ClinVar Miner

List of variants in gene USH1C studied for Usher syndrome type 1C

Included ClinVar conditions (3):
Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 119
Download table as spreadsheet
HGVS dbSNP
NM_005709.3(USH1C):c.1284+6881_1284+6882ins14 rs781176348
NM_005709.3(USH1C):c.238dupC (p.Arg80Profs) rs397515359
NM_005709.4(USH1C):c.1146dup (p.Gln383fs) rs1554960388
NM_005709.4(USH1C):c.1284+6880del rs745622612
NM_005709.4(USH1C):c.1426dup (p.Ile476fs) rs758555088
NM_005709.4(USH1C):c.1628dup (p.Glu544fs) rs1554953360
NM_005709.4(USH1C):c.841_848del (p.Ser281fs) rs1064797153
NM_153676.4(USH1C):c.1013A>C (p.Glu338Ala) rs876658109
NM_153676.4(USH1C):c.1016G>A (p.Arg339Gln) rs765571023
NM_153676.4(USH1C):c.1020-2A>C rs147956944
NM_153676.4(USH1C):c.104+1G>A rs1287021691
NM_153676.4(USH1C):c.1069C>T (p.Arg357Trp) rs140934960
NM_153676.4(USH1C):c.1139del (p.Gly379_Ser380insTer) rs1554960390
NM_153676.4(USH1C):c.1210+5G>A rs372285784
NM_153676.4(USH1C):c.1211-1175del rs1207247951
NM_153676.4(USH1C):c.1216G>T (p.Gly406Ter) rs1554959148
NM_153676.4(USH1C):c.1233C>T (p.Tyr411=) rs377439949
NM_153676.4(USH1C):c.1265del (p.Gly422fs) rs1554957912
NM_153676.4(USH1C):c.1290T>G (p.Tyr430Ter) rs1406224812
NM_153676.4(USH1C):c.1292G>T (p.Gly431Val) rs751388655
NM_153676.4(USH1C):c.1351_1356AAAGAG[1] (p.451_452KE[1]) rs1554957867
NM_153676.4(USH1C):c.1363G>T (p.Glu455Ter) rs148115969
NM_153676.4(USH1C):c.1413+2T>C rs1344670523
NM_153676.4(USH1C):c.1414-2_1414-1insCTG rs769675063
NM_153676.4(USH1C):c.1531-11A>G rs397517872
NM_153676.4(USH1C):c.1543_1551CCCCCGCCT[3] (p.Pro518_Pro520dup) rs777764626
NM_153676.4(USH1C):c.1548G>A (p.Pro516=) rs780428813
NM_153676.4(USH1C):c.1556C>T (p.Pro519Leu) rs778703128
NM_153676.4(USH1C):c.1559dup (p.Ser521fs) rs1554957167
NM_153676.4(USH1C):c.1654_1660del (p.Tyr552fs) rs758580540
NM_153676.4(USH1C):c.1712_1716dup (p.Pro573fs) rs1554957020
NM_153676.4(USH1C):c.1739_1744del (p.Pro580_Val581del) rs1175090344
NM_153676.4(USH1C):c.1806del (p.Ile603fs) rs765346539
NM_153676.4(USH1C):c.1806dup (p.Ile603fs) rs765346539
NM_153676.4(USH1C):c.1807dup (p.Ile603fs) rs1554956941
NM_153676.4(USH1C):c.1822C>T (p.Pro608Ser) rs727505247
NM_153676.4(USH1C):c.1824del (p.Pro609fs) rs1389725640
NM_153676.4(USH1C):c.1840C>T (p.Gln614Ter) rs1554956913
NM_153676.4(USH1C):c.1840del (p.Gln614fs) rs1554956916
NM_153676.4(USH1C):c.1871C>A (p.Ser624Ter) rs778700091
NM_153676.4(USH1C):c.1874C>T (p.Ala625Val) rs727505187
NM_153676.4(USH1C):c.187C>T (p.Arg63Trp) rs375741564
NM_153676.4(USH1C):c.188G>A (p.Arg63Gln) rs372497947
NM_153676.4(USH1C):c.1954_1955CA[1] (p.His652fs) rs766725582
NM_153676.4(USH1C):c.1A>G (p.Met1Val) rs1554965967
NM_153676.4(USH1C):c.2006_2010del (p.Thr669fs) rs1554956821
NM_153676.4(USH1C):c.2041C>T (p.Arg681Ter) rs369369849
NM_153676.4(USH1C):c.2089G>T (p.Glu697Ter) rs139116036
NM_153676.4(USH1C):c.2124T>C (p.Ser708=) rs369021714
NM_153676.4(USH1C):c.216G>A (p.Val72=) rs151045328
NM_153676.4(USH1C):c.2185-2A>G rs1358056232
NM_153676.4(USH1C):c.2191C>T (p.Arg731Trp) rs397517874
NM_153676.4(USH1C):c.2192G>A (p.Arg731Gln) rs371626423
NM_153676.4(USH1C):c.2194A>G (p.Lys732Glu) rs148168494
NM_153676.4(USH1C):c.2227-1G>A
