ClinVar Miner

List of variants reported as pathogenic for Duchenne muscular dystrophy

Included ClinVar conditions (3):
Minimum submission review status: Collection method:
Minimum conflict level:
ClinVar version:
Total variants: 506
Download table as spreadsheet
HGVS dbSNP
DMD, 1-BP DEL, 10334C AND IVS69, G-T, +1
DMD, 1-BP DEL, 10662T
DMD, 1-BP DEL, 2568C
DMD, 1-BP DEL, 6408C
DMD, 1-BP DEL, 724C
DMD, 1-BP INS, 402A
DMD, 1-BP INS, 7188A
DMD, 1-BP INS, EX12
DMD, 1-BP INS, NT1554
DMD, 1-BP INS, NT2928
DMD, 11-BP DEL, NT989
DMD, 17-BP DEL, NT6982
DMD, 4-BP DEL, NT9679
DMD, 52-BP DEL
DMD, 8-BP DEL, 1-BP INS, NT10692
DMD, AG-T, EX48
DMD, EX18DEL
DMD, EX21DEL
DMD, EX73-76DEL
DMD, IVS47, G-A, +1, EX48DEL
DMD, IVS65, G-A, +1
DMD, IVS68, T-A, +2
DMD, IVS70, G-T, +5
GRCh37/hg19 Xp21.1(chrX:32235149-32459424)
GRCh37/hg19 Xp21.1(chrX:32466518-32928163)
GRCh37/hg19 Xp21.1(chrX:32587530-32719171)
NC_000023.10:g.(31838467_31853996)_(31855256_31867499)del
NC_000023.10:g.(?_31627738)_(31747885_?)del
NC_000023.10:g.(?_31627738)_(31838220_?)dup
NC_000023.10:g.(?_31747728)_(31893510_?)del
NC_000023.10:g.(?_31747728)_(31986651_?)del
NC_000023.10:g.(?_31792057)_(31893510_?)del
NC_000023.10:g.(?_31792057)_(31950364_?)del
NC_000023.10:g.(?_31792077)_(31854939_?)del
NC_000023.10:g.(?_31838072)_(31893510_?)del
NC_000023.10:g.(?_31838072)_(31986651_?)del
NC_000023.10:g.(?_31854815)_(31986651_?)del
NC_000023.10:g.(?_31947693)_(31950364_?)del
NC_000023.10:g.(?_31947693)_(31986651_?)del
NC_000023.10:g.(?_32429849)_(33038337_?)dup
NC_000023.10:g.(?_32632400)_(32632590_?)dup
NC_000023.10:g.31947471_31972601dup
NC_000023.11:g.(?_31119228)_(33211556_?)del
NC_000023.11:g.(?_31177912)_(31182924_?)dup
NC_000023.11:g.(?_31203961)_(31223121_?)dup
NC_000023.11:g.(?_31206562)_(31364153_?)dup
NC_000023.11:g.(?_31223027)_(31223141_?)del
NC_000023.11:g.(?_31260935)_(31729768_?)dup
NC_000023.11:g.(?_31260955)_(31261016_?)del
NC_000023.11:g.(?_31314406)_(31444647_?)dup
NC_000023.11:g.(?_31314406)_(31609621_?)dup
NC_000023.11:g.(?_31323578)_(31323678_?)dup
NC_000023.11:g.(?_31323578)_(31508257_?)del
NC_000023.11:g.(?_31323598)_(31479103_?)del
NC_000023.11:g.(?_31348536)_(31479123_?)del
NC_000023.11:g.(?_31348536)_(31729768_?)dup
NC_000023.11:g.(?_31444461)_(31679606_?)del
NC_000023.11:g.(?_31444481)_(31496944_?)del
NC_000023.11:g.(?_31478106)_(31932227_?)del
NC_000023.11:g.(?_31496768)_(31679606_?)dup
NC_000023.11:g.(?_31496768)_(31875393_?)del
NC_000023.11:g.(?_31496788)_(31875373_?)del
NC_000023.11:g.(?_31609584)_(31968514_?)del
NC_000023.11:g.(?_31609621)_(31774212_?)del
NC_000023.11:g.(?_31609621)_(31836839_?)del
NC_000023.11:g.(?_31609621)_(31875393_?)del
NC_000023.11:g.(?_31609621)_(31932247_?)del
NC_000023.11:g.(?_31609621)_(31968534_?)del
NC_000023.11:g.(?_31627653)_(31679606_?)del
NC_000023.11:g.(?_31627653)_(31820103_?)dup
NC_000023.11:g.(?_31627653)_(31932247_?)del
NC_000023.11:g.(?_31627653)_(31968534_?)del
NC_000023.11:g.(?_31657970)_(31774212_?)del
NC_000023.11:g.(?_31657990)_(31820083_?)del
NC_000023.11:g.(?_31657990)_(31836819_?)del
NC_000023.11:g.(?_31679355)_(31679606_?)del
