ClinVar Miner

List of variants in gene LDB3 studied for autosomal dominant distal myopathy

Included ClinVar conditions (33):
Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 414
Download table as spreadsheet
HGVS dbSNP
NC_000010.10:g.(?_88428443)_(88428547_?)dup
NC_000010.10:g.88469652-?_88492743+?dup
NM_007078.2(LDB3):c.-23-?_93+?dup
NM_007078.3(LDB3):c.-23-32C>A rs34972863
NM_007078.3(LDB3):c.-24+41G>A rs45578532
NM_007078.3(LDB3):c.-24+8T>C rs2803558
NM_007078.3(LDB3):c.1014A>G (p.Thr338=) rs150209221
NM_007078.3(LDB3):c.1017T>G (p.Ala339=) rs727504526
NM_007078.3(LDB3):c.1018G>C (p.Ala340Pro) rs755329877
NM_007078.3(LDB3):c.1035C>T (p.Ile345=) rs121908336
NM_007078.3(LDB3):c.1036G>A (p.Ala346Thr) rs201968775
NM_007078.3(LDB3):c.1041C>A (p.Ser347=) rs45555240
NM_007078.3(LDB3):c.1041C>T (p.Ser347=) rs45555240
NM_007078.3(LDB3):c.1045T>A (p.Ser349Thr) rs147042608
NM_007078.3(LDB3):c.1049C>T (p.Thr350Ile) rs200796750
NM_007078.3(LDB3):c.1051A>G (p.Thr351Ala) rs138251566
NM_007078.3(LDB3):c.1053A>T (p.Thr351=)
NM_007078.3(LDB3):c.1071T>A (p.Pro357=) rs143823978
NM_007078.3(LDB3):c.1074C>T (p.Ala358=) rs45459491
NM_007078.3(LDB3):c.1075G>A (p.Asp359Asn) rs557956141
NM_007078.3(LDB3):c.1086-247_1231+2del rs1564653469
NM_007078.3(LDB3):c.1092G>A (p.Gln364=)
NM_007078.3(LDB3):c.1094C>T (p.Ala365Val)
NM_007078.3(LDB3):c.1105A>G (p.Ser369Gly) rs181700296
NM_007078.3(LDB3):c.1111G>A (p.Ala371Thr) rs45539535
NM_007078.3(LDB3):c.1119C>T (p.Ala373=) rs773647394
NM_007078.3(LDB3):c.1121C>T (p.Ala374Val) rs1554860812
NM_007078.3(LDB3):c.1132C>T (p.Pro378Ser) rs373546361
NM_007078.3(LDB3):c.1147A>G (p.Ser383Gly)
NM_007078.3(LDB3):c.1150T>A (p.Tyr384Asn) rs1554860857
NM_007078.3(LDB3):c.1153A>G (p.Ser385Gly) rs777547764
NM_007078.3(LDB3):c.115G>C (p.Ala39Pro)
NM_007078.3(LDB3):c.1164C>T (p.Pro388=) rs780108812
NM_007078.3(LDB3):c.1165G>A (p.Ala389Thr) rs924634578
NM_007078.3(LDB3):c.1167C>T (p.Ala389=) rs768844187
NM_007078.3(LDB3):c.1200T>G (p.Thr400=) rs1447980981
NM_007078.3(LDB3):c.1211G>A (p.Arg404Gln) rs150868546
NM_007078.3(LDB3):c.1225C>A (p.Gln409Lys) rs139104492
NM_007078.3(LDB3):c.1231G>C (p.Val411Leu)
NM_007078.3(LDB3):c.1232-8T>G
NM_007078.3(LDB3):c.123C>T (p.Ser41=)
NM_007078.3(LDB3):c.1253C>G (p.Pro418Arg) rs141870580
NM_007078.3(LDB3):c.1253C>T (p.Pro418Leu) rs141870580
NM_007078.3(LDB3):c.1254G>A (p.Pro418=) rs145942370
NM_007078.3(LDB3):c.1256C>A (p.Ser419Tyr) rs368888118
NM_007078.3(LDB3):c.1263G>A (p.Gly421=) rs139834701
