ClinVar Miner

List of variants reported as pathogenic for Usher syndrome type 1

Included ClinVar conditions (15):
Minimum submission review status: Collection method:
Minimum conflict level:
ClinVar version:
Total variants: 179
Download table as spreadsheet
HGVS dbSNP
MYO7A, IVS27AS, G-C, -1
NM_000260.3(MYO7A):c.1200+1G>A rs397516283
NM_000260.3(MYO7A):c.133-2A>G rs782064437
NM_000260.3(MYO7A):c.1344-2A>G rs111033415
NM_000260.3(MYO7A):c.141G>A (p.Trp47Ter) rs397516285
NM_000260.3(MYO7A):c.1556G>A (p.Gly519Asp) rs111033206
NM_000260.3(MYO7A):c.1556delG (p.Gly519Alafs) rs606231379
NM_000260.3(MYO7A):c.1797G>A (p.Met599Ile) rs121965082
NM_000260.3(MYO7A):c.1845delG (p.Lys615Asnfs) rs886037762
NM_000260.3(MYO7A):c.1884C>A (p.Cys628Ter) rs121965083
NM_000260.3(MYO7A):c.19-2A>G rs1555051384
NM_000260.3(MYO7A):c.1900C>T (p.Arg634Ter) rs111033180
NM_000260.3(MYO7A):c.1952T>C (p.Leu651Pro) rs876657416
NM_000260.3(MYO7A):c.1963C>T (p.Gln655Ter) rs397516291
NM_000260.3(MYO7A):c.1969C>T rs878853236
NM_000260.3(MYO7A):c.1976C>A (p.Ser659Ter) rs878853378
NM_000260.3(MYO7A):c.1996C>T (p.Arg666Ter) rs121965085
NM_000260.3(MYO7A):c.2005C>T (p.Arg669Ter) rs111033201
NM_000260.3(MYO7A):c.2094+1G>A rs111033404
NM_000260.3(MYO7A):c.2172delC (p.Lys725Argfs) rs397516294
NM_000260.3(MYO7A):c.2187+1G>A rs111033290
NM_000260.3(MYO7A):c.223delG (p.Asp75ThrfsTer31) rs876657415
NM_000260.3(MYO7A):c.2283-1G>T (p.Ser762CysfsTer61) rs397516295
NM_000260.3(MYO7A):c.2311G>T (p.Ala771Ser) rs782384464
NM_000260.3(MYO7A):c.2323C>T (p.Gln775Ter) rs201892914
NM_000260.3(MYO7A):c.2461C>T (p.Gln821Ter) rs1279918132
NM_000260.3(MYO7A):c.285+2T>C rs782292032
NM_000260.3(MYO7A):c.2904G>T (p.Glu968Asp) rs111033233
NM_000260.3(MYO7A):c.3327delC (p.His1109Glnfs) rs111033433
NM_000260.3(MYO7A):c.3504-1G>C rs1555090171
NM_000260.3(MYO7A):c.3508G>A (p.Glu1170Lys) rs111033214
NM_000260.3(MYO7A):c.3564_3571delTGCCCGGGinsA (p.Tyr1188Terfs) rs797044513
NM_000260.3(MYO7A):c.3591_3592delCT (p.Cys1198Argfs) rs1555090368
NM_000260.3(MYO7A):c.3594C>A (p.Cys1198Ter) rs782694195
NM_000260.3(MYO7A):c.3696_3706delAAGGACCTTTG (p.Arg1232Serfs) rs397516303
NM_000260.3(MYO7A):c.3719G>A (p.Arg1240Gln) rs111033178
NM_000260.3(MYO7A):c.3724C>T (p.Gln1242Ter) rs1057517857
NM_000260.3(MYO7A):c.3728_3729insC (p.Pro1244Alafs) rs397516304
NM_000260.3(MYO7A):c.3764delA (p.Lys1255Argfs) rs111033347
NM_000260.3(MYO7A):c.3892G>A (p.Gly1298Arg) rs727503329
NM_000260.3(MYO7A):c.4006C>T (p.Gln1336Ter)