NC_000023.11:g.(?_31679355)_(31875393_?)del
NC_000023.11:g.(?_31679355)_(31968534_?)del
NC_000023.11:g.(?_31729611)_(31774212_?)del
NC_000023.11:g.(?_31729611)_(31875393_?)dup
NC_000023.11:g.(?_31729611)_(31932247_?)del
NC_000023.11:g.(?_31729625)_(31774198_?)del
NC_000023.11:g.(?_31729631)_(31729748_?)del
NC_000023.11:g.(?_31729631)_(31820083_?)del
NC_000023.11:g.(?_31773940)_(31836839_?)del
NC_000023.11:g.(?_31773940)_(31968534_?)del
NC_000023.11:g.(?_31773940)_(32217083_?)del
NC_000023.11:g.(?_31773960)_(31774192_?)del
NC_000023.11:g.(?_31773960)_(31836819_?)del
NC_000023.11:g.(?_31819955)_(31820103_?)del
NC_000023.11:g.(?_31819955)_(31820103_?)dup
NC_000023.11:g.(?_31819955)_(31932247_?)del
NC_000023.11:g.(?_31819975)_(31836819_?)del
NC_000023.11:g.(?_31836698)_(31875393_?)del
NC_000023.11:g.(?_31836698)_(31932247_?)del
NC_000023.11:g.(?_31836698)_(32365219_?)del
NC_000023.11:g.(?_31875168)_(31875393_?)del
NC_000023.11:g.(?_31875168)_(31932247_?)del
NC_000023.11:g.(?_31875168)_(31968534_?)del
NC_000023.11:g.(?_31875168)_(32217083_?)dup
NC_000023.11:g.(?_31875168)_(33339285_?)del
NC_000023.11:g.(?_31929576)_(31929765_?)del
NC_000023.11:g.(?_31929576)_(32217083_?)del
NC_000023.11:g.(?_31929576)_(32365219_?)del
NC_000023.11:g.(?_31932060)_(31932247_?)del
NC_000023.11:g.(?_31932060)_(31968534_?)del
NC_000023.11:g.(?_31968319)_(31968534_?)del
NC_000023.11:g.(?_31968339)_(31968514_?)del
NC_000023.11:g.(?_32216896)_(32217083_?)del
NC_000023.11:g.(?_32216896)_(32365219_?)del
NC_000023.11:g.(?_32216896)_(32454852_?)del
NC_000023.11:g.(?_32216896)_(32472329_?)del
NC_000023.11:g.(?_32216896)_(32501862_?)del
NC_000023.11:g.(?_32216896)_(32651077_?)del
NC_000023.11:g.(?_32216896)_(32698018_?)del
NC_000023.11:g.(?_32216896)_(32849840_?)del
NC_000023.11:g.(?_32287509)_(32287721_?)del
NC_000023.11:g.(?_32287509)_(32362978_?)del
NC_000023.11:g.(?_32287509)_(32390201_?)del
NC_000023.11:g.(?_32287509)_(32491538_?)dup
NC_000023.11:g.(?_32287529)_(32310276_?)del
NC_000023.11:g.(?_32287529)_(32310276_?)dup
NC_000023.11:g.(?_32342080)_(32518151_?)del
NC_000023.11:g.(?_32362768)_(32699313_?)del
NC_000023.11:g.(?_32386290)_(32849840_?)del
NC_000023.11:g.(?_32411732)_(32573866_?)del
NC_000023.11:g.(?_32411732)_(32614473_?)del
NC_000023.11:g.(?_32438221)_(32614473_?)del
NC_000023.11:g.(?_32438221)_(32651077_?)del
NC_000023.11:g.(?_32438221)_(32699313_?)del
NC_000023.11:g.(?_32438221)_(32849840_?)del
NC_000023.11:g.(?_32438241)_(32491518_?)del
NC_000023.11:g.(?_32463439)_(32491518_?)dup
NC_000023.11:g.(?_32484899)_(32699313_?)del
NC_000023.11:g.(?_32501735)_(32501862_?)del
NC_000023.11:g.(?_32517988)_(33020220_?)dup
NC_000023.11:g.(?_32517988)_(33339285_?)del
NC_000023.11:g.(?_32545139)_(32573866_?)dup
NC_000023.11:g.(?_32545159)_(32849820_?)del
NC_000023.11:g.(?_32565702)_(32614453_?)dup
NC_000023.11:g.(?_32573530)_(32699293_?)del
NC_000023.11:g.(?_32595737)_(32699313_?)del
NC_000023.11:g.(?_32595737)_(32823850_?)del
NC_000023.11:g.(?_32595757)_(32849820_?)del
NC_000023.11:g.(?_32614283)_(32849840_?)del
NC_000023.11:g.(?_32644112)_(32651077_?)del
NC_000023.11:g.(?_32644112)_(32651077_?)dup