NM_007078.3(LDB3):c.1289C>A (p.Thr430Asn) rs746183666
NM_007078.3(LDB3):c.1294del (p.Ser432fs)
NM_007078.3(LDB3):c.1296CCCTGCCCCTGCCTACACCCCCTC[1] (p.434APAYTPSP[1]) rs397517209
NM_007078.3(LDB3):c.1296CCCTGCCCCTGCCTACACCCCCTC[3] (p.434APAYTPSP[3]) rs397517209
NM_007078.3(LDB3):c.1312A>G (p.Thr438Ala) rs111941389
NM_007078.3(LDB3):c.1313C>A (p.Thr438Asn)
NM_007078.3(LDB3):c.1313C>G (p.Thr438Ser) rs767914340
NM_007078.3(LDB3):c.1317C>T (p.Pro439=) rs397517208
NM_007078.3(LDB3):c.1321C>T (p.Pro441Ser) rs757728320
NM_007078.3(LDB3):c.1328C>T (p.Pro443Leu) rs1554863327
NM_007078.3(LDB3):c.1335C>T (p.Tyr445=) rs587781024
NM_007078.3(LDB3):c.1337C>T (p.Thr446Ile)
NM_007078.3(LDB3):c.1339C>G (p.Pro447Ala) rs397517211
NM_007078.3(LDB3):c.1351C>G (p.Pro451Ala)
NM_007078.3(LDB3):c.1361C>T (p.Thr454Ile)
NM_007078.3(LDB3):c.1381T>G (p.Tyr461Asp) rs145655904
NM_007078.3(LDB3):c.1386C>T (p.Thr462=) rs764330273
NM_007078.3(LDB3):c.139G>A (p.Asp47Asn) rs397517212
NM_007078.3(LDB3):c.1403A>G (p.Asn468Ser) rs730880129
NM_007078.3(LDB3):c.1418C>A (p.Pro473His)
NM_007078.3(LDB3):c.1421C>T (p.Ser474Leu) rs1011836119
NM_007078.3(LDB3):c.1422G>A (p.Ser474=) rs142625982
NM_007078.3(LDB3):c.1426G>T (p.Ala476Ser)
NM_007078.3(LDB3):c.1434C>T (p.Ser478=)
NM_007078.3(LDB3):c.1435G>A (p.Gly479Arg) rs370521488
NM_007078.3(LDB3):c.1442C>G (p.Pro481Arg) rs12761754
NM_007078.3(LDB3):c.1445C>T (p.Ala482Val) rs774313535
NM_007078.3(LDB3):c.1446G>A (p.Ala482=)
NM_007078.3(LDB3):c.144C>T (p.Leu48=) rs397517213
NM_007078.3(LDB3):c.1453G>T (p.Ala485Ser) rs397517214
NM_007078.3(LDB3):c.1457dup (p.Ser486fs)
NM_007078.3(LDB3):c.1458C>T (p.Ser486=)
NM_007078.3(LDB3):c.1459C>T (p.Arg487Cys)
NM_007078.3(LDB3):c.145G>A (p.Val49Met)
NM_007078.3(LDB3):c.145G>C (p.Val49Leu)
NM_007078.3(LDB3):c.1460G>A (p.Arg487His) rs146265188
NM_007078.3(LDB3):c.1468T>C (p.Trp490Arg) rs1589675054
NM_007078.3(LDB3):c.1471G>A (p.Val491Met)
NM_007078.3(LDB3):c.1471G>T (p.Val491Leu) rs397517215
NM_007078.3(LDB3):c.1472T>A (p.Val491Glu) rs139709036
NM_007078.3(LDB3):c.147G>A (p.Val49=) rs45591834
NM_007078.3(LDB3):c.1487T>C (p.Phe496Ser) rs147072071
NM_007078.3(LDB3):c.1497G>T (p.Lys499Asn) rs1278770988
NM_007078.3(LDB3):c.149T>C (p.Val50Ala)
NM_007078.3(LDB3):c.1502C>T (p.Ala501Val) rs755362259
NM_007078.3(LDB3):c.1503C>T (p.Ala501=) rs147692024
NM_007078.3(LDB3):c.1505C>T (p.Pro502Leu) rs528611881
NM_007078.3(LDB3):c.1506G>A (p.Pro502=) rs45579241
