ClinVar Miner

List of variants in gene LPIN2 studied for Majeed syndrome

Included ClinVar conditions (1):
Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 191
Download table as spreadsheet
HGVS dbSNP
NC_000018.9:g.(?_2920271)_(2960858_?)del
NC_000018.9:g.(?_2920271)_(2960858_?)dup
NM_014646.2(LPIN2):c.*1021G>A rs886053751
NM_014646.2(LPIN2):c.*1026C>T rs529650414
NM_014646.2(LPIN2):c.*1027G>A rs551503883
NM_014646.2(LPIN2):c.*1052T>C rs59566682
NM_014646.2(LPIN2):c.*1077C>G rs563088438
NM_014646.2(LPIN2):c.*1126G>A rs886053750
NM_014646.2(LPIN2):c.*1179G>A rs147362027
NM_014646.2(LPIN2):c.*1220G>A rs886053749
NM_014646.2(LPIN2):c.*1418G>A rs552844041
NM_014646.2(LPIN2):c.*1462A>G rs560770304
NM_014646.2(LPIN2):c.*1502G>A rs113346639
NM_014646.2(LPIN2):c.*1514G>A rs544570644
NM_014646.2(LPIN2):c.*1514G>C rs544570644
NM_014646.2(LPIN2):c.*151G>A rs571000282
NM_014646.2(LPIN2):c.*1559A>G rs886053748
NM_014646.2(LPIN2):c.*1586G>A rs144299426
NM_014646.2(LPIN2):c.*158G>A rs547872442
NM_014646.2(LPIN2):c.*1622T>C rs111366726
NM_014646.2(LPIN2):c.*1691A>G rs112588494
NM_014646.2(LPIN2):c.*1742A>G rs551448975
NM_014646.2(LPIN2):c.*1827G>A rs886053747
NM_014646.2(LPIN2):c.*1874C>G rs75771450
NM_014646.2(LPIN2):c.*2076C>A rs112529707
NM_014646.2(LPIN2):c.*2103G>A rs561577089
NM_014646.2(LPIN2):c.*217G>T rs886053763
NM_014646.2(LPIN2):c.*2197_*2198delTT rs55834965
NM_014646.2(LPIN2):c.*2216C>A rs886053746
NM_014646.2(LPIN2):c.*2241T>C rs16944033
NM_014646.2(LPIN2):c.*2390C>T rs555969171
NM_014646.2(LPIN2):c.*2412C>T rs553336397
NM_014646.2(LPIN2):c.*2493C>G rs8091401
NM_014646.2(LPIN2):c.*251C>T rs563023966
NM_014646.2(LPIN2):c.*252G>A rs886053762
NM_014646.2(LPIN2):c.*2691_*2696delGAAAAA rs777601819
NM_014646.2(LPIN2):c.*2724A>G rs886053744
NM_014646.2(LPIN2):c.*2759A>C rs886053743
NM_014646.2(LPIN2):c.*275C>G rs886053761
NM_014646.2(LPIN2):c.*2787C>G rs886053742
NM_014646.2(LPIN2):c.*2822C>T rs73375246
NM_014646.2(LPIN2):c.*2830C>T rs886053741
NM_014646.2(LPIN2):c.*2833_*2834delCA rs886053740
NM_014646.2(LPIN2):c.*2866A>C rs17880885
NM_014646.2(LPIN2):c.*2890_*2893dupTTTC rs540600202
NM_014646.2(LPIN2):c.*2923C>T rs202079191
NM_014646.2(LPIN2):c.*2924delC rs148191039
NM_014646.2(LPIN2):c.*2934C>T rs7980
NM_014646.2(LPIN2):c.*2946G>A rs4781
NM_014646.2(LPIN2):c.*2999C>A rs138807947
NM_014646.2(LPIN2):c.*3015T>C rs14916
NM_014646.2(LPIN2):c.*3068A>T rs1985
NM_014646.2(LPIN2):c.*3139A>G rs1164
NM_014646.2(LPIN2):c.*3217A>G rs767074158
NM_014646.2(LPIN2):c.*3280C>T rs751266426
NM_014646.2(LPIN2):c.*358G>A rs184193388
NM_014646.2(LPIN2):c.*362T>C rs886053760
NM_014646.2(LPIN2):c.*3C>T rs3745012
NM_014646.2(LPIN2):c.*448C>T rs886053759
NM_014646.2(LPIN2):c.*493G>A rs886053758
NM_014646.2(LPIN2):c.*501T>C rs35176958
NM_014646.2(LPIN2):c.*506C>T rs886053757
NM_014646.2(LPIN2):c.*507T>C rs886053756
NM_014646.2(LPIN2):c.*557G>A rs112795993
NM_014646.2(LPIN2):c.*637G>A rs118142692
NM_014646.2(LPIN2):c.*657A>C rs16944040
NM_014646.2(LPIN2):c.*666C>T rs186189096