NC_000023.11:g.(?_32644132)_(32849820_?)del
NC_000023.11:g.(?_32697850)_(32699313_?)del
NC_000023.11:g.(?_32809473)_(32816660_?)del
NC_000023.11:g.(?_32809473)_(32823850_?)del
NC_000023.11:g.(?_32809473)_(32823850_?)dup
NC_000023.11:g.(?_32809473)_(32849840_?)del
NC_000023.11:g.(?_32809473)_(32849840_?)dup
NC_000023.11:g.(?_32809473)_(33020220_?)del
NC_000023.11:g.(?_32809493)_(33020200_?)dup
NC_000023.11:g.(?_32816448)_(32849840_?)del
NC_000023.11:g.(?_32823275)_(32823850_?)del
NC_000023.11:g.(?_32823275)_(32849840_?)del
NC_000023.11:g.(?_32844783)_(32849820_?)dup
NC_000023.11:g.(?_33014549)_(33020220_?)dup
NC_000023.11:g.(?_33020119)_(33020220_?)dup
NC_000023.11:g.(?_33211262)_(33211366_?)del
NM_000109.3(DMD):c.700C>T (p.Gln234Ter) rs128626238
NM_004006.2(DMD):c.10033C>T (p.Arg3345Ter) rs398123827
NM_004006.2(DMD):c.1006G>T (p.Glu336Ter)
NM_004006.2(DMD):c.10086+1G>A rs398123828
NM_004006.2(DMD):c.10101_10103delAGA (p.Glu3367del) rs886042840
NM_004006.2(DMD):c.10108C>T (p.Arg3370Ter) rs104894787
NM_004006.2(DMD):c.1012G>T (p.Glu338Ter) rs398123830
NM_004006.2(DMD):c.10133del (p.Asn3378Thrfs) rs863224975
NM_004006.2(DMD):c.10141C>T (p.Arg3381Ter) rs104894790
NM_004006.2(DMD):c.10171C>T (p.Arg3391Ter) rs398123832
NM_004006.2(DMD):c.10223+1G>C rs398123834
NM_004006.2(DMD):c.10224-175_10230del rs1556035817
NM_004006.2(DMD):c.10238delT (p.Ile3413Thrfs) rs1556035795
NM_004006.2(DMD):c.10247G>A (p.Trp3416Ter) rs201217593
NM_004006.2(DMD):c.10279C>T (p.Gln3427Ter) rs886042691
NM_004006.2(DMD):c.10367delA (p.Asn3456Metfs) rs1556028034
NM_004006.2(DMD):c.10406_10407insAA (p.His3469Glnfs) rs1060502630
NM_004006.2(DMD):c.10412T>G (p.Leu3471Ter) rs863224976
NM_004006.2(DMD):c.10446_10447delCT (p.Ser3483Profs) rs398123837
NM_004006.2(DMD):c.10453dup (p.Leu3485Profs) rs886043375
NM_004006.2(DMD):c.10454delT (p.Leu3485Argfs) rs398123839
NM_004006.2(DMD):c.1048G>T (p.Glu350Ter) rs398123840
NM_004006.2(DMD):c.10504G>T (p.Glu3502Ter) rs863224977
NM_004006.2(DMD):c.10554-2A>G rs794727890
NM_004006.2(DMD):c.10572T>A (p.Tyr3524Ter) rs886043817
NM_004006.2(DMD):c.1061G>A (p.Trp354Ter) rs1060502644
NM_004006.2(DMD):c.10625delC (p.Pro3542Leufs) rs398123844
NM_004006.2(DMD):c.1070delC (p.Ser357Leufs) rs794726994
NM_004006.2(DMD):c.10725delG (p.Met3576Cysfs) rs1060502625
NM_004006.2(DMD):c.1075G>T (p.Glu359Ter) rs1556876346
NM_004006.2(DMD):c.10783C>T (p.Gln3595Ter) rs1385794215
NM_004006.2(DMD):c.10797+5G>A rs398123846
NM_004006.2(DMD):c.1150-2del rs863224978
NM_004006.2(DMD):c.1261C>T (p.Gln421Ter) rs398123852
NM_004006.2(DMD):c.1286C>A (p.Ser429Ter) rs398123853
NM_004006.2(DMD):c.1286C>G (p.Ser429Ter) rs398123853
NM_004006.2(DMD):c.1292G>A (p.Trp431Ter) rs1556875224
NM_004006.2(DMD):c.1306dupG (p.Val436Glyfs) rs398123854
NM_004006.2(DMD):c.1324C>T (p.Gln442Ter) rs863224979
NM_004006.2(DMD):c.1331+1G>A rs863224980
NM_004006.2(DMD):c.1332-9A>G rs72468700
NM_004006.2(DMD):c.1366A>T (p.Lys456Ter) rs1556853298
NM_004006.2(DMD):c.1371delG (p.Glu459Serfs) rs398123857
NM_004006.2(DMD):c.137_138dupAT (p.Gly47Metfs) rs398123859
NM_004006.2(DMD):c.1388G>A (p.Trp463Ter) rs863224981
NM_004006.2(DMD):c.141dup (p.Arg48Glufs)
