ClinVar Miner

List of variants in gene MYLK studied for aortic aneurysm, familial thoracic 7

Included ClinVar conditions (1):
Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 310
Download table as spreadsheet
HGVS dbSNP
NC_000003.12:g.(?_123682204)_(123682330_?)del
NM_053025.3(MYLK):c.1003A>G (p.Thr335Ala) rs757891156
NM_053025.3(MYLK):c.1005C>T (p.Thr335=) rs4678047
NM_053025.3(MYLK):c.1007C>T (p.Pro336Leu) rs35912339
NM_053025.3(MYLK):c.1028G>T (p.Ser343Ile) rs961194527
NM_053025.3(MYLK):c.1113G>A (p.Arg371=) rs139391789
NM_053025.3(MYLK):c.1123G>A (p.Ala375Thr)
NM_053025.3(MYLK):c.1132C>G (p.Arg378Gly) rs11920433
NM_053025.3(MYLK):c.1133G>A (p.Arg378His) rs56378658
NM_053025.3(MYLK):c.1167G>A (p.Leu389=) rs377631029
NM_053025.3(MYLK):c.1182_1184delTGT (p.Val395del) rs771815695
NM_053025.3(MYLK):c.119G>A (p.Arg40Gln) rs767877538
NM_053025.3(MYLK):c.1212C>A (p.Pro404=) rs765597431
NM_053025.3(MYLK):c.1212C>T (p.Pro404=) rs765597431
NM_053025.3(MYLK):c.1213A>G (p.Met405Val) rs35436690
NM_053025.3(MYLK):c.1219G>A (p.Gly407Ser) rs199719143
NM_053025.3(MYLK):c.1226G>A (p.Arg409Lys)
NM_053025.3(MYLK):c.1254C>G (p.Ser418Arg) rs377193216
NM_053025.3(MYLK):c.1255A>C (p.Lys419Gln) rs773391076
NM_053025.3(MYLK):c.1271A>T (p.Glu424Val) rs779309547
NM_053025.3(MYLK):c.1289C>G (p.Thr430Ser) rs1386279142
NM_053025.3(MYLK):c.1321C>T (p.Pro441Ser) rs928811814
NM_053025.3(MYLK):c.1327C>T (p.Pro443Ser) rs35156360
NM_053025.3(MYLK):c.1330G>A (p.Glu444Lys) rs766381045
NM_053025.3(MYLK):c.1334T>G (p.Val445Gly) rs760407806
NM_053025.3(MYLK):c.1348_1356delGAAGGCACCinsTCT (p.Glu450_Thr452delinsSer) rs1064792964
NM_053025.3(MYLK):c.1356C>T (p.Thr452=) rs768697251
NM_053025.3(MYLK):c.1359C>T (p.Pro453=) rs200973568
NM_053025.3(MYLK):c.1396G>A (p.Asp466Asn) rs1060502529
NM_053025.3(MYLK):c.1400C>G (p.Ala467Gly) rs878855175
NM_053025.3(MYLK):c.1420C>T (p.Leu474=) rs1413024663
NM_053025.3(MYLK):c.1433G>A (p.Arg478Gln) rs775483725
NM_053025.3(MYLK):c.143C>G (p.Ala48Gly) rs1060502537
NM_053025.3(MYLK):c.1473C>T (p.Asn491=) rs138761352
NM_053025.3(MYLK):c.1474G>A (p.Ala492Thr) rs143010767
NM_053025.3(MYLK):c.1480G>C (p.Gly494Arg) rs1002989047
NM_053025.3(MYLK):c.1486C>G (p.Leu496Val) rs9833275
NM_053025.3(MYLK):c.1513G>A (p.Glu505Lys) rs780888701
NM_053025.3(MYLK):c.1516A>G (p.Arg506Gly) rs77323602
