ClinVar Miner

List of variants in gene LDB3 reported as uncertain significance for autosomal dominant distal myopathy

Included ClinVar conditions (33):
Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 248
Download table as spreadsheet
HGVS dbSNP
NC_000010.10:g.(?_88428443)_(88428547_?)dup
NC_000010.10:g.88469652-?_88492743+?dup
NM_007078.2(LDB3):c.-23-?_93+?dup
NM_007078.3(LDB3):c.-23-32C>A rs34972863
NM_007078.3(LDB3):c.-24+41G>A rs45578532
NM_007078.3(LDB3):c.1018G>C (p.Ala340Pro) rs755329877
NM_007078.3(LDB3):c.1049C>T (p.Thr350Ile) rs200796750
NM_007078.3(LDB3):c.1071T>A (p.Pro357=) rs143823978
NM_007078.3(LDB3):c.1086-247_1231+2del rs1564653469
NM_007078.3(LDB3):c.1094C>T (p.Ala365Val)
NM_007078.3(LDB3):c.1121C>T (p.Ala374Val) rs1554860812
NM_007078.3(LDB3):c.1132C>T (p.Pro378Ser) rs373546361
NM_007078.3(LDB3):c.1147A>G (p.Ser383Gly)
NM_007078.3(LDB3):c.1150T>A (p.Tyr384Asn) rs1554860857
NM_007078.3(LDB3):c.1153A>G (p.Ser385Gly) rs777547764
NM_007078.3(LDB3):c.115G>C (p.Ala39Pro)
NM_007078.3(LDB3):c.1165G>A (p.Ala389Thr) rs924634578
NM_007078.3(LDB3):c.1211G>A (p.Arg404Gln) rs150868546
NM_007078.3(LDB3):c.1225C>A (p.Gln409Lys) rs139104492
NM_007078.3(LDB3):c.1231G>C (p.Val411Leu)
NM_007078.3(LDB3):c.1253C>G (p.Pro418Arg) rs141870580
NM_007078.3(LDB3):c.1253C>T (p.Pro418Leu) rs141870580
NM_007078.3(LDB3):c.1256C>A (p.Ser419Tyr) rs368888118
NM_007078.3(LDB3):c.1289C>A (p.Thr430Asn) rs746183666
NM_007078.3(LDB3):c.1294del (p.Ser432fs)
NM_007078.3(LDB3):c.1296CCCTGCCCCTGCCTACACCCCCTC[1] (p.434APAYTPSP[1]) rs397517209
NM_007078.3(LDB3):c.1296CCCTGCCCCTGCCTACACCCCCTC[3] (p.434APAYTPSP[3]) rs397517209
NM_007078.3(LDB3):c.1312A>G (p.Thr438Ala) rs111941389
NM_007078.3(LDB3):c.1313C>A (p.Thr438Asn)
NM_007078.3(LDB3):c.1313C>G (p.Thr438Ser) rs767914340
NM_007078.3(LDB3):c.1321C>T (p.Pro441Ser) rs757728320
NM_007078.3(LDB3):c.1328C>T (p.Pro443Leu) rs1554863327
NM_007078.3(LDB3):c.1337C>T (p.Thr446Ile)
NM_007078.3(LDB3):c.1339C>G (p.Pro447Ala) rs397517211
NM_007078.3(LDB3):c.1351C>G (p.Pro451Ala)
NM_007078.3(LDB3):c.1361C>T (p.Thr454Ile)
NM_007078.3(LDB3):c.1381T>G (p.Tyr461Asp) rs145655904
NM_007078.3(LDB3):c.139G>A (p.Asp47Asn) rs397517212
NM_007078.3(LDB3):c.1403A>G (p.Asn468Ser) rs730880129
NM_007078.3(LDB3):c.1418C>A (p.Pro473His)
NM_007078.3(LDB3):c.1421C>T (p.Ser474Leu) rs1011836119
NM_007078.3(LDB3):c.1426G>T (p.Ala476Ser)
NM_007078.3(LDB3):c.1435G>A (p.Gly479Arg) rs370521488
NM_007078.3(LDB3):c.1445C>T (p.Ala482Val) rs774313535
NM_007078.3(LDB3):c.1446G>A (p.Ala482=)
NM_007078.3(LDB3):c.1453G>T (p.Ala485Ser) rs397517214
NM_007078.3(LDB3):c.1457dup (p.Ser486fs)
NM_007078.3(LDB3):c.1459C>T (p.Arg487Cys)
NM_007078.3(LDB3):c.145G>A (p.Val49Met)
NM_007078.3(LDB3):c.145G>C (p.Val49Leu)
NM_007078.3(LDB3):c.1468T>C (p.Trp490Arg) rs1589675054
NM_007078.3(LDB3):c.1471G>A (p.Val491Met)
NM_007078.3(LDB3):c.1471G>T (p.Val491Leu) rs397517215
NM_007078.3(LDB3):c.1472T>A (p.Val491Glu) rs139709036
NM_007078.3(LDB3):c.1487T>C (p.Phe496Ser) rs147072071
NM_007078.3(LDB3):c.1497G>T (p.Lys499Asn) rs1278770988
NM_007078.3(LDB3):c.149T>C (p.Val50Ala)