NM_004006.2(DMD):c.1476delA (p.Gln492Hisfs) rs1556853039
NM_004006.2(DMD):c.1483-1G>C rs863224982
NM_004006.2(DMD):c.1489C>T (p.Gln497Ter) rs128626241
NM_004006.2(DMD):c.14_15delAAinsT (p.Glu5Valfs) rs796065325
NM_004006.2(DMD):c.1504C>T (p.Gln502Ter) rs878854618
NM_004006.2(DMD):c.1529_1530delTC (p.Leu510Hisfs) rs398123863
NM_004006.2(DMD):c.153dupA (p.Asp52Argfs) rs1557084128
NM_004006.2(DMD):c.1577delC (p.Thr526Metfs)
NM_004006.2(DMD):c.1615C>T (p.Arg539Ter) rs398123865
NM_004006.2(DMD):c.1619G>A (p.Trp540Ter)
NM_004006.2(DMD):c.161T>G (p.Leu54Arg) rs128626231
NM_004006.2(DMD):c.1652G>A (p.Trp551Ter)
NM_004006.2(DMD):c.1653G>A (p.Trp551Ter) rs1060502629
NM_004006.2(DMD):c.1663C>T (p.Gln555Ter) rs863224983
NM_004006.2(DMD):c.1683G>A (p.Trp561Ter) rs863224984
NM_004006.2(DMD):c.1704+1G>A rs794727123
NM_004006.2(DMD):c.1705-1G>T rs878854619
NM_004006.2(DMD):c.178C>T (p.Gln60Ter) rs128626233
NM_004006.2(DMD):c.1795delA (p.Ser599Valfs) rs1556809704
NM_004006.2(DMD):c.1812+1G>A rs373286166
NM_004006.2(DMD):c.186+1G>A rs1557084067
NM_004006.2(DMD):c.1865C>A (p.Ser622Ter) rs886041344
NM_004006.2(DMD):c.1886C>A (p.Ser629Ter) rs398123867
NM_004006.2(DMD):c.1952G>A (p.Trp651Ter) rs128626242
NM_004006.2(DMD):c.1956delT (p.Asp652Glufs) rs886043640
NM_004006.2(DMD):c.1990C>T (p.Gln664Ter) rs398123870
NM_004006.2(DMD):c.1992+1G>T rs1556802319
NM_004006.2(DMD):c.19delG (p.Val7Terfs) rs1557300135
NM_004006.2(DMD):c.2017C>T (p.Gln673Ter) rs128626232
NM_004006.2(DMD):c.2032C>T (p.Gln678Ter) rs398123872
NM_004006.2(DMD):c.2076dupA (p.Gln693Thrfs) rs1060502635
NM_004006.2(DMD):c.2077C>T (p.Gln693Ter) rs1060502661
NM_004006.2(DMD):c.2125delC (p.Gln709Lysfs) rs398123875
NM_004006.2(DMD):c.2168+1G>A rs1057518207
NM_004006.2(DMD):c.2202G>A (p.Trp734Ter) rs1060502636
NM_004006.2(DMD):c.2215G>T (p.Glu739Ter) rs863224985
NM_004006.2(DMD):c.2276T>A (p.Leu759Ter) rs1060502627
NM_004006.2(DMD):c.2294_2297delCCAT (p.Ala765Glufs) rs398123882
NM_004006.2(DMD):c.2302C>T (p.Arg768Ter) rs201366610
NM_004006.2(DMD):c.2308A>T (p.Lys770Ter) rs128626243
NM_004006.2(DMD):c.2314G>T (p.Glu772Ter) rs267606770
NM_004006.2(DMD):c.2316_2317delGA (p.Lys773Valfs) rs886042437
NM_004006.2(DMD):c.2317A>G (p.Lys773Glu) rs128626244
NM_004006.2(DMD):c.2332C>T (p.Gln778Ter) rs398123883
NM_004006.2(DMD):c.2368C>T (p.Gln790Ter) rs762860653
NM_004006.2(DMD):c.2380+1G>C rs398123884
NM_004006.2(DMD):c.238dupG (p.Ala80Glyfs) rs1557079469
NM_004006.2(DMD):c.2407C>T (p.Gln803Ter) rs863224986
NM_004006.2(DMD):c.253C>T (p.Gln85Ter) rs128626234
NM_004006.2(DMD):c.2547delT (p.Glu850Lysfs) rs398123895
NM_004006.2(DMD):c.2611A>T (p.Lys871Ter) rs863224987
NM_004006.2(DMD):c.2622+1G>A rs398123901
NM_004006.2(DMD):c.2623-3C>G rs863224988
NM_004006.2(DMD):c.2638delC (p.Leu880Tyrfs) rs1557380685
NM_004006.2(DMD):c.265-2A>G rs863224989
NM_004006.2(DMD):c.2650C>T (p.Gln884Ter) rs398123903
NM_004006.2(DMD):c.2665C>T (p.Arg889Ter) rs1060502639
NM_004006.2(DMD):c.2669T>A (p.Leu890Ter) rs1557380616
NM_004006.2(DMD):c.2733dupT (p.Val912Cysfs) rs1557380496
NM_004006.2(DMD):c.2776C>T (p.Gln926Ter) rs1055371114
NM_004006.2(DMD):c.2791G>T (p.Glu931Ter) rs128625227