NM_053025.3(MYLK):c.1609G>A (p.Val537Ile) rs199988497
NM_053025.3(MYLK):c.1612C>T (p.Arg538Trp) rs55672414
NM_053025.3(MYLK):c.1613G>A (p.Arg538Gln) rs368509953
NM_053025.3(MYLK):c.1651+1G>A
NM_053025.3(MYLK):c.1684G>A (p.Glu562Lys)
NM_053025.3(MYLK):c.1693G>A (p.Val565Met)
NM_053025.3(MYLK):c.169C>T (p.Arg57Trp) rs776636237
NM_053025.3(MYLK):c.1724C>T (p.Pro575Leu) rs761639849
NM_053025.3(MYLK):c.1745C>A (p.Thr582Asn) rs749069560
NM_053025.3(MYLK):c.1752A>G (p.Leu584=) rs775877814
NM_053025.3(MYLK):c.1785C>T (p.Ser595=) rs370094325
NM_053025.3(MYLK):c.1786G>A (p.Ala596Thr) rs758715543
NM_053025.3(MYLK):c.179C>T (p.Pro60Leu) rs1060502532
NM_053025.3(MYLK):c.1802A>C (p.His601Pro) rs45477891
NM_053025.3(MYLK):c.1804+8C>T rs820355
NM_053025.3(MYLK):c.1807A>G (p.Lys603Glu) rs751023438
NM_053025.3(MYLK):c.1957G>A (p.Glu653Lys) rs142765858
NM_053025.3(MYLK):c.1968G>T (p.Trp656Cys) rs138172035
NM_053025.3(MYLK):c.1990C>T (p.Gln664Ter) rs1553809100
NM_053025.3(MYLK):c.1991A>G (p.Gln664Arg) rs200273207
NM_053025.3(MYLK):c.2009A>T (p.His670Leu) rs1057524740
NM_053025.3(MYLK):c.2023G>A (p.Gly675Arg) rs147008323
NM_053025.3(MYLK):c.2060C>G (p.Pro687Arg)
NM_053025.3(MYLK):c.2060C>T (p.Pro687Leu) rs144923036
NM_053025.3(MYLK):c.2061G>A (p.Pro687=) rs539307414
NM_053025.3(MYLK):c.2076G>A (p.Thr692=) rs147295583
NM_053025.3(MYLK):c.2085C>G (p.Cys695Trp) rs780052122
NM_053025.3(MYLK):c.2085C>T (p.Cys695=)
NM_053025.3(MYLK):c.208G>A (p.Gly70Arg)
NM_053025.3(MYLK):c.2096A>G (p.Asn699Ser) rs757524646
NM_053025.3(MYLK):c.2101G>A (p.Ala701Thr) rs142835596
NM_053025.3(MYLK):c.2120A>G (p.Gln707Arg) rs201615936
NM_053025.3(MYLK):c.2125G>A (p.Val709Met) rs112537316
NM_053025.3(MYLK):c.2127G>A (p.Val709=) rs138575251
NM_053025.3(MYLK):c.2140+6G>A rs374346618
NM_053025.3(MYLK):c.2149G>A (p.Asp717Asn) rs150936840
NM_053025.3(MYLK):c.2149G>T (p.Asp717Tyr) rs150936840
NM_053025.3(MYLK):c.2165G>A (p.Trp722Ter)
NM_053025.3(MYLK):c.2183G>A (p.Arg728His) rs370154845
NM_053025.3(MYLK):c.2253C>T (p.Thr751=) rs138777049
NM_053025.3(MYLK):c.225C>T (p.Ser75=) rs371699704
NM_053025.3(MYLK):c.2260T>C (p.Trp754Arg) rs774187263
NM_053025.3(MYLK):c.226G>A (p.Gly76Arg) rs368413008
NM_053025.3(MYLK):c.2305G>A (p.Glu769Lys)
NM_053025.3(MYLK):c.2388C>T (p.Leu796=) rs193007255
NM_053025.3(MYLK):c.2398G>T (p.Val800Phe) rs758697820
NM_053025.3(MYLK):c.2404G>A (p.Glu802Lys) rs1477764878