NM_007078.3(LDB3):c.1520C>A (p.Thr507Asn) rs150188572
NM_007078.3(LDB3):c.1521C>T (p.Thr507=) rs200838004
NM_007078.3(LDB3):c.1535A>C (p.Gln512Pro) rs138951890
NM_007078.3(LDB3):c.1535A>G (p.Gln512Arg)
NM_007078.3(LDB3):c.1547G>A (p.Arg516Gln)
NM_007078.3(LDB3):c.1548G>A (p.Arg516=)
NM_007078.3(LDB3):c.1556C>A (p.Pro519Gln)
NM_007078.3(LDB3):c.1565C>A (p.Thr522Asn)
NM_007078.3(LDB3):c.1572G>A (p.Ala524=) rs149423035
NM_007078.3(LDB3):c.1587A>G (p.Pro529=)
NM_007078.3(LDB3):c.1594G>C (p.Ala532Pro) rs143764931
NM_007078.3(LDB3):c.1599G>C (p.Arg533Ser)
NM_007078.3(LDB3):c.159C>T (p.Asp53=) rs200114285
NM_007078.3(LDB3):c.1601_1602dup (p.Thr535fs)
NM_007078.3(LDB3):c.1603_1605delinsTGCCACTCA (p.Thr535delinsCysHisSer) rs1589675306
NM_007078.3(LDB3):c.1605C>A (p.Thr535=)
NM_007078.3(LDB3):c.1605C>T (p.Thr535=) rs727505207
NM_007078.3(LDB3):c.1606G>A (p.Val536Ile) rs113817827
NM_007078.3(LDB3):c.1607T>C (p.Val536Ala) rs727503128
NM_007078.3(LDB3):c.1609del (p.Gln537fs) rs727503129
NM_007078.3(LDB3):c.160G>A (p.Gly54Ser) rs201786090
NM_007078.3(LDB3):c.162C>T (p.Gly54=) rs757856121
NM_007078.3(LDB3):c.1631C>A (p.Ala544Asp)
NM_007078.3(LDB3):c.1633A>G (p.Ser545Gly) rs1370639524
NM_007078.3(LDB3):c.1639C>T (p.Arg547Trp) rs374426474
NM_007078.3(LDB3):c.163G>A (p.Val55Ile) rs3740343
NM_007078.3(LDB3):c.1640G>A (p.Arg547Gln) rs201968826
NM_007078.3(LDB3):c.1649T>C (p.Leu550Pro) rs1589675409
NM_007078.3(LDB3):c.1653C>T (p.Cys551=) rs45581435
NM_007078.3(LDB3):c.1654G>A (p.Gly552Ser)
NM_007078.3(LDB3):c.1664A>G (p.Asn555Ser) rs760635362
NM_007078.3(LDB3):c.1667A>G (p.Asn556Ser) rs372583830
NM_007078.3(LDB3):c.1672A>G (p.Ile558Val) rs372331627
NM_007078.3(LDB3):c.1675C>T (p.Arg559Trp) rs142947567
NM_007078.3(LDB3):c.1676G>A (p.Arg559Gln) rs763908636
NM_007078.3(LDB3):c.1677G>A (p.Arg559=)
NM_007078.3(LDB3):c.167A>G (p.Asn56Ser)
NM_007078.3(LDB3):c.1690G>A (p.Val564Ile)
NM_007078.3(LDB3):c.1696A>G (p.Met566Val) rs775232208
NM_007078.3(LDB3):c.1697T>G (p.Met566Arg) rs566463138
NM_007078.3(LDB3):c.1703G>A (p.Arg568His) rs769156627
NM_007078.3(LDB3):c.1728C>T (p.Thr576=) rs749988944
NM_007078.3(LDB3):c.172G>A (p.Asp58Asn) rs730880127
NM_007078.3(LDB3):c.1736A>G (p.Tyr579Cys) rs199749907
NM_007078.3(LDB3):c.1745C>G (p.Thr582Ser)
NM_007078.3(LDB3):c.1752G>C (p.Leu584=) rs1589676711
NM_007078.3(LDB3):c.1763G>A (p.Cys588Tyr)
NM_007078.3(LDB3):c.1773del (p.Glu592fs) rs776530913
NM_007078.3(LDB3):c.1774G>C (p.Glu592Gln) rs727504944
NM_007078.3(LDB3):c.1779G>A (p.Gln593=)