NM_004006.2(DMD):c.2797C>T (p.Gln933Ter) rs756949497
NM_004006.2(DMD):c.2804-1G>A rs398123909
NM_004006.2(DMD):c.2804-1G>T rs398123909
NM_004006.2(DMD):c.2804-1delG rs1557374667
NM_004006.2(DMD):c.2804-2A>C rs794727357
NM_004006.2(DMD):c.2804-2A>T rs794727357
NM_004006.2(DMD):c.280del (p.Ile94Leufs) rs863224990
NM_004006.2(DMD):c.2815_2816delTT (p.Leu939Alafs) rs794727358
NM_004006.2(DMD):c.2816T>A (p.Leu939Ter) rs398123910
NM_004006.2(DMD):c.282dup (p.Gly95Trpfs) rs863224991
NM_004006.2(DMD):c.28delT (p.Cys10Valfs) rs398123913
NM_004006.2(DMD):c.2949+1G>A rs1557374482
NM_004006.2(DMD):c.2991C>G (p.Tyr997Ter) rs863224992
NM_004006.2(DMD):c.3020C>A (p.Ser1007Ter)
NM_004006.2(DMD):c.31+1G>T rs398123923
NM_004006.2(DMD):c.31+36947G>A rs886042106
NM_004006.2(DMD):c.3121C>T (p.Gln1041Ter) rs128626245
NM_004006.2(DMD):c.3151C>T (p.Arg1051Ter) rs398123929
NM_004006.2(DMD):c.3188G>A (p.Trp1063Ter) rs128626246
NM_004006.2(DMD):c.32-?_93+?dup62
NM_004006.2(DMD):c.3268C>T (p.Gln1090Ter) rs1557369991
NM_004006.2(DMD):c.3276+1G>A rs398123934
NM_004006.2(DMD):c.3295C>T (p.Gln1099Ter) rs398123935
NM_004006.2(DMD):c.3358G>T (p.Glu1120Ter)
NM_004006.2(DMD):c.336G>A (p.Trp112Ter) rs398123936
NM_004006.2(DMD):c.3388_3389dup (p.Leu1131Asnfs) rs1557369413
NM_004006.2(DMD):c.3413G>A (p.Trp1138Ter) rs886044406
NM_004006.2(DMD):c.3427C>T (p.Gln1143Ter) rs863224993
NM_004006.2(DMD):c.3432+1G>A rs398123937
NM_004006.2(DMD):c.3432+3A>G rs398123938
NM_004006.2(DMD):c.3433-5_3434del rs863224994
NM_004006.2(DMD):c.3469G>T (p.Glu1157Ter) rs128625226
NM_004006.2(DMD):c.3535G>T (p.Glu1179Ter) rs794727422
NM_004006.2(DMD):c.355C>T (p.Gln119Ter) rs863224995
NM_004006.2(DMD):c.356delA (p.Gln119Argfs) rs1557058308
NM_004006.2(DMD):c.358-1G>A rs886044582
NM_004006.2(DMD):c.358-2A>G rs863224996
NM_004006.2(DMD):c.3580C>T (p.Gln1194Ter) rs398123942
NM_004006.2(DMD):c.3603+2T>G
NM_004006.2(DMD):c.3603+3A>T rs1060502615
NM_004006.2(DMD):c.3604-1G>C
NM_004006.2(DMD):c.3639dupA (p.Val1214Serfs) rs398123943
NM_004006.2(DMD):c.3679C>T (p.Gln1227Ter)
NM_004006.2(DMD):c.3713delA (p.Lys1238Argfs) rs1557362198
NM_004006.2(DMD):c.3742C>T (p.Gln1248Ter)
NM_004006.2(DMD):c.3747delG (p.Trp1249Cysfs) rs398123945
NM_004006.2(DMD):c.3779_3785delCTTTGGAinsGG (p.Thr1260Argfs) rs398123946
NM_004006.2(DMD):c.377delA (p.Asn126Ilefs)
NM_004006.2(DMD):c.3817delT (p.Ser1273Hisfs) rs1557359217
NM_004006.2(DMD):c.3940C>T (p.Arg1314Ter) rs5030730
NM_004006.2(DMD):c.4000G>T (p.Gly1334Ter) rs146880270
NM_004006.2(DMD):c.4071+1G>A rs1060502643
NM_004006.2(DMD):c.40_41delGA (p.Glu14Argfs) rs1060502652
NM_004006.2(DMD):c.4117C>T (p.Gln1373Ter) rs398123948
NM_004006.2(DMD):c.412_413delAA (p.Lys138Aspfs) rs398123949
NM_004006.2(DMD):c.415_428delATTCTCCTGAGCTG (p.Ile139Glyfs) rs794727795
NM_004006.2(DMD):c.4213C>T (p.Gln1405Ter) rs128626247
NM_004006.2(DMD):c.4231C>T (p.Gln1411Ter) rs1010666282
NM_004006.2(DMD):c.4240C>T (p.Gln1414Ter) rs863224997
NM_004006.2(DMD):c.4315A>T (p.Arg1439Ter) rs794727550
NM_004006.2(DMD):c.433C>T (p.Arg145Ter) rs128626235
NM_004006.2(DMD):c.4375C>T (p.Arg1459Ter) rs398123953