NM_053025.3(MYLK):c.2439C>G (p.Asn813Lys) rs1060502538
NM_053025.3(MYLK):c.2458C>T (p.Pro820Ser) rs748575040
NM_053025.3(MYLK):c.2461C>T (p.Arg821Trp) rs150007422
NM_053025.3(MYLK):c.2462+5G>A rs374003770
NM_053025.3(MYLK):c.2463G>T (p.Arg821=) rs562829000
NM_053025.3(MYLK):c.2464G>A (p.Gly822Arg) rs776358725
NM_053025.3(MYLK):c.2474C>T (p.Pro825Leu) rs201332554
NM_053025.3(MYLK):c.2485G>A (p.Glu829Lys) rs370190691
NM_053025.3(MYLK):c.2492T>G (p.Leu831Arg)
NM_053025.3(MYLK):c.2495G>A (p.Cys832Tyr) rs1553804523
NM_053025.3(MYLK):c.24C>G (p.Ala8=) rs78118111
NM_053025.3(MYLK):c.2509G>C (p.Gly837Arg)
NM_053025.3(MYLK):c.2533C>T (p.Arg845Cys) rs3732485
NM_053025.3(MYLK):c.256C>T (p.Arg86Trp) rs368822172
NM_053025.3(MYLK):c.257G>A (p.Arg86Gln) rs138265409
NM_053025.3(MYLK):c.2595C>T (p.Asp865=) rs567610011
NM_053025.3(MYLK):c.2599G>A (p.Glu867Lys)
NM_053025.3(MYLK):c.2604C>T (p.Asp868=) rs372924929
NM_053025.3(MYLK):c.2627G>A (p.Arg876His)
NM_053025.3(MYLK):c.2628C>T (p.Arg876=) rs571744275
NM_053025.3(MYLK):c.2629G>A (p.Val877Met) rs34542174
NM_053025.3(MYLK):c.2652G>A (p.Glu884=) rs1314650520
NM_053025.3(MYLK):c.2663G>A (p.Arg888His) rs528507616
NM_053025.3(MYLK):c.2693G>A (p.Arg898Gln) rs145507832
NM_053025.3(MYLK):c.2701C>G (p.Leu901Val) rs765778763
NM_053025.3(MYLK):c.2740G>A (p.Asp914Asn) rs561148360
NM_053025.3(MYLK):c.2741A>G (p.Asp914Gly)
NM_053025.3(MYLK):c.2776C>T (p.Arg926Cys) rs766824318
NM_053025.3(MYLK):c.2777G>A (p.Arg926His)
NM_053025.3(MYLK):c.2799G>A (p.Val933=) rs144806671
NM_053025.3(MYLK):c.2804C>T (p.Pro935Leu)
NM_053025.3(MYLK):c.2838C>G (p.His946Gln) rs1200981327
NM_053025.3(MYLK):c.2860C>T (p.Arg954Cys) rs749847711
NM_053025.3(MYLK):c.2898C>T (p.Pro966=) rs753785049
NM_053025.3(MYLK):c.2918C>T (p.Pro973Leu) rs760450984
NM_053025.3(MYLK):c.2919G>A (p.Pro973=) rs149482336
NM_053025.3(MYLK):c.2983A>G (p.Asn995Asp) rs756054110
NM_053025.3(MYLK):c.298G>A (p.Asp100Asn) rs1060502535
NM_053025.3(MYLK):c.3000C>T (p.Ala1000=) rs141546581
NM_053025.3(MYLK):c.3032C>T (p.Ser1011Phe) rs200423083
NM_053025.3(MYLK):c.304G>C (p.Gly102Arg) rs1345796517
NM_053025.3(MYLK):c.3075C>T (p.Pro1025=) rs144885184
NM_053025.3(MYLK):c.3076G>A (p.Val1026Met) rs778578954
NM_053025.3(MYLK):c.3096_3131del36 (p.Ala1044_Pro1055del) rs758966808
NM_053025.3(MYLK):c.3112A>G (p.Met1038Val)