NM_007078.3(LDB3):c.177C>A (p.Thr59=)
NM_007078.3(LDB3):c.1789T>A (p.Tyr597Asn) rs727503131
NM_007078.3(LDB3):c.1794T>C (p.Cys598=)
NM_007078.3(LDB3):c.1798C>T (p.Arg600Ter) rs727503132
NM_007078.3(LDB3):c.1799G>A (p.Arg600Gln) rs747523570
NM_007078.3(LDB3):c.1805A>C (p.Tyr602Ser)
NM_007078.3(LDB3):c.1812A>G (p.Gln604=)
NM_007078.3(LDB3):c.1823C>T (p.Pro608Leu) rs145983824
NM_007078.3(LDB3):c.1851T>C (p.Ile617=) rs145402041
NM_007078.3(LDB3):c.1857+3A>G
NM_007078.3(LDB3):c.1858-10T>C rs202208256
NM_007078.3(LDB3):c.1858-3C>A
NM_007078.3(LDB3):c.1858-5C>A
NM_007078.3(LDB3):c.1869T>C (p.His623=)
NM_007078.3(LDB3):c.1885T>C (p.Trp629Arg) rs773554501
NM_007078.3(LDB3):c.1894A>G (p.Thr632Ala) rs770525232
NM_007078.3(LDB3):c.1902C>A (p.Phe634Leu) rs773904344
NM_007078.3(LDB3):c.1902C>T (p.Phe634=)
NM_007078.3(LDB3):c.1903G>A (p.Val635Ile) rs45618633
NM_007078.3(LDB3):c.1903G>C (p.Val635Leu) rs45618633
NM_007078.3(LDB3):c.1904T>A (p.Val635Asp)
NM_007078.3(LDB3):c.1904T>G (p.Val635Gly)
NM_007078.3(LDB3):c.1907G>A (p.Cys636Tyr) rs397517218
NM_007078.3(LDB3):c.1910C>T (p.Ala637Val) rs141569007
NM_007078.3(LDB3):c.1911G>A (p.Ala637=) rs150710377
NM_007078.3(LDB3):c.1944C>T (p.Phe648=)
NM_007078.3(LDB3):c.1956C>T (p.Asp652=) rs139213290
NM_007078.3(LDB3):c.1957G>C (p.Gly653Arg) rs149945820
NM_007078.3(LDB3):c.1962G>A (p.Glu654=) rs201063130
NM_007078.3(LDB3):c.1965C>G (p.Pro655=)
NM_007078.3(LDB3):c.196C>T (p.Gln66Ter) rs1554849100
NM_007078.3(LDB3):c.1971C>T (p.Cys657=) rs140552419
NM_007078.3(LDB3):c.1972G>A (p.Glu658Lys) rs760563152
NM_007078.3(LDB3):c.1978+2_1978+5del rs1554864768
NM_007078.3(LDB3):c.1978+6A>G
NM_007078.3(LDB3):c.1978+9A>C rs1060504199
NM_007078.3(LDB3):c.2010T>C (p.His670=) rs759857527
NM_007078.3(LDB3):c.2016C>T (p.Cys672=) rs45578640
NM_007078.3(LDB3):c.2017G>A (p.Asp673Asn) rs45514002
NM_007078.3(LDB3):c.2025C>T (p.Pro675=) rs876657490
NM_007078.3(LDB3):c.2037C>T (p.Gly679=)
NM_007078.3(LDB3):c.2049C>T (p.Ile683=)
NM_007078.3(LDB3):c.2050G>A (p.Glu684Lys)
NM_007078.3(LDB3):c.2056C>G (p.Leu686Val)
NM_007078.3(LDB3):c.2066C>G (p.Thr689Ser)
NM_007078.3(LDB3):c.2073C>T (p.His691=) rs45486293
NM_007078.3(LDB3):c.2074G>A (p.Asp692Asn)
NM_007078.3(LDB3):c.2091C>T (p.Cys697=) rs571356142
NM_007078.3(LDB3):c.2092G>A (p.Ala698Thr) rs45577134
NM_007078.3(LDB3):c.2094+3A>G
NM_007078.3(LDB3):c.2104G>T (p.Val702Leu) rs773235586
NM_007078.3(LDB3):c.2119C>T (p.Gln707Ter) rs771316707
NM_007078.3(LDB3):c.2123C>T (p.Pro708Leu) rs774815578