NM_004006.2(DMD):c.4414C>T (p.Gln1472Ter) rs128626248
NM_004006.2(DMD):c.4471_4472delAA (p.Lys1491Glufs) rs398123957
NM_004006.2(DMD):c.4483C>T (p.Gln1495Ter) rs748769566
NM_004006.2(DMD):c.4486G>T (p.Glu1496Ter)
NM_004006.2(DMD):c.4501C>T (p.Gln1501Ter) rs1557322201
NM_004006.2(DMD):c.4518+5G>A rs398123960
NM_004006.2(DMD):c.4523delT (p.Leu1508Cysfs) rs794727567
NM_004006.2(DMD):c.4534_4535delCT (p.Leu1512Glufs) rs398123961
NM_004006.2(DMD):c.4545_4549delGAAGT (p.Lys1516Terfs) rs398123962
NM_004006.2(DMD):c.4606G>T (p.Glu1536Ter) rs863224998
NM_004006.2(DMD):c.4675-2A>G rs794727575
NM_004006.2(DMD):c.4729C>T (p.Arg1577Ter) rs863224999
NM_004006.2(DMD):c.478_479insAC (p.Thr160Asnfs) rs1557052560
NM_004006.2(DMD):c.4843A>T (p.Lys1615Ter) rs398123969
NM_004006.2(DMD):c.4858G>T (p.Glu1620Ter) rs1060502645
NM_004006.2(DMD):c.4870C>T (p.Gln1624Ter) rs762250680
NM_004006.2(DMD):c.4918_4919delACinsTG (p.Thr1640Ter) rs1557305645
NM_004006.2(DMD):c.4918del (p.Thr1640Glnfs) rs863225000
NM_004006.2(DMD):c.4934_4937delAGGA (p.Lys1645Argfs) rs1060502632
NM_004006.2(DMD):c.4996C>T (p.Arg1666Ter) rs398123973
NM_004006.2(DMD):c.5097_5098delCAinsATGAATGAATTCATT (p.Asp1699Glufs) rs398123978
NM_004006.2(DMD):c.5100_5101delAC (p.Leu1701Phefs) rs1060502647
NM_004006.2(DMD):c.5110G>T (p.Glu1704Ter) rs765445866
NM_004006.2(DMD):c.5124_5127delGAAA (p.Lys1708Asnfs) rs398123979
NM_004006.2(DMD):c.5131C>T (p.Gln1711Ter) rs863225001
NM_004006.2(DMD):c.5139delA (p.Glu1714Lysfs) rs1557304860
NM_004006.2(DMD):c.5140G>T (p.Glu1714Ter) rs886042747
NM_004006.2(DMD):c.5266C>T (p.Gln1756Ter) rs1557303544
NM_004006.2(DMD):c.5287C>T (p.Arg1763Ter) rs398123981
NM_004006.2(DMD):c.531-1G>C
NM_004006.2(DMD):c.5324_5325delAGinsGT (p.Lys1775Ser) rs1557303381
NM_004006.2(DMD):c.5350G>T (p.Glu1784Ter) rs777864641
NM_004006.2(DMD):c.5360dupA (p.Asn1787Lysfs) rs1557294296
NM_004006.2(DMD):c.5455_5459dup (p.Asn1820Lysfs)
NM_004006.2(DMD):c.5461G>T (p.Glu1821Ter) rs863225002
NM_004006.2(DMD):c.547dup (p.Trp183Leufs) rs796065333
NM_004006.2(DMD):c.5487_5488delAA (p.Gly1831Argfs)
NM_004006.2(DMD):c.5506C>T (p.Gln1836Ter) rs770845480
NM_004006.2(DMD):c.5530C>T (p.Arg1844Ter) rs1064325
NM_004006.2(DMD):c.5551C>T (p.Gln1851Ter) rs128625228
NM_004006.2(DMD):c.5554C>T (p.Gln1852Ter) rs398123991
NM_004006.2(DMD):c.5602A>T (p.Arg1868Ter) rs1557291229
NM_004006.2(DMD):c.5602_5605del (p.Arg1868Glufs) rs863225003
NM_004006.2(DMD):c.5613_5640delGGCTCTAGAAATTTCTCATCAGTGGTAT (p.Lys1871Asnfs) rs1557291170
NM_004006.2(DMD):c.5640T>A (p.Tyr1880Ter) rs398123993
NM_004006.2(DMD):c.5641C>T (p.Gln1881Ter) rs863225004
NM_004006.2(DMD):c.5647A>T (p.Lys1883Ter) rs1060502623
NM_004006.2(DMD):c.5652delG (p.Arg1884Serfs) rs1057518692
NM_004006.2(DMD):c.565C>T (p.Gln189Ter) rs794727861
NM_004006.2(DMD):c.5697delA (p.Lys1899Asnfs) rs794727661
NM_004006.2(DMD):c.5773G>T (p.Glu1925Ter) rs398123997
NM_004006.2(DMD):c.583C>T (p.Arg195Ter) rs398123999
NM_004006.2(DMD):c.5851C>T (p.Gln1951Ter) rs773643220
NM_004006.2(DMD):c.5884_5891delAAATTTGC (p.Lys1962Serfs) rs1060502646
NM_004006.2(DMD):c.5899C>T (p.Arg1967Ter) rs128626249
NM_004006.2(DMD):c.5917C>T (p.Gln1973Ter) rs863225005
