs1555096223
NM_000260.4(MYO7A):c.448C>T (p.Arg150Ter) rs121965079
NM_000260.4(MYO7A):c.470+1G>A rs797044510
NM_000260.4(MYO7A):c.4805G>A (p.Arg1602Gln) rs139889944
NM_000260.4(MYO7A):c.4838del (p.Asp1613fs) rs1199012623
NM_000260.4(MYO7A):c.4852+1G>A
NM_000260.4(MYO7A):c.4996_4997del (p.Ser1666fs) rs1591467894
NM_000260.4(MYO7A):c.5069_5070insC (p.Gln1690fs) rs1591470904
NM_000260.4(MYO7A):c.52C>T (p.Gln18Ter) rs1555051455
NM_000260.4(MYO7A):c.5581C>T (p.Arg1861Ter) rs878864531
NM_000260.4(MYO7A):c.5632del (p.Ala1877_Leu1878insTer) rs1299898646
NM_000260.4(MYO7A):c.5824G>T (p.Gly1942Ter) rs111033192
NM_000260.4(MYO7A):c.5886_5889del (p.Phe1962fs) rs1397834886
NM_000260.4(MYO7A):c.6025del (p.Ala2009fs) rs397516326
NM_000260.4(MYO7A):c.6028G>A (p.Asp2010Asn) rs755934966
NM_000260.4(MYO7A):c.6070C>T (p.Arg2024Ter) rs111033198
NM_000260.4(MYO7A):c.6196C>T (p.Gln2066Ter) rs1060499801
NM_000260.4(MYO7A):c.6321G>A (p.Trp2107Ter) rs773945008
NM_000260.4(MYO7A):c.634C>T (p.Arg212Cys) rs121965080
NM_000260.4(MYO7A):c.635G>A (p.Arg212His) rs28934610
NM_000260.4(MYO7A):c.640G>A (p.Gly214Arg) rs111033283
NM_000260.4(MYO7A):c.6439-2A>G rs397516330
NM_000260.4(MYO7A):c.652_657del (p.Asp218_Ile219del) rs1555062984
NM_000260.4(MYO7A):c.700C>T (p.Gln234Ter) rs41298133
NM_000260.4(MYO7A):c.905G>A (p.Arg302His) rs41298135
NM_000260.4(MYO7A):c.93C>A (p.Cys31Ter) rs35689081
NM_005709.3(USH1C):c.238dupC (p.Arg80Profs) rs397515359
NM_005709.4(USH1C):c.1285-2684C>T rs146451547
NM_005709.4(USH1C):c.1285-3970G>A rs150567427
NM_005709.4(USH1C):c.496+1G>A rs138138689
NM_005709.4(USH1C):c.496+1G>T rs138138689
NM_006383.4(CIB2):c.192G>C (p.Glu64Asp) rs145415848
NM_022124.6(CDH23):c.193del (p.Leu65fs) rs796051861
NM_022124.6(CDH23):c.1987-1G>A rs1060499714
NM_022124.6(CDH23):c.2206C>T (p.Arg736Ter) rs1230303971
NM_022124.6(CDH23):c.2289+1G>A rs769433759
NM_022124.6(CDH23):c.3428dup (p.His1143fs) rs1253419936
NM_022124.6(CDH23):c.3625A>G (p.Thr1209Ala) rs41281314
NM_022124.6(CDH23):c.3839_3841TGA[1] (p.Met1281del) rs796051860
NM_022124.6(CDH23):c.3880C>T (p.Gln1294Ter) rs121908350
NM_022124.6(CDH23):c.4105-2A>T
NM_022124.6(CDH23):c.4210-2A>G rs557620034
NM_022124.6(CDH23):c.4309C>T (p.Arg1437Ter) rs397517329
NM_022124.6(CDH23):c.4488G>C (p.Gln1496His) rs121908347
NM_022124.6(CDH23):c.5237G>A (p.Arg1746Gln) rs111033270
NM_022124.6(CDH23):c.5311C>T (p.Arg1771Ter) rs750027965
NM_022124.6(CDH23):c.6000C>A (p.Tyr2000Ter) rs1564794944
NM_022124.6(CDH23):c.6050-9G>A rs367928692