NM_007078.3(LDB3):c.2124G>A (p.Pro708=) rs759812655
NM_007078.3(LDB3):c.2128T>C (p.Tyr710His)
NM_007078.3(LDB3):c.2130C>T (p.Tyr710=)
NM_007078.3(LDB3):c.2136del (p.Lys713fs)
NM_007078.3(LDB3):c.2142C>A (p.Asp714Glu)
NM_007078.3(LDB3):c.2150T>G (p.Leu717Arg)
NM_007078.3(LDB3):c.2155A>C (p.Lys719Gln) rs397517220
NM_007078.3(LDB3):c.2157G>A (p.Lys719=)
NM_007078.3(LDB3):c.2163C>T (p.His721=) rs556787635
NM_007078.3(LDB3):c.2164G>A (p.Ala722Thr) rs727505129
NM_007078.3(LDB3):c.2173A>C (p.Ile725Leu)
NM_007078.3(LDB3):c.2173A>G (p.Ile725Val) rs1554870749
NM_007078.3(LDB3):c.2174T>A (p.Ile725Asn) rs748399477
NM_007078.3(LDB3):c.2177A>G (p.Asn726Ser)
NM_007078.3(LDB3):c.23C>A (p.Thr8Asn) rs1060501317
NM_007078.3(LDB3):c.242del (p.Gln81fs) rs1554849133
NM_007078.3(LDB3):c.245+7G>A
NM_007078.3(LDB3):c.246-4A>G
NM_007078.3(LDB3):c.246-8T>A
NM_007078.3(LDB3):c.269C>G (p.Ser90Cys)
NM_007078.3(LDB3):c.272C>T (p.Thr91Met) rs769237367
NM_007078.3(LDB3):c.273G>A (p.Thr91=) rs45613039
NM_007078.3(LDB3):c.281C>T (p.Pro94Leu)
NM_007078.3(LDB3):c.285A>C (p.Pro95=)
NM_007078.3(LDB3):c.287T>C (p.Val96Ala) rs794729056
NM_007078.3(LDB3):c.290A>G (p.Gln97Arg) rs762580653
NM_007078.3(LDB3):c.295C>T (p.Pro99Ser) rs201693259
NM_007078.3(LDB3):c.302C>T (p.Pro101Leu) rs45592139
NM_007078.3(LDB3):c.303G>A (p.Pro101=)
NM_007078.3(LDB3):c.304G>A (p.Val102Met)
NM_007078.3(LDB3):c.306G>A (p.Val102=) rs201715521
NM_007078.3(LDB3):c.309C>A (p.Ile103=) rs1060504198
NM_007078.3(LDB3):c.30C>G (p.Pro10=) rs766817285
NM_007078.3(LDB3):c.30C>T (p.Pro10=) rs766817285
NM_007078.3(LDB3):c.318G>A (p.Gln106=)
NM_007078.3(LDB3):c.319A>T (p.Lys107Ter)
NM_007078.3(LDB3):c.31G>A (p.Gly11Arg)
NM_007078.3(LDB3):c.322-8T>C
NM_007078.3(LDB3):c.324C>A (p.Asp108Glu) rs1322226509
NM_007078.3(LDB3):c.328G>A (p.Ala110Thr) rs768737496
NM_007078.3(LDB3):c.338C>T (p.Thr113Met) rs563714303
NM_007078.3(LDB3):c.342C>T (p.Asn114=) rs151166414
NM_007078.3(LDB3):c.344G>A (p.Gly115Asp) rs767658173
NM_007078.3(LDB3):c.348C>T (p.Ser116=) rs1060504200
NM_007078.3(LDB3):c.352G>A (p.Val118Met) rs35507268
NM_007078.3(LDB3):c.356C>T (p.Ala119Val) rs397517223
NM_007078.3(LDB3):c.368G>A (p.Ser123Asn)
NM_007078.3(LDB3):c.378G>A (p.Ala126=) rs149872184
NM_007078.3(LDB3):c.378G>T (p.Ala126=) rs149872184
NM_007078.3(LDB3):c.390AGGCACCCC[1] (p.131GTP[1])
NM_007078.3(LDB3):c.395C>T (p.Thr132Ile)
NM_007078.3(LDB3):c.398C>T (p.Pro133Leu) rs200239096
NM_007078.3(LDB3):c.399A>T (p.Pro133=) rs769713715