NM_014646.2(LPIN2):c.*685T>A rs607549
NM_014646.2(LPIN2):c.*703dupG rs200435334
NM_014646.2(LPIN2):c.*723A>G rs76325993
NM_014646.2(LPIN2):c.*725G>A rs886053755
NM_014646.2(LPIN2):c.*767A>G rs886053754
NM_014646.2(LPIN2):c.*792G>C rs542453339
NM_014646.2(LPIN2):c.*796T>C rs567530586
NM_014646.2(LPIN2):c.*797T>G rs3810064
NM_014646.2(LPIN2):c.*805C>G rs146605124
NM_014646.2(LPIN2):c.*813A>C rs547125074
NM_014646.2(LPIN2):c.*823G>A rs747730329
NM_014646.2(LPIN2):c.*833G>A rs540627141
NM_014646.2(LPIN2):c.*834G>A rs886053753
NM_014646.2(LPIN2):c.*84A>G rs886053764
NM_014646.2(LPIN2):c.*897T>G rs886053752
NM_014646.2(LPIN2):c.*903T>A rs78462116
NM_014646.2(LPIN2):c.*947dupA rs3840906
NM_014646.2(LPIN2):c.*950A>C rs3810065
NM_014646.2(LPIN2):c.*99C>T rs143728428
NM_014646.2(LPIN2):c.-10+12T>C rs566304730
NM_014646.2(LPIN2):c.-125G>A rs886053770
NM_014646.2(LPIN2):c.-160C>T rs762246311
NM_014646.2(LPIN2):c.-173A>T rs112648131
NM_014646.2(LPIN2):c.-192C>T rs765741319
NM_014646.2(LPIN2):c.-209G>A rs751000184
NM_014646.2(LPIN2):c.-25A>G rs886053769
NM_014646.2(LPIN2):c.-36C>G rs58940048
NM_014646.2(LPIN2):c.-37C>G rs59096963
NM_014646.2(LPIN2):c.-66C>T rs116643915
NM_014646.2(LPIN2):c.1043C>T (p.Pro348Leu) rs34676691
NM_014646.2(LPIN2):c.106G>A (p.Val36Ile)
NM_014646.2(LPIN2):c.1082C>T (p.Ala361Val)
NM_014646.2(LPIN2):c.1099G>A (p.Ala367Thr) rs540544894
NM_014646.2(LPIN2):c.1132C>T (p.Pro378Ser) rs201678207
NM_014646.2(LPIN2):c.1133C>T (p.Pro378Leu)
NM_014646.2(LPIN2):c.1151C>T (p.Ser384Leu)
NM_014646.2(LPIN2):c.1154C>T (p.Pro385Leu) rs754221410
NM_014646.2(LPIN2):c.1159A>G (p.Lys387Glu) rs104895501
NM_014646.2(LPIN2):c.1168+11G>C rs79439091
NM_014646.2(LPIN2):c.1168+4A>G
NM_014646.2(LPIN2):c.1168+6C>T rs200130790
NM_014646.2(LPIN2):c.1169-3C>T rs200259086
NM_014646.2(LPIN2):c.1169-7delT rs746626720
NM_014646.2(LPIN2):c.1171G>A (p.Val391Ile) rs886053767
NM_014646.2(LPIN2):c.1203T>G (p.Asp401Glu) rs1018736752
NM_014646.2(LPIN2):c.120T>C (p.Asp40=) rs143261167
NM_014646.2(LPIN2):c.1247C>T (p.Ala416Val) rs777239535
NM_014646.2(LPIN2):c.1282G>A (p.Gly428Ser) rs768189312
NM_014646.2(LPIN2):c.1312C>T (p.Leu438Phe) rs138079183
NM_014646.2(LPIN2):c.1312_1313CT[2] (p.Ser439fs) rs318240736
NM_014646.2(LPIN2):c.1315T>C (p.Ser439Pro) rs1555673672
NM_014646.2(LPIN2):c.1329C>A (p.Ser443=) rs759651506
NM_014646.2(LPIN2):c.1339G>A (p.Val447Met) rs373758040
NM_014646.2(LPIN2):c.1348G>A (p.Ala450Thr) rs771486222
NM_014646.2(LPIN2):c.1367C>T (p.Thr456Ile)
NM_014646.2(LPIN2):c.1395C>T (p.Asp465=) rs143562359
NM_014646.2(LPIN2):c.1404C>T (p.Asp468=) rs376147435
NM_014646.2(LPIN2):c.1456+4C>G rs373685201
NM_014646.2(LPIN2):c.147C>T (p.His49=) rs17886056
NM_014646.2(LPIN2):c.1510C>T (p.Leu504Phe) rs104895500
NM_014646.2(LPIN2):c.1514T>C (p.Ile505Thr) rs146424724
NM_014646.2(LPIN2):c.1522C>T (p.Pro508Ser)
NM_014646.2(LPIN2):c.1735T>C (p.Ser579Pro) rs150022314
NM_014646.2(LPIN2):c.1783G>C (p.Ala595Pro) rs373929015
NM_014646.2(LPIN2):c.1796C>T (p.Pro599Leu) rs372850864
NM_014646.2(LPIN2):c.1800C>T (p.Ala600=) rs369572309