NM_000260.3(MYO7A):c.4117C>T (p.Arg1373Ter) rs766641715
NM_000260.3(MYO7A):c.4293G>A (p.Trp1431Ter) rs397516308
NM_000260.3(MYO7A):c.4297delC (p.Gln1433Serfs) rs1555096223
NM_000260.3(MYO7A):c.448C>T (p.Arg150Ter) rs121965079
NM_000260.3(MYO7A):c.4544_4551delAGATCATGinsCA (p.Glu1515_Met1517delinsAla) rs111033259
NM_000260.3(MYO7A):c.4555delG (p.Val1519Cysfs) rs876657712
NM_000260.3(MYO7A):c.470+1G>A rs797044510
NM_000260.3(MYO7A):c.4805G>A (p.Arg1602Gln) rs139889944
NM_000260.3(MYO7A):c.4821T>A (p.Tyr1607Ter) rs397516315
NM_000260.3(MYO7A):c.4838delA (p.Asp1613Valfs) rs1199012623
NM_000260.3(MYO7A):c.494C>T (p.Thr165Met) rs111033174
NM_000260.3(MYO7A):c.496delG (p.Glu166Argfs) rs111033448
NM_000260.3(MYO7A):c.5101C>T (p.Arg1701Ter) rs111033182
NM_000260.3(MYO7A):c.52C>T (p.Gln18Ter) rs1555051455
NM_000260.3(MYO7A):c.5392C>T (p.Gln1798Ter) rs397516317
NM_000260.3(MYO7A):c.5573T>C (p.Leu1858Pro) rs368657015
NM_000260.3(MYO7A):c.5581C>T (p.Arg1861Ter) rs878864531
NM_000260.3(MYO7A):c.5581_5582insC (p.Arg1861Profs) rs397516320
NM_000260.3(MYO7A):c.5617C>T (p.Arg1873Trp) rs397516321
NM_000260.3(MYO7A):c.5632delC (p.Leu1878Terfs) rs1299898646
NM_000260.3(MYO7A):c.5648G>A (p.Arg1883Gln) rs111033215
NM_000260.3(MYO7A):c.5660C>T (p.Pro1887Leu) rs199606180
NM_000260.3(MYO7A):c.5824G>T (p.Gly1942Ter) rs111033192
NM_000260.3(MYO7A):c.582delC (p.Ile195Phefs) rs111033238
NM_000260.3(MYO7A):c.5845_5855delATTGCAGACAA (p.Ile1949Glyfs) rs876657713
NM_000260.3(MYO7A):c.5886_5888delCTT (p.Phe1963del) rs111033232
NM_000260.3(MYO7A):c.5886_5889delCTTT (p.Phe1962Leufs) rs1397834886
NM_000260.3(MYO7A):c.5899C>T (p.Arg1967Ter) rs376764423
NM_000260.3(MYO7A):c.6025delG (p.Ala2009Profs) rs397516326
NM_000260.3(MYO7A):c.6028G>A (p.Asp2010Asn) rs755934966
NM_000260.3(MYO7A):c.6029A>G (p.Asp2010Gly) rs111033175
NM_000260.3(MYO7A):c.6070C>T (p.Arg2024Ter) rs111033198
NM_000260.3(MYO7A):c.6231_6232insG (p.Lys2078Glufs) rs730880367
NM_000260.3(MYO7A):c.6321G>A (p.Trp2107Ter) rs773945008
NM_000260.3(MYO7A):c.634C>T (p.Arg212Cys) rs121965080
NM_000260.3(MYO7A):c.635G>A (p.Arg212His) rs28934610
NM_000260.3(MYO7A):c.640G>A (p.Gly214Arg) rs111033283
NM_000260.3(MYO7A):c.6439-2A>G rs397516330
NM_000260.3(MYO7A):c.6498C>A (p.Tyr2166Ter) rs397516331
NM_000260.3(MYO7A):c.652_657delGACATC (p.Asp218_Ile219del) rs1555062984
NM_000260.3(MYO7A):c.689C>T (p.Ala230Val) rs797044512
NM_000260.3(MYO7A):c.700C>T (p.Gln234Ter) rs41298133