NM_007078.3(LDB3):c.404C>A (p.Thr135Asn) rs1004651681
NM_007078.3(LDB3):c.407C>T (p.Pro136Leu) rs772887402
NM_007078.3(LDB3):c.408G>A (p.Pro136=)
NM_007078.3(LDB3):c.435C>T (p.Ala145=)
NM_007078.3(LDB3):c.442C>T (p.Arg148Trp) rs536186237
NM_007078.3(LDB3):c.444G>C (p.Arg148=) rs754596106
NM_007078.3(LDB3):c.450C>T (p.Ser150=) rs878854907
NM_007078.3(LDB3):c.451G>A (p.Ala151Thr) rs780578350
NM_007078.3(LDB3):c.465C>A (p.Leu155=)
NM_007078.3(LDB3):c.465C>T (p.Leu155=) rs45516997
NM_007078.3(LDB3):c.466G>A (p.Ala156Thr) rs200596619
NM_007078.3(LDB3):c.467C>T (p.Ala156Val)
NM_007078.3(LDB3):c.469G>A (p.Glu157Lys) rs770678454
NM_007078.3(LDB3):c.47G>A (p.Arg16His)
NM_007078.3(LDB3):c.488C>G (p.Pro163Arg)
NM_007078.3(LDB3):c.492G>A (p.Pro164=) rs368407147
NM_007078.3(LDB3):c.492G>T (p.Pro164=) rs368407147
NM_007078.3(LDB3):c.493C>A (p.Arg165=)
NM_007078.3(LDB3):c.493C>T (p.Arg165Trp) rs45610637
NM_007078.3(LDB3):c.494G>A (p.Arg165Gln) rs61857115
NM_007078.3(LDB3):c.498C>A (p.Ala166=)
NM_007078.3(LDB3):c.4T>A (p.Ser2Thr) rs1564626023
NM_007078.3(LDB3):c.501C>A (p.Ser167Arg)
NM_007078.3(LDB3):c.507G>A (p.Arg169=)
NM_007078.3(LDB3):c.525G>C (p.Glu175Asp) rs757099637
NM_007078.3(LDB3):c.526G>A (p.Gly176Arg) rs149167391
NM_007078.3(LDB3):c.529del (p.Ala177fs) rs730880345
NM_007078.3(LDB3):c.529dup (p.Ala177fs) rs730880345
NM_007078.3(LDB3):c.530C>T (p.Ala177Val) rs397517224
NM_007078.3(LDB3):c.531C>T (p.Ala177=)
NM_007078.3(LDB3):c.532C>T (p.Arg178Trp) rs730880128
NM_007078.3(LDB3):c.541C>T (p.Leu181Phe) rs1589623326
NM_007078.3(LDB3):c.543C>T (p.Leu181=) rs148324530
NM_007078.3(LDB3):c.548del (p.Pro183fs) rs1285270306
NM_007078.3(LDB3):c.54G>T (p.Gln18His) rs149348427
NM_007078.3(LDB3):c.550A>G (p.Lys184Glu) rs774886148
NM_007078.3(LDB3):c.55G>A (p.Gly19Arg) rs777413488
NM_007078.3(LDB3):c.55G>C (p.Gly19Arg)
NM_007078.3(LDB3):c.55G>T (p.Gly19Trp) rs777413488
NM_007078.3(LDB3):c.560C>T (p.Pro187Leu) rs149218167
NM_007078.3(LDB3):c.561G>A (p.Pro187=)
NM_007078.3(LDB3):c.566C>T (p.Ser189Leu) rs45487699
NM_007078.3(LDB3):c.567G>A (p.Ser189=) rs778777214
NM_007078.3(LDB3):c.567_568delinsTT (p.Ser190Cys)
NM_007078.3(LDB3):c.56G>A (p.Gly19Glu)
NM_007078.3(LDB3):c.575C>T (p.Pro192Leu) rs758182278
NM_007078.3(LDB3):c.576G>A (p.Pro192=) rs45543741
NM_007078.3(LDB3):c.576G>T (p.Pro192=) rs45543741
NM_007078.3(LDB3):c.581A>T (p.Gln194Leu)
NM_007078.3(LDB3):c.592C>T (p.Pro198Ser) rs1060501318
NM_007078.3(LDB3):c.608C>T (p.Ser203Leu)
