ClinVar Miner

List of variants in gene PRNP studied for Huntington disease-like 1

Included ClinVar conditions (1):
Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 12
Download table as spreadsheet
NM_000311.3(PRNP):c.204_227del24 (p.Pro84_Gln91del) rs193922906
NM_000311.4(PRNP):c.160_183GGTGGTGGCTGGGGGCAGCCTCAT(4) (p.Gln59_Pro60insGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGln) rs193922906
NM_000311.4(PRNP):c.593T>C (p.Phe198Ser) rs74315405
NM_000311.5(PRNP):c.160G>A (p.Gly54Ser) rs763524380
NM_000311.5(PRNP):c.228C>T (p.Pro76=) rs112637437
NM_000311.5(PRNP):c.246A>G (p.Gly82=) rs62643364
NM_000311.5(PRNP):c.246_269del (p.60_67PHGGGWGQ[3]) rs138688873
NM_000311.5(PRNP):c.351A>G (p.Ala117=) rs8124214
NM_000311.5(PRNP):c.462G>A (p.Met154Ile)
NM_000311.5(PRNP):c.512A>G (p.Asn171Ser) rs16990018
NM_000311.5(PRNP):c.598G>A (p.Glu200Lys) rs28933385
NM_000311.5(PRNP):c.628G>A (p.Val210Ile) rs74315407

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.