NM_153676.4(USH1C):c.2227-1G>T rs778110397
NM_153676.4(USH1C):c.2240A>G (p.Gln747Arg) rs201600193
NM_153676.4(USH1C):c.2280+2T>C rs1554954681
NM_153676.4(USH1C):c.2281-1G>A rs1554954574
NM_153676.4(USH1C):c.2281-2A>G rs921755529
NM_153676.4(USH1C):c.2341G>A (p.Val781Ile) rs397517875
NM_153676.4(USH1C):c.2381-2A>G rs1465352266
NM_153676.4(USH1C):c.2418C>A (p.Asn806Lys) rs397517876
NM_153676.4(USH1C):c.2418C>T (p.Asn806=) rs397517876
NM_153676.4(USH1C):c.2419G>A (p.Gly807Ser) rs142652588
NM_153676.4(USH1C):c.241C>T (p.Arg81Cys) rs876658111
NM_153676.4(USH1C):c.2431_2451del (p.Thr811_Glu817del) rs779253356
NM_153676.4(USH1C):c.2441C>A (p.Thr814Asn) rs397517877
NM_153676.4(USH1C):c.2458G>A (p.Ala820Thr) rs397517878
NM_153676.4(USH1C):c.245C>G (p.Ser82Cys) rs769021971
NM_153676.4(USH1C):c.248+1G>A rs1482487617
NM_153676.4(USH1C):c.2487C>T (p.Gly829=) rs142801489
NM_153676.4(USH1C):c.2490+1G>T rs1554953746
NM_153676.4(USH1C):c.2490+1del rs1366154374
NM_153676.4(USH1C):c.2490+2T>C rs1554953745
NM_153676.4(USH1C):c.2546+1G>T rs1554953350
NM_153676.4(USH1C):c.2547-1G>T rs571304936
NM_153676.4(USH1C):c.2590C>T (p.Arg864Ter) rs767767573
NM_153676.4(USH1C):c.2611G>A (p.Ala871Thr) rs56165709
NM_153676.4(USH1C):c.2617G>A (p.Val873Met) rs201533059
NM_153676.4(USH1C):c.2655+12G>A rs727504552
NM_153676.4(USH1C):c.2656-1G>A rs747133793
NM_153676.4(USH1C):c.2661_2663TCT[1] (p.Leu889del) rs1474458620
NM_153676.4(USH1C):c.266G>A (p.Arg89His) rs749647539
NM_153676.4(USH1C):c.2681del (p.Gly894fs) rs1554952757
NM_153676.4(USH1C):c.2688_2695dup (p.Arg899fs) rs1554952752
NM_153676.4(USH1C):c.308G>A (p.Arg103His) rs397514500
NM_153676.4(USH1C):c.311G>A (p.Gly104Asp) rs1317951509
NM_153676.4(USH1C):c.36+1G>T
NM_153676.4(USH1C):c.379G>A (p.Gly127Arg) rs768207716
NM_153676.4(USH1C):c.388-8T>A rs777486804
NM_153676.4(USH1C):c.388G>A (p.Val130Ile) rs55843567
NM_153676.4(USH1C):c.440A>G (p.His147Arg) rs777591673
NM_153676.4(USH1C):c.463C>T (p.Arg155Ter) rs377145777
NM_153676.4(USH1C):c.496+1G>A rs138138689
NM_153676.4(USH1C):c.496+1G>T rs138138689
NM_153676.4(USH1C):c.496+21GCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGGGAGCAGG[9] rs55983148
NM_153676.4(USH1C):c.497-2del
NM_153676.4(USH1C):c.497-4G>A rs397517881
NM_153676.4(USH1C):c.569C>T (p.Ser190Leu) rs200319849
NM_153676.4(USH1C):c.579+1G>C rs1283092935
NM_153676.4(USH1C):c.582C>T (p.Gly194=) rs397517882
NM_153676.4(USH1C):c.598G>A (p.Gly200Ser) rs770543827
NM_153676.4(USH1C):c.629A>C (p.Lys210Thr) rs372789934
NM_153676.4(USH1C):c.672C>A (p.Cys224Ter) rs1223763703
NM_153676.4(USH1C):c.674+1G>A rs775496999
NM_153676.4(USH1C):c.674+1del rs1554961872
NM_153676.4(USH1C):c.674+2T>G rs1298596518
NM_153676.4(USH1C):c.748_759+5del rs1355262412
NM_153676.4(USH1C):c.760-1G>T rs1187887456
NM_153676.4(USH1C):c.76C>T (p.Leu26Phe) rs267602805
NM_153676.4(USH1C):c.793G>A (p.Asp265Asn) rs199537187
NM_153676.4(USH1C):c.7C>T (p.Arg3Ter) rs876657624
NM_153676.4(USH1C):c.819+1G>A rs1554961152
NM_153676.4(USH1C):c.877-1G>A rs771279169
NM_153676.4(USH1C):c.915_920del (p.Glu306_Ala307del) rs1554960929
NM_153676.4(USH1C):c.91C>T (p.Arg31Ter) rs121908370
USH1C, 1-BP DEL, 1220G
USH1C, IVS5DS, G-A, +1

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.