NM_007078.3(LDB3):c.609G>A (p.Ser203=) rs45531131
NM_007078.3(LDB3):c.610G>A (p.Ala204Thr) rs774976112
NM_007078.3(LDB3):c.626A>T (p.Glu209Val)
NM_007078.3(LDB3):c.645G>A (p.Gln215=)
NM_007078.3(LDB3):c.646A>T (p.Met216Leu) rs765199175
NM_007078.3(LDB3):c.655C>T (p.Arg219Ter) rs727503123
NM_007078.3(LDB3):c.656G>A (p.Arg219Gln) rs530979771
NM_007078.3(LDB3):c.664G>A (p.Ala222Thr) rs139922045
NM_007078.3(LDB3):c.668C>T (p.Ser223Leu) rs375306400
NM_007078.3(LDB3):c.669G>A (p.Ser223=)
NM_007078.3(LDB3):c.675C>G (p.Val225=)
NM_007078.3(LDB3):c.675C>T (p.Val225=)
NM_007078.3(LDB3):c.676G>A (p.Gly226Arg) rs771099131
NM_007078.3(LDB3):c.689+10G>A rs45563234
NM_007078.3(LDB3):c.689+8A>G
NM_007078.3(LDB3):c.689+9C>T rs727503124
NM_007078.3(LDB3):c.690-2A>G rs1060501315
NM_007078.3(LDB3):c.690-4A>G rs45529531
NM_007078.3(LDB3):c.714C>T (p.Ala238=) rs727503125
NM_007078.3(LDB3):c.715G>A (p.Val239Ile) rs201417512
NM_007078.3(LDB3):c.723C>T (p.Ser241=) rs200580597
NM_007078.3(LDB3):c.724G>A (p.Ala242Thr)
NM_007078.3(LDB3):c.72C>A (p.Asn24Lys) rs1323002546
NM_007078.3(LDB3):c.730C>G (p.Pro244Ala)
NM_007078.3(LDB3):c.732C>T (p.Pro244=) rs144509718
NM_007078.3(LDB3):c.733G>A (p.Val245Ile) rs573061464
NM_007078.3(LDB3):c.752A>G (p.Lys251Arg) rs34423165
NM_007078.3(LDB3):c.769G>C (p.Glu257Gln)
NM_007078.3(LDB3):c.778G>A (p.Ala260Thr) rs777637914
NM_007078.3(LDB3):c.782A>C (p.Asp261Ala) rs1285921374
NM_007078.3(LDB3):c.783C>T (p.Asp261=) rs45470296
NM_007078.3(LDB3):c.784G>A (p.Glu262Lys)
NM_007078.3(LDB3):c.792A>G (p.Ala264=)
NM_007078.3(LDB3):c.793C>T (p.Arg265Cys) rs45521338
NM_007078.3(LDB3):c.794G>A (p.Arg265His) rs45458895
NM_007078.3(LDB3):c.796C>T (p.Arg266Cys)
NM_007078.3(LDB3):c.80T>C (p.Leu27Pro) rs1057517864
NM_007078.3(LDB3):c.818G>A (p.Arg273His)
NM_007078.3(LDB3):c.826C>T (p.Arg276Cys) rs397517226
NM_007078.3(LDB3):c.827G>A (p.Arg276His) rs774519585
NM_007078.3(LDB3):c.831C>T (p.Ile277=) rs752273360
NM_007078.3(LDB3):c.833T>G (p.Leu278Arg)
NM_007078.3(LDB3):c.846G>A (p.Thr282=)
NM_007078.3(LDB3):c.858C>T (p.Phe286=) rs764056994
NM_007078.3(LDB3):c.867C>T (p.Asp289=) rs397517227
NM_007078.3(LDB3):c.886C>T (p.Arg296Ter) rs1060501316
NM_007078.3(LDB3):c.887G>A (p.Arg296Gln) rs201689564
NM_007078.3(LDB3):c.891G>A (p.Arg297=) rs374336814
NM_007078.3(LDB3):c.891G>T (p.Arg297Ser) rs374336814
NM_007078.3(LDB3):c.892T>C (p.Ser298Pro)
NM_007078.3(LDB3):c.892T>G (p.Ser298Ala)
NM_007078.3(LDB3):c.896+5G>A
NM_007078.3(LDB3):c.896+6695T>C