NM_000260.3(MYO7A):c.73G>A (p.Gly25Arg) rs782252317
NM_000260.3(MYO7A):c.77C>A (p.Ala26Glu) rs369125667
NM_000260.3(MYO7A):c.93C>A (p.Cys31Ter) rs35689081
NM_000260.3(MYO7A):c.973_976delATCC (p.Ile325Cysfs) rs797044490
NM_000260.3(MYO7A):c.999T>G (p.Tyr333Ter) rs111033285
NM_000260.3:c.(?_6355)_(6648_?)del
NM_000260.4(MYO7A):c.1258A>T (p.Lys420Ter) rs782539587
NM_000260.4(MYO7A):c.2115C>A (p.Cys705Ter) rs782255281
NM_000260.4(MYO7A):c.905G>A (p.Arg302His) rs41298135
NM_001142763.1(PCDH15):c.2986C>T (p.Arg996Ter) rs754391973
NM_001142772.1(PCDH15):c.400C>T (p.Arg134Ter) rs137853003
NM_001171933.1(CDH23):c.1519delG (p.Val507Trpfs) rs1554877007
NM_005709.3(USH1C):c.1220delG (p.Gly407Glufs) rs1207247951
NM_005709.3(USH1C):c.216G>A (p.Val72=) rs151045328
NM_005709.3(USH1C):c.238dupC (p.Arg80Profs) rs397515359
NM_005709.3(USH1C):c.496+1G>T rs138138689
NM_005709.3(USH1C):c.7C>T (p.Arg3Ter) rs876657624
NM_005709.3(USH1C):c.91C>T (p.Arg31Ter) rs121908370
NM_006383.3(CIB2):c.192G>C (p.Glu64Asp) rs145415848
NM_022124.5(CDH23):c.193delC (p.Leu65Trpfs) rs796051861
NM_022124.5(CDH23):c.1949_1950insC (p.Leu651Serfs) rs753886326
NM_022124.5(CDH23):c.1987-1G>A rs1060499714
NM_022124.5(CDH23):c.2012delT (p.Phe671Serfs) rs397517313
NM_022124.5(CDH23):c.2289+1G>A rs769433759
NM_022124.5(CDH23):c.3428dup (p.His1143Glnfs)
NM_022124.5(CDH23):c.3481C>T (p.Arg1161Ter) rs397517323
NM_022124.5(CDH23):c.3628C>T (p.Gln1210Ter) rs397517326
NM_022124.5(CDH23):c.3706C>T (p.Arg1236Ter) rs397517327
NM_022124.5(CDH23):c.3842_3844del (p.Met1281del) rs796051860
NM_022124.5(CDH23):c.3880C>T (p.Gln1294Ter) rs121908350
NM_022124.5(CDH23):c.4210-2A>G
NM_022124.5(CDH23):c.4309C>T (p.Arg1437Ter) rs397517329
NM_022124.5(CDH23):c.4488G>C (p.Gln1496His) rs121908347
NM_022124.5(CDH23):c.46delG (p.Val16Cysfs) rs397517331
NM_022124.5(CDH23):c.5237G>A (p.Arg1746Gln) rs111033270
NM_022124.5(CDH23):c.5272C>T (p.Gln1758Ter) rs397517337
NM_022124.5(CDH23):c.5712+1G>A rs397517341
NM_022124.5(CDH23):c.5712G>A (p.Thr1904=) rs397517342
NM_022124.5(CDH23):c.5923+1G>A rs397517346
NM_022124.5(CDH23):c.6000C>A (p.Tyr2000Ter)
NM_022124.5(CDH23):c.6049+1G>A rs111033247
NM_022124.5(CDH23):c.6050-9G>A rs367928692
NM_022124.5(CDH23):c.6285dup (p.Glu2096Terfs)
NM_022124.5(CDH23):c.6442G>A (p.Asp2148Asn) rs111033271
NM_022124.5(CDH23):c.6968delC (p.Pro2323Leufs) rs397517350
NM_022124.5(CDH23):c.7362+5G>A rs727502931
NM_022124.5(CDH23):c.7483-1G>C rs876657682
NM_022124.5(CDH23):c.7776G>A (p.Trp2592Ter) rs397517353
