ClinVar Miner

List of variants in gene NAGLU reported as uncertain significance for Charcot-Marie-Tooth disease axonal type 2V

Included ClinVar conditions (2):
Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 7
Download table as spreadsheet
NM_000263.3(NAGLU):c.1090G>T (p.Ala364Ser)
NM_000263.3(NAGLU):c.1304A>G (p.Asn435Ser) rs764815033
NM_000263.3(NAGLU):c.1438G>A (p.Ala480Thr) rs147293270
NM_000263.3(NAGLU):c.1487T>C (p.Leu496Pro) rs569519789
NM_000263.3(NAGLU):c.1973A>G (p.Tyr658Cys)
NM_000263.3(NAGLU):c.214_237delGCGGCGCGCGTGCGGGTGCGCGGC (p.Ala72_Gly79del)
NM_000263.3(NAGLU):c.569A>G (p.Asn190Ser)

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.