NM_007078.3(LDB3):c.896+6717G>A
NM_007078.3(LDB3):c.896+6721C>T rs375798002
NM_007078.3(LDB3):c.896+6722G>A rs144445130
NM_007078.3(LDB3):c.896+6723G>C rs868365512
NM_007078.3(LDB3):c.896+6730A>G
NM_007078.3(LDB3):c.896+6730A>T
NM_007078.3(LDB3):c.896+6731C>T rs372789789
NM_007078.3(LDB3):c.896+6738C>T rs377201153
NM_007078.3(LDB3):c.896+6739G>A
NM_007078.3(LDB3):c.896+6749A>G
NM_007078.3(LDB3):c.896+6753C>G
NM_007078.3(LDB3):c.896+6753C>T rs121908335
NM_007078.3(LDB3):c.896+6754G>A
NM_007078.3(LDB3):c.896+6761G>A
NM_007078.3(LDB3):c.896+6767T>C rs748780980
NM_007078.3(LDB3):c.896+6768G>A rs771037817
NM_007078.3(LDB3):c.896+6781A>C rs1589656313
NM_007078.3(LDB3):c.896+6800C>T
NM_007078.3(LDB3):c.896+6814G>A
NM_007078.3(LDB3):c.896+6872G>A
NM_007078.3(LDB3):c.896+6957G>A rs886047354
NM_007078.3(LDB3):c.896+6959C>T rs139415121
NM_007078.3(LDB3):c.897-10G>A rs77304928
NM_007078.3(LDB3):c.897-1_897del
NM_007078.3(LDB3):c.897-6479C>T rs1554857593
NM_007078.3(LDB3):c.897-6525T>C rs886047356
NM_007078.3(LDB3):c.897-6664G>A
NM_007078.3(LDB3):c.897-6665C>T rs549156118
NM_007078.3(LDB3):c.897-6692C>T
NM_007078.3(LDB3):c.897-6700G>A
NM_007078.3(LDB3):c.897-6702C>G
NM_007078.3(LDB3):c.897-6707G>A rs537660741
NM_007078.3(LDB3):c.897-6719C>T
NM_007078.3(LDB3):c.897-6745C>T
NM_007078.3(LDB3):c.897-6759C>G rs11594242
NM_007078.3(LDB3):c.897-6831C>T rs886047355
NM_007078.3(LDB3):c.897-6834C>T rs185972751
NM_007078.3(LDB3):c.897-6861G>A
NM_007078.3(LDB3):c.897-6909G>A rs532856980
NM_007078.3(LDB3):c.897-7T>A
NM_007078.3(LDB3):c.89C>A (p.Ser30Tyr)
NM_007078.3(LDB3):c.900C>A (p.Thr300=) rs760071118
NM_007078.3(LDB3):c.914C>A (p.Ala305Glu)
NM_007078.3(LDB3):c.918G>A (p.Pro306=)
NM_007078.3(LDB3):c.91C>G (p.Arg31Gly)
NM_007078.3(LDB3):c.91C>T (p.Arg31Trp) rs367792378
NM_007078.3(LDB3):c.92G>A (p.Arg31Gln) rs1410128172
NM_007078.3(LDB3):c.94-9T>C rs1282721488
NM_007078.3(LDB3):c.940A>G (p.Thr314Ala)
NM_007078.3(LDB3):c.944C>T (p.Pro315Leu)
NM_007078.3(LDB3):c.945G>A (p.Pro315=)
NM_007078.3(LDB3):c.953C>A (p.Pro318His)
NM_007078.3(LDB3):c.954C>T (p.Pro318=) rs45603139
NM_007078.3(LDB3):c.955G>A (p.Ala319Thr) rs151219713
NM_007078.3(LDB3):c.991G>A (p.Ala331Thr) rs749520121
NM_007078.3(LDB3):c.992C>T (p.Ala331Val)
NM_007078.3(LDB3):c.993G>A (p.Ala331=) rs140347820
NM_007078.3(LDB3):c.998C>T (p.Ser333Leu)
NM_007078.3(LDB3):c.999G>A (p.Ser333=)
NM_007078.3(LDB3):c.99dup (p.Pro34fs) rs1554849000

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.