NM_053025.3(MYLK):c.3120C>T (p.Asn1040=) rs759475810
NM_053025.3(MYLK):c.3120_3155delCGCCAAGCCTGCCGAGACCCTGAAGCCCATGGGCAA (p.Ala1044_Pro1055del) rs779483683
NM_053025.3(MYLK):c.3121G>A (p.Ala1041Thr) rs568590920
NM_053025.3(MYLK):c.3127C>G (p.Pro1043Ala) rs777200220
NM_053025.3(MYLK):c.3133G>A (p.Glu1045Lys)
NM_053025.3(MYLK):c.3137C>T (p.Thr1046Ile) rs1060502533
NM_053025.3(MYLK):c.3184G>A (p.Ala1062Thr) rs11558550
NM_053025.3(MYLK):c.3184G>T (p.Ala1062Ser) rs11558550
NM_053025.3(MYLK):c.3203A>G (p.Lys1068Arg) rs148033472
NM_053025.3(MYLK):c.3242A>G (p.His1081Arg) rs113491038
NM_053025.3(MYLK):c.3253A>G (p.Thr1085Ala) rs75370906
NM_053025.3(MYLK):c.3265_3266delAA (p.Lys1089Glufs) rs1553803235
NM_053025.3(MYLK):c.3336C>A (p.Gly1112=) rs1060504648
NM_053025.3(MYLK):c.3351C>A (p.Leu1117=) rs1240784181
NM_053025.3(MYLK):c.3397C>T (p.Leu1133=) rs1060504649
NM_053025.3(MYLK):c.3402C>T (p.Asn1134=) rs865358
NM_053025.3(MYLK):c.3433A>G (p.Ile1145Val)
NM_053025.3(MYLK):c.3438C>T (p.Leu1146=) rs146320279
NM_053025.3(MYLK):c.3449-11_3449-9delTTC rs952172362
NM_053025.3(MYLK):c.3462C>T (p.Ser1154=) rs768346816
NM_053025.3(MYLK):c.3463G>A (p.Val1155Ile) rs201251944
NM_053025.3(MYLK):c.3495A>G (p.Arg1165=) rs142345443
NM_053025.3(MYLK):c.3525C>T (p.Asp1175=) rs147735490
NM_053025.3(MYLK):c.3545C>T (p.Ser1182Phe) rs372251565
NM_053025.3(MYLK):c.3558C>T (p.Thr1186=) rs40305
NM_053025.3(MYLK):c.3610C>T (p.Arg1204Trp) rs151294221
NM_053025.3(MYLK):c.3637G>A (p.Val1213Met) rs368390254
NM_053025.3(MYLK):c.3637G>C (p.Val1213Leu)
NM_053025.3(MYLK):c.3639G>A (p.Val1213=) rs148419939
NM_053025.3(MYLK):c.3651_3652delGA (p.Ser1218Terfs) rs1553795301
NM_053025.3(MYLK):c.3653-10_3653-8delTTT rs576620371
NM_053025.3(MYLK):c.3659C>T (p.Ala1220Val) rs370872760
NM_053025.3(MYLK):c.3660G>A (p.Ala1220=) rs765219262
NM_053025.3(MYLK):c.3681C>T (p.Ala1227=) rs201663473
NM_053025.3(MYLK):c.3706A>G (p.Met1236Val) rs113124819
NM_053025.3(MYLK):c.3749G>A (p.Arg1250His) rs139817477
NM_053025.3(MYLK):c.3750C>T (p.Arg1250=) rs201873975
NM_053025.3(MYLK):c.3784A>G (p.Thr1262Ala) rs1553788596
NM_053025.3(MYLK):c.3823C>T (p.Arg1275Ter) rs1382893400
NM_053025.3(MYLK):c.3824G>A (p.Arg1275Gln) rs564792567
NM_053025.3(MYLK):c.382G>A (p.Ala128Thr) rs147840022
NM_053025.3(MYLK):c.3832-6C>T rs185681684
NM_053025.3(MYLK):c.3832-8G>C
