ClinVar Miner

List of variants in gene KRT10 studied for congenital reticular ichthyosiform erythroderma

Included ClinVar conditions (3):
Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 16
Download table as spreadsheet
HGVS dbSNP gnomAD frequency
NM_000421.5(KRT10):c.1459C>T (p.His487Tyr) rs17855579 0.74556
NM_000421.5(KRT10):c.376G>A (p.Gly126Ser) rs77919366 0.17640
NM_000421.5(KRT10):c.1373+1G>A rs587776816
NM_000421.5(KRT10):c.1373+1del rs2143133654
NM_000421.5(KRT10):c.1374-1G>A
NM_000421.5(KRT10):c.1374-1G>C rs2143131560
NM_000421.5(KRT10):c.1374-2A>G rs587776815
NM_000421.5(KRT10):c.1403_1417delinsA (p.Ser468fs) rs2143130756
NM_000421.5(KRT10):c.1449dup (p.Gly484fs) rs587776817
NM_000421.5(KRT10):c.1560_1561del (p.Gly521fs) rs267607384
NM_000421.5(KRT10):c.1654AGCTCCGGCGGCGGATACGGCGGCGGCAGC[3] (p.556GYGGGSSSGG[3]) rs776920005
NM_000421.5(KRT10):c.1654_1683dup (p.Gly556_Gly565dup) rs776920005
NM_000421.5(KRT10):c.1749-10A>G
NM_000421.5(KRT10):c.466C>T (p.Arg156Cys) rs58852768
NM_000421.5(KRT10):c.470T>C (p.Leu157Pro) rs2143150768
NM_000421.5(KRT10):c.49GGA[9] (p.Gly24dup) rs148510452

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.