NM_022124.5(CDH23):c.7873-2A>T rs727502933
NM_022124.5(CDH23):c.7979_7986delACTGGGAG (p.Asp2660Valfs) rs727504761
NM_022124.5(CDH23):c.8064+1G>T rs1474524543
NM_022124.5(CDH23):c.8781C>A (p.Tyr2927Ter) rs397517362
NM_022124.5(CDH23):c.9176delC (p.Pro3059Argfs) rs1554877806
NM_022124.5(CDH23):c.945+1G>A
NM_022124.5(CDH23):c.945+1G>T rs727502919
NM_022124.5(CDH23):c.9556C>T (p.Arg3186Ter) rs773464867
NM_022124.5(CDH23):c.9629_9632delTCAA (p.Ile3210Argfs) rs397517367
NM_022124.5:c.(?_3716)_(4146_?)del
NM_022124.6(CDH23):c.3625A>G (p.Thr1209Ala) rs41281314
NM_022124.6(CDH23):c.9565C>T (p.Arg3189Trp) rs121908353
NM_031475.2(ESPN):c.2369_2386del (p.Arg790_Arg795del)
NM_033056.3(PCDH15):c.(?_-15)_(876_?)del
NM_033056.3(PCDH15):c.(?_3374)_(3501_?)del (p.(?))
NM_033056.3(PCDH15):c.1086delT (p.Leu363Trpfs) rs199469706
NM_033056.3(PCDH15):c.158-1G>A rs876657418
NM_033056.3(PCDH15):c.16delT (p.Tyr6Ilefs) rs397517451
NM_033056.3(PCDH15):c.1927C>T (p.Arg643Ter) rs727504301
NM_033056.3(PCDH15):c.1940C>G (p.Ser647Ter) rs137853004
NM_033056.3(PCDH15):c.1998-2A>G rs397517452
NM_033056.3(PCDH15):c.2419dupA (p.Ile807Asnfs) rs781148814
NM_033056.3(PCDH15):c.3316C>T (p.Arg1106Ter) rs202033121
NM_033056.3(PCDH15):c.3358C>T (p.Arg1120Ter) rs773404494
NM_033056.3(PCDH15):c.394dupG (p.Glu132Glyfs) rs397515566
NM_033056.3(PCDH15):c.5601_5603delAAC (p.Thr1869del) rs113363047
NM_033056.3(PCDH15):c.733C>T (p.Arg245Ter) rs111033260
NM_033056.3(PCDH15):c.7C>T (p.Arg3Ter) rs137853001
NM_033056.3:c.92-13779_157+41368del
NM_052836.3(CDH23):c.1450G>T (p.Val484Leu) rs876657680
NM_153676.3(USH1C):c.308G>A (p.Arg103His) rs397514500
NM_153676.3(USH1C):c.496+1G>A rs138138689
NM_153676.3(USH1C):c.496+59_479-35GAGCAGGGCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGG[7]GAGCAGGTCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGG[2] rs55983148
NM_173477.4(USH1G):c.113G>A (p.Trp38Ter) rs104894652
NM_173477.4(USH1G):c.143T>C (p.Leu48Pro) rs104894651
NM_173477.4(USH1G):c.186_187del (p.Ile63Leufs) rs730880268
NM_173477.4(USH1G):c.832_851del20 (p.Ser278Profs) rs397515345
NM_173477.5(USH1G):c.1060G>T (p.Asp354Tyr)
NM_173477.5(USH1G):c.394dup (p.Val132Glyfs) rs587776546
NP_000251.3(MYO7A):p.Tyr1302fsTer97
PCDH15, 3-BP DEL, 5601AAC
PCDH15, IVS27, A-G, -2
USH1C, 1-BP DEL, 1220G
USH1C, IVS16AS, G-T, -1
USH1C, IVS1DS, G-T, +1
USH1C, IVS5AS, A DEL, -2
USH1C, IVS5DS, G-A, +1
USH1G, 15-BP DEL, NT163

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.