NM_053025.3(MYLK):c.3836A>G (p.Gln1279Arg) rs956816227
NM_053025.3(MYLK):c.383C>T (p.Ala128Val) rs143896146
NM_053025.3(MYLK):c.3843C>T (p.Ser1281=) rs377231739
NM_053025.3(MYLK):c.3856G>A (p.Val1286Met) rs766866941
NM_053025.3(MYLK):c.3868G>A (p.Glu1290Lys) rs145953933
NM_053025.3(MYLK):c.3898G>A (p.Ala1300Thr) rs149530842
NM_053025.3(MYLK):c.3899C>T (p.Ala1300Val) rs201265306
NM_053025.3(MYLK):c.3901C>T (p.Arg1301Cys) rs368321325
NM_053025.3(MYLK):c.3915C>T (p.Cys1305=) rs371602931
NM_053025.3(MYLK):c.3916G>A (p.Gly1306Ser) rs755117377
NM_053025.3(MYLK):c.3987T>G (p.Asp1329Glu) rs9844788
NM_053025.3(MYLK):c.399G>T (p.Gln133His) rs140148380
NM_053025.3(MYLK):c.4001dup (p.Ala1335Serfs) rs1553785222
NM_053025.3(MYLK):c.4014T>C (p.Pro1338=) rs55669734
NM_053025.3(MYLK):c.4016G>T (p.Cys1339Phe) rs749921840
NM_053025.3(MYLK):c.4082G>A (p.Ser1361Asn) rs886039143
NM_053025.3(MYLK):c.4119A>G (p.Ser1373=) rs758896854
NM_053025.3(MYLK):c.411C>G (p.Ser137=) rs55760507
NM_053025.3(MYLK):c.4131G>A (p.Thr1377=) rs756697460
NM_053025.3(MYLK):c.4170C>T (p.Asn1390=) rs545959628
NM_053025.3(MYLK):c.4194C>T (p.His1398=) rs17298941
NM_053025.3(MYLK):c.4195G>A (p.Glu1399Lys) rs181663420
NM_053025.3(MYLK):c.4207C>T (p.Arg1403Cys) rs748559781
NM_053025.3(MYLK):c.4213C>T (p.Arg1405Cys)
NM_053025.3(MYLK):c.4221C>A (p.Ile1407=) rs780641277
NM_053025.3(MYLK):c.4225G>A (p.Val1409Met) rs751056847
NM_053025.3(MYLK):c.423-8C>T rs751696363
NM_053025.3(MYLK):c.4246A>G (p.Ser1416Gly) rs758305428
NM_053025.3(MYLK):c.4289-3delC rs41431347
NM_053025.3(MYLK):c.4289-3dupC rs41431347
NM_053025.3(MYLK):c.4289-4C>G rs376670657
NM_053025.3(MYLK):c.4289-4_4289-3dup rs41431347
NM_053025.3(MYLK):c.4289-9C>G rs41443051
NM_053025.3(MYLK):c.4292C>T (p.Pro1431Leu) rs746690413
NM_053025.3(MYLK):c.4293G>A (p.Pro1431=) rs370153686
NM_053025.3(MYLK):c.4302A>G (p.Glu1434=) rs145872838
NM_053025.3(MYLK):c.4335C>T (p.Pro1445=) rs756038706
NM_053025.3(MYLK):c.4336G>A (p.Glu1446Lys) rs146682969
NM_053025.3(MYLK):c.4349G>A (p.Arg1450Gln) rs41366751
NM_053025.3(MYLK):c.4372C>T (p.Gln1458Ter) rs1553781304
NM_053025.3(MYLK):c.4392C>T (p.Tyr1464=) rs565217509
NM_053025.3(MYLK):c.4397T>C (p.Ile1466Thr) rs766722671
NM_053025.3(MYLK):c.439C>T (p.Pro147Ser) rs9840993
NM_053025.3(MYLK):c.4415+1G>A
NM_053025.3(MYLK):c.4415+9A>G rs187964526
NM_053025.3(MYLK):c.4438C>T (p.Arg1480Ter) rs387906782