NM_014646.2(LPIN2):c.1801G>A (p.Glu601Lys) rs61735393
NM_014646.2(LPIN2):c.1839C>T (p.Leu613=) rs886053766
NM_014646.2(LPIN2):c.1867C>T (p.Pro623Ser) rs143090653
NM_014646.2(LPIN2):c.1876C>T (p.Pro626Ser) rs150806357
NM_014646.2(LPIN2):c.1938+4A>G rs1397526157
NM_014646.2(LPIN2):c.1939-2delA rs745529823
NM_014646.2(LPIN2):c.1939-5A>G rs779830291
NM_014646.2(LPIN2):c.200T>C (p.Ile67Thr)
NM_014646.2(LPIN2):c.206T>C (p.Ile69Thr) rs1555677681
NM_014646.2(LPIN2):c.2086_2087+39delAAGTAAGCTCAATCCTTCAGGTGGGTGGCAAGGAACAGCCC
NM_014646.2(LPIN2):c.2088G>A (p.Lys696=) rs778440902
NM_014646.2(LPIN2):c.2201C>T (p.Ser734Leu) rs80338807
NM_014646.2(LPIN2):c.2211C>T (p.Ala737=) rs886053765
NM_014646.2(LPIN2):c.2223C>T (p.Ala741=) rs17555442
NM_014646.2(LPIN2):c.2224G>A (p.Asp742Asn) rs779538504
NM_014646.2(LPIN2):c.2237G>A (p.Gly746Asp) rs1555672260
NM_014646.2(LPIN2):c.2316C>A (p.Ser772=) rs145270447
NM_014646.2(LPIN2):c.2327+1G>C rs80338808
NM_014646.2(LPIN2):c.2371C>T (p.Leu791=) rs373520277
NM_014646.2(LPIN2):c.2409G>C (p.Gln803His) rs876660987
NM_014646.2(LPIN2):c.2420C>T (p.Ala807Val)
NM_014646.2(LPIN2):c.2443-9C>T rs191749331
NM_014646.2(LPIN2):c.2445T>C (p.Asp815=) rs140249737
NM_014646.2(LPIN2):c.2547-1G>A rs145858312
NM_014646.2(LPIN2):c.2569G>T (p.Val857Leu) rs1346809433
NM_014646.2(LPIN2):c.2583C>T (p.Phe861=) rs141043192
NM_014646.2(LPIN2):c.2617C>A (p.Pro873Thr)
NM_014646.2(LPIN2):c.2621G>A (p.Cys874Tyr) rs201160155
NM_014646.2(LPIN2):c.2621G>T (p.Cys874Phe) rs201160155
NM_014646.2(LPIN2):c.2625G>A (p.Pro875=) rs187572602
NM_014646.2(LPIN2):c.2650C>T (p.Arg884Ter) rs547662448
NM_014646.2(LPIN2):c.2657C>T (p.Pro886Leu) rs147203309
NM_014646.2(LPIN2):c.2671G>A (p.Asp891Asn) rs200648652
NM_014646.2(LPIN2):c.353T>C (p.Ile118Thr) rs181542503
NM_014646.2(LPIN2):c.374C>G (p.Ser125Trp)
NM_014646.2(LPIN2):c.377G>A (p.Gly126Asp)
NM_014646.2(LPIN2):c.388A>G (p.Thr130Ala) rs191101701
NM_014646.2(LPIN2):c.446C>T (p.Pro149Leu) rs147615538
NM_014646.2(LPIN2):c.469C>T (p.Arg157Ter) rs916009547
NM_014646.2(LPIN2):c.517G>A (p.Ala173Thr) rs140609636
NM_014646.2(LPIN2):c.523G>C (p.Ala175Pro) rs1334969199
NM_014646.2(LPIN2):c.540_541del (p.Thr180_Cys181insTer) rs80338806
NM_014646.2(LPIN2):c.582G>A (p.Gln194=) rs1555677025
NM_014646.2(LPIN2):c.584C>G (p.Ala195Gly) rs1226336598
NM_014646.2(LPIN2):c.584C>T (p.Ala195Val) rs1226336598
NM_014646.2(LPIN2):c.589C>T (p.Arg197Ter)
NM_014646.2(LPIN2):c.590+6A>G rs73375280
NM_014646.2(LPIN2):c.608C>T (p.Ser203Phe) rs144555528
NM_014646.2(LPIN2):c.698C>T (p.Thr233Ile)
NM_014646.2(LPIN2):c.71A>G (p.Gln24Arg) rs1568575278
NM_014646.2(LPIN2):c.755C>T (p.Ala252Val)
NM_014646.2(LPIN2):c.802G>A (p.Gly268Arg)
NM_014646.2(LPIN2):c.87G>A (p.Gly29=) rs1346313879
NM_014646.2(LPIN2):c.907A>C (p.Ser303Arg)
NM_014646.2(LPIN2):c.932T>A (p.Val311Asp) rs886053768
NM_014646.2(LPIN2):c.970A>T (p.Ile324Leu) rs1476358117
NM_014646.2(LPIN2):c.991G>T (p.Ala331Ser) rs80338805
Single allele

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.