NM_004006.2(DMD):c.5938G>T (p.Glu1980Ter) rs398124001
NM_004006.2(DMD):c.5985T>G (p.Tyr1995Ter) rs128627257
NM_004006.2(DMD):c.6000T>A (p.Tyr2000Ter) rs398124002
NM_004006.2(DMD):c.6072T>A (p.Cys2024Ter) rs373804251
NM_004006.2(DMD):c.6118-1G>A rs1060502656
NM_004006.2(DMD):c.6128_6131del (p.Asp2043Valfs) rs863225006
NM_004006.2(DMD):c.615T>A (p.Tyr205Ter) rs398124004
NM_004006.2(DMD):c.6182delC (p.Ala2061Glufs) rs398124005
NM_004006.2(DMD):c.6205delG (p.Val2069Trpfs) rs1060502640
NM_004006.2(DMD):c.6251_6290+12981del
NM_004006.2(DMD):c.6292C>T (p.Arg2098Ter) rs128626250
NM_004006.2(DMD):c.630delG (p.Lys211Asnfs) rs1557047827
NM_004006.2(DMD):c.6373C>T (p.Gln2125Ter) rs128626251
NM_004006.2(DMD):c.6391_6392delCA (p.Gln2131Asnfs) rs398124012
NM_004006.2(DMD):c.6408G>A (p.Trp2136Ter) rs1557218131
NM_004006.2(DMD):c.6424A>T (p.Lys2142Ter) rs1557218076
NM_004006.2(DMD):c.649+1G>A rs398124032
NM_004006.2(DMD):c.650-1828_770del
NM_004006.2(DMD):c.6502G>T (p.Glu2168Ter) rs779739455
NM_004006.2(DMD):c.656dup (p.Asp219Glufs) rs1556930839
NM_004006.2(DMD):c.6611dupA (p.Arg2205Glufs) rs863225007
NM_004006.2(DMD):c.6614+2T>C rs1060502641
NM_004006.2(DMD):c.6615-2A>T rs1557011973
NM_004006.2(DMD):c.6662delA (p.Asn2221Metfs) rs1060502620
NM_004006.2(DMD):c.6673_6674insGTTT (p.Leu2225Cysfs) rs797044743
NM_004006.2(DMD):c.676_678delAAG (p.Lys226del) rs398124034
NM_004006.2(DMD):c.6790C>T (p.Gln2264Ter) rs128626252
NM_004006.2(DMD):c.686T>G (p.Leu229Ter) rs1556930769
NM_004006.2(DMD):c.6906G>A (p.Trp2302Ter) rs398124036
NM_004006.2(DMD):c.6955C>T (p.Gln2319Ter) rs128625230
NM_004006.2(DMD):c.6986delA (p.Lys2329Serfs) rs398124040
NM_004006.2(DMD):c.6986dupA (p.Leu2330Alafs) rs398124040
NM_004006.2(DMD):c.699_703dup (p.Leu235Hisfs)
NM_004006.2(DMD):c.7068_7069delAC (p.Gln2356Hisfs) rs1060502659
NM_004006.2(DMD):c.7098+1G>T rs1556962223
NM_004006.2(DMD):c.7105G>T (p.Glu2369Ter) rs863225008
NM_004006.2(DMD):c.7189C>T (p.Gln2397Ter) rs398124042
NM_004006.2(DMD):c.7241_7243delACCinsGTTT (p.Asn2414Serfs) rs1064792967
NM_004006.2(DMD):c.7247T>A (p.Leu2416Ter)
NM_004006.2(DMD):c.7252C>T (p.Gln2418Ter)
NM_004006.2(DMD):c.7268delA (p.Lys2423Serfs) rs1556917057
NM_004006.2(DMD):c.7295_7296delCC (p.Thr2432Asnfs) rs794727746
NM_004006.2(DMD):c.7309+1G>A rs398124044
NM_004006.2(DMD):c.7310-1G>A rs1556880354
NM_004006.2(DMD):c.7402G>T (p.Glu2468Ter) rs128626253
NM_004006.2(DMD):c.748G>T (p.Glu250Ter) rs128626239
NM_004006.2(DMD):c.7657C>T (p.Arg2553Ter) rs398124050
NM_004006.2(DMD):c.7661-2A>G rs1556806356
NM_004006.2(DMD):c.7661-?_10921+?del
NM_004006.2(DMD):c.7672C>T (p.Gln2558Ter) rs398124051
NM_004006.2(DMD):c.7682G>A (p.Trp2561Ter) rs398124052
NM_004006.2(DMD):c.7683G>A (p.Trp2561Ter) rs398124053
NM_004006.2(DMD):c.7755G>A (p.Trp2585Ter) rs762394978
NM_004006.2(DMD):c.7771G>T (p.Glu2591Ter) rs398124055
NM_004006.2(DMD):c.7781delA (p.Gln2594Argfs) rs878854621
NM_004006.2(DMD):c.7817G>A (p.Trp2606Ter) rs863225009
NM_004006.2(DMD):c.7894C>T (p.Gln2632Ter) rs398124058
NM_004006.2(DMD):c.7922delA (p.Asn2641Metfs) rs398124059
NM_004006.2(DMD):c.8027+1G>A rs1556789913
NM_004006.2(DMD):c.8027+2T>A rs863225010