NM_022124.6(CDH23):c.6285dup (p.Glu2096Ter) rs1564796487
NM_022124.6(CDH23):c.6449del (p.Gly2150fs) rs1564796673
NM_022124.6(CDH23):c.7362+5G>A rs727502931
NM_022124.6(CDH23):c.7872G>A (p.Glu2624=) rs1292050472
NM_022124.6(CDH23):c.8239del (p.Val2747fs) rs1554877007
NM_022124.6(CDH23):c.9284dup (p.Arg3096fs) rs1564808024
NM_022124.6(CDH23):c.945+1G>A rs727502919
NM_022124.6(CDH23):c.9565C>T (p.Arg3189Trp) rs121908353
NM_031475.3(ESPN):c.2369_2386del (p.Arg790_Arg795del) rs1557720377
NM_033056.4(PCDH15):c.1088del (p.Leu363fs) rs199469706
NM_033056.4(PCDH15):c.158-1G>A rs876657418
NM_033056.4(PCDH15):c.16del (p.Tyr6fs) rs397517451
NM_033056.4(PCDH15):c.1863T>G (p.Tyr621Ter) rs1590691343
NM_033056.4(PCDH15):c.1927C>T (p.Arg643Ter) rs727504301
NM_033056.4(PCDH15):c.1940C>G (p.Ser647Ter) rs137853004
NM_033056.4(PCDH15):c.2645_2646del (p.Asp881_Tyr882insTer) rs1589950125
NM_033056.4(PCDH15):c.2971C>T (p.Arg991Ter) rs754391973
NM_033056.4(PCDH15):c.3316C>T (p.Arg1106Ter) rs202033121
NM_033056.4(PCDH15):c.394dup (p.Glu132fs) rs397515566
NM_033056.4(PCDH15):c.400C>T (p.Arg134Ter) rs137853003
NM_033056.4(PCDH15):c.5598_5600AAC[1] (p.Thr1869del) rs113363047
NM_033056.4(PCDH15):c.733C>T (p.Arg245Ter) rs111033260
NM_033056.4(PCDH15):c.7C>T (p.Arg3Ter) rs137853001
NM_033056.4(PCDH15):c.92-528C>T
NM_153676.4(USH1C):c.1211-1175del rs1207247951
NM_153676.4(USH1C):c.216G>A (p.Val72=) rs151045328
NM_153676.4(USH1C):c.2227-1G>A rs778110397
NM_153676.4(USH1C):c.308G>A (p.Arg103His) rs397514500
NM_153676.4(USH1C):c.36+1G>T rs1403777293
NM_153676.4(USH1C):c.496+21GCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGGGAGCAGG[9] rs55983148
NM_153676.4(USH1C):c.497-2del rs1480243085
NM_153676.4(USH1C):c.7C>T (p.Arg3Ter) rs876657624
NM_153676.4(USH1C):c.91C>T (p.Arg31Ter) rs121908370
NM_173477.5(USH1G):c.1060G>T (p.Asp354Tyr) rs1316299165
NM_173477.5(USH1G):c.113G>A (p.Trp38Ter) rs104894652
NM_173477.5(USH1G):c.143T>C (p.Leu48Pro) rs104894651
NM_173477.5(USH1G):c.186_187del (p.Ile63fs) rs730880268
NM_173477.5(USH1G):c.205dup (p.Leu69fs) rs1598584825
NM_173477.5(USH1G):c.208_209insTC (p.His70fs) rs1555627787
NM_173477.5(USH1G):c.394dup (p.Val132fs) rs587776546
NM_173477.5(USH1G):c.511G>T (p.Glu171Ter) rs201866631
NM_173477.5(USH1G):c.832_851del (p.Ser278fs) rs397515345
NP_000251.3(MYO7A):p.Tyr1302fsTer97
PCDH15, 3-BP DEL, 5601AAC
PCDH15, IVS27, A-G, -2
USH1C, 1-BP DEL, 1220G
USH1C, IVS5DS, G-A, +1
USH1G, 15-BP DEL, NT163

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.