ClinVar Miner

List of variants studied for Majeed syndrome by Invitae

Included ClinVar conditions (1):
Minimum submission review status: Collection method:
Minimum conflict level:
ClinVar version:
Total variants: 73
Download table as spreadsheet
HGVS dbSNP
NC_000018.9:g.(?_2920271)_(2960858_?)del
NC_000018.9:g.(?_2920271)_(2960858_?)dup
NM_014646.2(LPIN2):c.1043C>T (p.Pro348Leu) rs34676691
NM_014646.2(LPIN2):c.106G>A (p.Val36Ile)
NM_014646.2(LPIN2):c.1082C>T (p.Ala361Val)
NM_014646.2(LPIN2):c.1099G>A (p.Ala367Thr) rs540544894
NM_014646.2(LPIN2):c.1132C>T (p.Pro378Ser) rs201678207
NM_014646.2(LPIN2):c.1133C>T (p.Pro378Leu)
NM_014646.2(LPIN2):c.1151C>T (p.Ser384Leu)
NM_014646.2(LPIN2):c.1154C>T (p.Pro385Leu) rs754221410
NM_014646.2(LPIN2):c.1159A>G (p.Lys387Glu) rs104895501
NM_014646.2(LPIN2):c.1168+4A>G
NM_014646.2(LPIN2):c.1168+6C>T rs200130790
NM_014646.2(LPIN2):c.1169-3C>T rs200259086
NM_014646.2(LPIN2):c.1203T>G (p.Asp401Glu) rs1018736752
NM_014646.2(LPIN2):c.120T>C (p.Asp40=) rs143261167
NM_014646.2(LPIN2):c.1282G>A (p.Gly428Ser) rs768189312
NM_014646.2(LPIN2):c.1312C>T (p.Leu438Phe) rs138079183
NM_014646.2(LPIN2):c.1315T>C (p.Ser439Pro) rs1555673672
NM_014646.2(LPIN2):c.1329C>A (p.Ser443=) rs759651506
NM_014646.2(LPIN2):c.1339G>A (p.Val447Met) rs373758040
NM_014646.2(LPIN2):c.1367C>T (p.Thr456Ile)
NM_014646.2(LPIN2):c.147C>T (p.His49=) rs17886056
NM_014646.2(LPIN2):c.1510C>T (p.Leu504Phe) rs104895500
NM_014646.2(LPIN2):c.1514T>C (p.Ile505Thr) rs146424724
NM_014646.2(LPIN2):c.1522C>T (p.Pro508Ser)
NM_014646.2(LPIN2):c.1735T>C (p.Ser579Pro) rs150022314
NM_014646.2(LPIN2):c.1796C>T (p.Pro599Leu) rs372850864
NM_014646.2(LPIN2):c.1800C>T (p.Ala600=) rs369572309
NM_014646.2(LPIN2):c.1801G>A (p.Glu601Lys) rs61735393
NM_014646.2(LPIN2):c.1867C>T (p.Pro623Ser) rs143090653
NM_014646.2(LPIN2):c.1876C>T (p.Pro626Ser) rs150806357
NM_014646.2(LPIN2):c.1938+4A>G rs1397526157
NM_014646.2(LPIN2):c.1939-5A>G rs779830291
NM_014646.2(LPIN2):c.200T>C (p.Ile67Thr)
NM_014646.2(LPIN2):c.2086_2087+39delAAGTAAGCTCAATCCTTCAGGTGGGTGGCAAGGAACAGCCC
NM_014646.2(LPIN2):c.2088G>A (p.Lys696=) rs778440902
NM_014646.2(LPIN2):c.2223C>T (p.Ala741=) rs17555442
NM_014646.2(LPIN2):c.2224G>A (p.Asp742Asn) rs779538504
NM_014646.2(LPIN2):c.2237G>A (p.Gly746Asp) rs1555672260
NM_014646.2(LPIN2):c.2316C>A (p.Ser772=) rs145270447
NM_014646.2(LPIN2):c.2371C>T (p.Leu791=) rs373520277
NM_014646.2(LPIN2):c.2409G>C (p.Gln803His) rs876660987
NM_014646.2(LPIN2):c.2420C>T (p.Ala807Val)
NM_014646.2(LPIN2):c.2443-9C>T rs191749331
NM_014646.2(LPIN2):c.2569G>T (p.Val857Leu) rs1346809433
NM_014646.2(LPIN2):c.2583C>T (p.Phe861=) rs141043192
NM_014646.2(LPIN2):c.2617C>A (p.Pro873Thr)
NM_014646.2(LPIN2):c.2621G>A (p.Cys874Tyr) rs201160155
NM_014646.2(LPIN2):c.2650C>T (p.Arg884Ter) rs547662448
NM_014646.2(LPIN2):c.2657C>T (p.Pro886Leu) rs147203309
NM_014646.2(LPIN2):c.2671G>A (p.Asp891Asn) rs200648652
NM_014646.2(LPIN2):c.353T>C (p.Ile118Thr) rs181542503
NM_014646.2(LPIN2):c.374C>G (p.Ser125Trp)
NM_014646.2(LPIN2):c.377G>A (p.Gly126Asp)
NM_014646.2(LPIN2):c.388A>G (p.Thr130Ala) rs191101701
NM_014646.2(LPIN2):c.446C>T (p.Pro149Leu) rs147615538
NM_014646.2(LPIN2):c.517G>A (p.Ala173Thr) rs140609636
NM_014646.2(LPIN2):c.523G>C (p.Ala175Pro) rs1334969199
NM_014646.2(LPIN2):c.582G>A (p.Gln194=) rs1555677025
NM_014646.2(LPIN2):c.584C>G (p.Ala195Gly) rs1226336598
NM_014646.2(LPIN2):c.584C>T (p.Ala195Val) rs1226336598
NM_014646.2(LPIN2):c.589C>T (p.Arg197Ter)
NM_014646.2(LPIN2):c.590+6A>G rs73375280
NM_014646.2(LPIN2):c.698C>T (p.Thr233Ile)
NM_014646.2(LPIN2):c.71A>G (p.Gln24Arg) rs1568575278
NM_014646.2(LPIN2):c.755C>T (p.Ala252Val)
NM_014646.2(LPIN2):c.802G>A (p.Gly268Arg)
NM_014646.2(LPIN2):c.87G>A (p.Gly29=) rs1346313879
NM_014646.2(LPIN2):c.907A>C (p.Ser303Arg)
NM_014646.2(LPIN2):c.970A>T (p.Ile324Leu) rs1476358117
NM_014646.2(LPIN2):c.991G>T (p.Ala331Ser) rs80338805
Single allele

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.