NM_053025.3(MYLK):c.4459C>T (p.Arg1487Ter) rs886229659
NM_053025.3(MYLK):c.4489_4493delGCATA (p.Ala1497Phefs) rs1060502531
NM_053025.3(MYLK):c.4565T>C (p.Val1522Ala) rs763880352
NM_053025.3(MYLK):c.4619+2T>G rs1553780501
NM_053025.3(MYLK):c.4620-6C>T rs113607507
NM_053025.3(MYLK):c.463A>C (p.Ile155Leu) rs368775754
NM_053025.3(MYLK):c.463A>G (p.Ile155Val) rs368775754
NM_053025.3(MYLK):c.465C>A (p.Ile155=) rs199517273
NM_053025.3(MYLK):c.4681G>C (p.Glu1561Gln) rs1114167363
NM_053025.3(MYLK):c.468G>A (p.Trp156Ter)
NM_053025.3(MYLK):c.4715G>A (p.Gly1572Glu) rs1060502534
NM_053025.3(MYLK):c.4725C>T (p.Tyr1575=) rs374665486
NM_053025.3(MYLK):c.4731C>G (p.His1577Gln)
NM_053025.3(MYLK):c.4748A>G (p.His1583Arg) rs1553778145
NM_053025.3(MYLK):c.474G>T (p.Glu158Asp) rs370158852
NM_053025.3(MYLK):c.4764G>A (p.Pro1588=) rs56056823
NM_053025.3(MYLK):c.479C>G (p.Pro160Arg) rs111256888
NM_053025.3(MYLK):c.4800G>A (p.Arg1600=) rs111901174
NM_053025.3(MYLK):c.4813G>A (p.Asp1605Asn) rs1060502536
NM_053025.3(MYLK):c.4838-3C>T rs776825316
NM_053025.3(MYLK):c.4838-7G>A rs377561378
NM_053025.3(MYLK):c.4882G>A (p.Val1628Met) rs76655666
NM_053025.3(MYLK):c.4908G>A (p.Glu1636=) rs1553777406
NM_053025.3(MYLK):c.4915G>C (p.Gly1639Arg) rs143900788
NM_053025.3(MYLK):c.4916G>C (p.Gly1639Ala) rs752526557
NM_053025.3(MYLK):c.4920C>T (p.Tyr1640=) rs756699701
NM_053025.3(MYLK):c.4929C>T (p.Asp1643=) rs138423692
NM_053025.3(MYLK):c.4941C>T (p.Ile1647=) rs200291268
NM_053025.3(MYLK):c.4992C>A (p.Asp1664Glu) rs1553774803
NM_053025.3(MYLK):c.49C>T (p.Leu17Phe)
NM_053025.3(MYLK):c.5001C>T (p.Asn1667=) rs375038682
NM_053025.3(MYLK):c.5003_5017dup (p.Asn1672_Val1673insGluThrLeuAlaAsn) rs1553774774
NM_053025.3(MYLK):c.5019T>C (p.Val1673=) rs1553774768
NM_053025.3(MYLK):c.5041G>T (p.Asp1681Tyr)
NM_053025.3(MYLK):c.505C>T (p.Arg169Ter)
NM_053025.3(MYLK):c.5079G>A (p.Lys1693=) rs141467675
NM_053025.3(MYLK):c.5114+7A>G rs1553774672
NM_053025.3(MYLK):c.5114+8G>A rs202229368
NM_053025.3(MYLK):c.5119C>T (p.Arg1707Cys) rs1060502530
NM_053025.3(MYLK):c.5120G>A (p.Arg1707His) rs1328179065
NM_053025.3(MYLK):c.5121C>T (p.Arg1707=) rs144436556
NM_053025.3(MYLK):c.5132C>G (p.Thr1711Arg)
NM_053025.3(MYLK):c.5132C>T (p.Thr1711Met) rs374662467
NM_053025.3(MYLK):c.5166T>C (p.Asp1722=) rs140870383
NM_053025.3(MYLK):c.5214G>C (p.Lys1738Asn) rs761266023
