ClinVar Miner

List of variants reported as pathogenic for X-linked hypohidrotic ectodermal dysplasia

Included ClinVar conditions (2):
Minimum submission review status: Collection method:
Minimum conflict level:
ClinVar version:
Total variants: 43
Download table as spreadsheet
HGVS dbSNP
EDA, 1-BP DEL, EX6
EDA, 36-BP DEL, EX5
NC_000023.10:g.(?_68836133)_(69255479_?)del
NC_000023.10:g.(?_68890034)_(69177002_?)dup
NC_000023.10:g.(?_69080668)_(69177002_?)dup
NC_000023.10:g.(?_69243048)_(69255479_?)del
NC_000023.11:g.(?_69616289)_(69616724_?)del
NC_000023.11:g.(?_69616289)_(69670280_?)del
NM_001399.4(EDA):c.1045G>A (p.Ala349Thr) rs132630317
NM_001399.4(EDA):c.1094T>C (p.Val365Ala) rs397516654
NM_001399.4(EDA):c.1133C>T (p.Thr378Met)
NM_001399.4(EDA):c.180C>A (p.Cys60Ter) rs1131692034
NM_001399.4(EDA):c.181T>C (p.Tyr61His) rs132630308
NM_001399.4(EDA):c.183C>G (p.Tyr61Ter) rs132630318
NM_001399.4(EDA):c.187G>A (p.Glu63Lys) rs132630311
NM_001399.4(EDA):c.206G>T (p.Arg69Leu) rs132630309
NM_001399.4(EDA):c.228_234delCCGCCTTinsAA (p.Leu78Argfs) rs1555972067
NM_001399.4(EDA):c.239dup (p.Ser81Leufs) rs1555972071
NM_001399.4(EDA):c.396+4dup
NM_001399.4(EDA):c.457C>T (p.Arg153Cys) rs397516662
NM_001399.4(EDA):c.459dup (p.Val154Cysfs)
NM_001399.4(EDA):c.463C>T (p.Arg155Cys) rs132630312
NM_001399.4(EDA):c.466C>T (p.Arg156Cys) rs132630313
NM_001399.4(EDA):c.467G>A (p.Arg156His) rs132630314
NM_001399.4(EDA):c.521_522delAAinsT (p.Lys174Ilefs) rs1556092261
NM_001399.4(EDA):c.527-2A>T
NM_001399.4(EDA):c.546_581delTGGACCCAATGGCCCTCCAGGACCCCCAGGACCTCC (p.Asn185_Pro196del) rs397516665
NM_001399.4(EDA):c.560dup (p.Pro188Serfs) rs1556098384
NM_001399.4(EDA):c.572_589delCAGGACCTCCAGGACCCC (p.Pro191_Pro196del) rs397516668
NM_001399.4(EDA):c.599dup (p.Gly201Argfs) rs1556098570
NM_001399.4(EDA):c.626C>T (p.Pro209Leu) rs132630315
NM_001399.4(EDA):c.628G>T (p.Gly210Ter) rs1556098733
NM_001399.4(EDA):c.663_697delTCCTCCTGGTCCTCAAGGACCCCCTGGCCTCCAGG (p.Pro222Thrfs) rs397516670
NM_001399.4(EDA):c.671G>C (p.Gly224Ala) rs132630316
NM_001399.4(EDA):c.67C>T (p.Gln23Ter) rs132630310
NM_001399.4(EDA):c.681_697delACCCCCTGGCCTCCAGG (p.Pro228Thrfs) rs1556098978
NM_001399.4(EDA):c.706+1G>A rs886039344
NM_001399.4(EDA):c.741G>A (p.Gln247=) rs886042183
NM_001399.4(EDA):c.755A>T (p.His252Leu) rs879255552
NM_001399.4(EDA):c.766C>T (p.Gln256Ter) rs727504417
NM_001399.4(EDA):c.826C>T (p.Arg276Cys) rs387907197
NM_001399.5(EDA):c.573_574insT (p.Gly192Trpfs)
NM_001399.5(EDA):c.912_913dup (p.Ser305Ilefs)

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.