NM_004006.2(DMD):c.8038C>T (p.Arg2680Ter) rs863225011
NM_004006.2(DMD):c.8064_8065delTA (p.His2688Glnfs) rs398124060
NM_004006.2(DMD):c.8066_8070delGATTA (p.Arg2689Thrfs) rs1556764934
NM_004006.2(DMD):c.8069T>G (p.Leu2690Ter) rs398124061
NM_004006.2(DMD):c.8096_8112delAAAAGTTTCTTGCCTGG (p.Glu2699Alafs) rs1556764880
NM_004006.2(DMD):c.8209C>T (p.Gln2737Ter) rs1060502621
NM_004006.2(DMD):c.831+1G>A rs1239018406
NM_004006.2(DMD):c.8357G>A (p.Trp2786Ter) rs863225012
NM_004006.2(DMD):c.8374_8375delAA (p.Lys2792Valfs) rs398124070
NM_004006.2(DMD):c.8390+2T>C rs863225013
NM_004006.2(DMD):c.8443C>T (p.Gln2815Ter) rs398124072
NM_004006.2(DMD):c.8579delC (p.Pro2860Leufs) rs1556656847
NM_004006.2(DMD):c.857dup (p.Tyr286Terfs) rs1556929259
NM_004006.2(DMD):c.8604dup (p.Val2869Cysfs) rs1556656818
NM_004006.2(DMD):c.8608C>T (p.Arg2870Ter) rs398124074
NM_004006.2(DMD):c.8652_8653delCT (p.Tyr2885Profs) rs398124075
NM_004006.2(DMD):c.8655C>A (p.Tyr2885Ter)
NM_004006.2(DMD):c.8656C>T (p.Gln2886Ter) rs201361100
NM_004006.2(DMD):c.8675delC (p.Pro2892Leufs) rs1556656487
NM_004006.2(DMD):c.8683dup (p.Glu2895Glyfs) rs1556656456
NM_004006.2(DMD):c.8713C>T (p.Arg2905Ter) rs128627256
NM_004006.2(DMD):c.8912_8913delTC (p.Leu2971Profs) rs398124078
NM_004006.2(DMD):c.8914C>T (p.Gln2972Ter) rs1060502633
NM_004006.2(DMD):c.8944C>T (p.Arg2982Ter) rs128625229
NM_004006.2(DMD):c.8970_8971delGA (p.Asn2991Argfs) rs863225014
NM_004006.2(DMD):c.9040dupC (p.Leu3014Profs) rs1556641290
NM_004006.2(DMD):c.9100C>T (p.Arg3034Ter)
NM_004006.2(DMD):c.9125delA (p.His3042Profs) rs398124080
NM_004006.2(DMD):c.9183G>A (p.Trp3061Ter) rs1556503937
NM_004006.2(DMD):c.918T>A (p.Tyr306Ter)
NM_004006.2(DMD):c.9197C>A (p.Ser3066Ter) rs128626254
NM_004006.2(DMD):c.9204_9207delCAAA (p.Asn3068Lysfs) rs863225015
NM_004006.2(DMD):c.9224+1G>A
NM_004006.2(DMD):c.9225-647A>G rs398124091
NM_004006.2(DMD):c.9238_9241delACAA (p.Thr3080Leufs) rs1060502624
NM_004006.2(DMD):c.93+1G>A rs886042604
NM_004006.2(DMD):c.9337C>T (p.Arg3113Ter) rs398124092
NM_004006.2(DMD):c.9361+1G>A rs398124094
NM_004006.2(DMD):c.9361+1G>C rs398124094
NM_004006.2(DMD):c.94-?_4233+?del
NM_004006.2(DMD):c.9434delT (p.Met3145Argfs) rs1060502648
NM_004006.2(DMD):c.9551dup (p.Asn3184Lysfs) rs863225017
NM_004006.2(DMD):c.9563+1G>A rs886043989
NM_004006.2(DMD):c.9564-1G>A rs398124096
NM_004006.2(DMD):c.9568C>T (p.Arg3190Ter) rs104894797
NM_004006.2(DMD):c.961-5831C>T rs398124099
NM_004006.2(DMD):c.9621T>A (p.Cys3207Ter) rs1057524037
NM_004006.2(DMD):c.9649+1G>A rs1556256329
NM_004006.2(DMD):c.9650-2A>G rs398124100
NM_004006.2(DMD):c.9854_9863delTGAGACTGGA (p.Met3285Asnfs) rs398124105
NM_004006.2(DMD):c.9862G>T (p.Glu3288Ter) rs398124106
NM_004006.2(DMD):c.9881_9890delGGCTGCCCGT (p.Trp3294Serfs) rs1556046080
NM_004006.2(DMD):c.9928C>T (p.Gln3310Ter) rs104894789
NM_004006.2(DMD):c.9938_9941dup (p.Asn3314Lysfs) rs863225018
NM_004006.2(DMD):c.9975-1G>A rs1556040444
NM_004006.2(DMD):c.9975-2A>C rs886044502
NM_004006.2(DMD):c.9G>A (p.Trp3Ter) rs398122853
NM_004019.2(DMD):c.1020G>A (p.Thr340=) rs398123834

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.