NM_053025.3(MYLK):c.524G>T (p.Gly175Val) rs375456836
NM_053025.3(MYLK):c.5275T>C (p.Ser1759Pro) rs387906781
NM_053025.3(MYLK):c.5287A>G (p.Met1763Val) rs1337673131
NM_053025.3(MYLK):c.5302A>G (p.Ser1768Gly)
NM_053025.3(MYLK):c.5369-10T>G rs373584324
NM_053025.3(MYLK):c.5374G>A (p.Val1792Met) rs746213310
NM_053025.3(MYLK):c.5377T>G (p.Ser1793Ala) rs1553770582
NM_053025.3(MYLK):c.5441C>T (p.Thr1814Ile) rs142220417
NM_053025.3(MYLK):c.5448C>T (p.Arg1816=) rs56262958
NM_053025.3(MYLK):c.5477C>T (p.Ala1826Val) rs147187907
NM_053025.3(MYLK):c.5489G>C (p.Cys1830Ser) rs1302244958
NM_053025.3(MYLK):c.5535T>C (p.Asp1845=) rs748934365
NM_053025.3(MYLK):c.5562C>T (p.His1854=) rs199880151
NM_053025.3(MYLK):c.5587G>A (p.Gly1863Arg)
NM_053025.3(MYLK):c.560G>A (p.Arg187Gln) rs762477499
NM_053025.3(MYLK):c.568C>T (p.Pro190Ser)
NM_053025.3(MYLK):c.5702C>T (p.Thr1901Met)
NM_053025.3(MYLK):c.5715T>G (p.Gly1905=) rs753024354
NM_053025.3(MYLK):c.571C>G (p.Gln191Glu) rs794727880
NM_053025.3(MYLK):c.593A>G (p.Asn198Ser) rs201835018
NM_053025.3(MYLK):c.601C>T (p.Leu201=) rs773082759
NM_053025.3(MYLK):c.608C>A (p.Pro203Gln) rs772426809
NM_053025.3(MYLK):c.611G>A (p.Ser204Asn) rs878855176
NM_053025.3(MYLK):c.617G>T (p.Arg206Leu) rs367649461
NM_053025.3(MYLK):c.643A>G (p.Met215Val) rs754479443
NM_053025.3(MYLK):c.649G>T (p.Val217Phe) rs1553824777
NM_053025.3(MYLK):c.652C>T (p.Leu218=) rs113035707
NM_053025.3(MYLK):c.695C>T (p.Thr232Met) rs55935214
NM_053025.3(MYLK):c.711C>T (p.Asn237=) rs149407805
NM_053025.3(MYLK):c.716C>T (p.Ser239Leu) rs137982786
NM_053025.3(MYLK):c.717G>A (p.Ser239=) rs146960026
NM_053025.3(MYLK):c.728C>G (p.Ser243Trp) rs202126043
NM_053025.3(MYLK):c.755-4C>G rs1249330032
NM_053025.3(MYLK):c.771T>C (p.Asn257=) rs369494886
NM_053025.3(MYLK):c.842A>G (p.Lys281Arg)
NM_053025.3(MYLK):c.845A>G (p.Glu282Gly)
NM_053025.3(MYLK):c.901C>A (p.Gln301Lys)
NM_053025.3(MYLK):c.901C>T (p.Gln301Ter) rs545515041
NM_053025.3(MYLK):c.957G>A (p.Glu319=) rs864622770
NM_053025.3(MYLK):c.963G>A (p.Lys321=) rs1052922812
NM_053025.3(MYLK):c.96C>T (p.Ala32=) rs775979851
NM_053025.3(MYLK):c.984G>A (p.Ser328=) rs115018449
NM_053025.3(MYLK):c.993G>A (p.Thr331=) rs55932343
NM_053025.3(MYLK):c.999G>A (p.Pro333=) rs13319347
NM_053026.3(MYLK):c.3923C>T (p.Thr1308Met) rs750002545

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.