NM_007078.3(LDB3):c.1502C>T (p.Ala501Val) rs755362259
NM_007078.3(LDB3):c.1505C>T (p.Pro502Leu) rs528611881
NM_007078.3(LDB3):c.1520C>A (p.Thr507Asn) rs150188572
NM_007078.3(LDB3):c.1535A>C (p.Gln512Pro) rs138951890
NM_007078.3(LDB3):c.1535A>G (p.Gln512Arg)
NM_007078.3(LDB3):c.1547G>A (p.Arg516Gln)
NM_007078.3(LDB3):c.1556C>A (p.Pro519Gln)
NM_007078.3(LDB3):c.1565C>A (p.Thr522Asn)
NM_007078.3(LDB3):c.1599G>C (p.Arg533Ser)
NM_007078.3(LDB3):c.1601_1602dup (p.Thr535fs)
NM_007078.3(LDB3):c.1603_1605delinsTGCCACTCA (p.Thr535delinsCysHisSer) rs1589675306
NM_007078.3(LDB3):c.1606G>A (p.Val536Ile) rs113817827
NM_007078.3(LDB3):c.1607T>C (p.Val536Ala) rs727503128
NM_007078.3(LDB3):c.1609del (p.Gln537fs) rs727503129
NM_007078.3(LDB3):c.160G>A (p.Gly54Ser) rs201786090
NM_007078.3(LDB3):c.1631C>A (p.Ala544Asp)
NM_007078.3(LDB3):c.1633A>G (p.Ser545Gly) rs1370639524
NM_007078.3(LDB3):c.1639C>T (p.Arg547Trp) rs374426474
NM_007078.3(LDB3):c.1640G>A (p.Arg547Gln) rs201968826
NM_007078.3(LDB3):c.1649T>C (p.Leu550Pro) rs1589675409
NM_007078.3(LDB3):c.1654G>A (p.Gly552Ser)
NM_007078.3(LDB3):c.1664A>G (p.Asn555Ser) rs760635362
NM_007078.3(LDB3):c.1667A>G (p.Asn556Ser) rs372583830
NM_007078.3(LDB3):c.1672A>G (p.Ile558Val) rs372331627
NM_007078.3(LDB3):c.1675C>T (p.Arg559Trp) rs142947567
NM_007078.3(LDB3):c.1676G>A (p.Arg559Gln) rs763908636
NM_007078.3(LDB3):c.1677G>A (p.Arg559=)
NM_007078.3(LDB3):c.167A>G (p.Asn56Ser)
NM_007078.3(LDB3):c.1690G>A (p.Val564Ile)
NM_007078.3(LDB3):c.1696A>G (p.Met566Val) rs775232208
NM_007078.3(LDB3):c.1703G>A (p.Arg568His) rs769156627
NM_007078.3(LDB3):c.172G>A (p.Asp58Asn) rs730880127
NM_007078.3(LDB3):c.1736A>G (p.Tyr579Cys) rs199749907
NM_007078.3(LDB3):c.1745C>G (p.Thr582Ser)
NM_007078.3(LDB3):c.1752G>C (p.Leu584=) rs1589676711
NM_007078.3(LDB3):c.1763G>A (p.Cys588Tyr)
NM_007078.3(LDB3):c.1773del (p.Glu592fs) rs776530913
NM_007078.3(LDB3):c.1774G>C (p.Glu592Gln) rs727504944
NM_007078.3(LDB3):c.1789T>A (p.Tyr597Asn) rs727503131
NM_007078.3(LDB3):c.1798C>T (p.Arg600Ter) rs727503132
NM_007078.3(LDB3):c.1799G>A (p.Arg600Gln) rs747523570
NM_007078.3(LDB3):c.1805A>C (p.Tyr602Ser)
NM_007078.3(LDB3):c.1812A>G (p.Gln604=)
NM_007078.3(LDB3):c.1823C>T (p.Pro608Leu) rs145983824
NM_007078.3(LDB3):c.1857+3A>G
NM_007078.3(LDB3):c.1858-3C>A
NM_007078.3(LDB3):c.1885T>C (p.Trp629Arg) rs773554501
NM_007078.3(LDB3):c.1894A>G (p.Thr632Ala) rs770525232
NM_007078.3(LDB3):c.1902C>A (p.Phe634Leu) rs773904344
NM_007078.3(LDB3):c.1903G>C (p.Val635Leu) rs45618633
NM_007078.3(LDB3):c.1904T>A (p.Val635Asp)
NM_007078.3(LDB3):c.1904T>G (p.Val635Gly)
NM_007078.3(LDB3):c.1907G>A (p.Cys636Tyr) rs397517218
NM_007078.3(LDB3):c.1910C>T (p.Ala637Val) rs141569007
NM_007078.3(LDB3):c.1957G>C (p.Gly653Arg) rs149945820
NM_007078.3(LDB3):c.196C>T (p.Gln66Ter) rs1554849100
NM_007078.3(LDB3):c.1971C>T (p.Cys657=) rs140552419
NM_007078.3(LDB3):c.1972G>A (p.Glu658Lys) rs760563152
NM_007078.3(LDB3):c.1978+2_1978+5del rs1554864768
NM_007078.3(LDB3):c.1978+6A>G
NM_007078.3(LDB3):c.2017G>A (p.Asp673Asn) rs45514002
NM_007078.3(LDB3):c.2037C>T (p.Gly679=)
NM_007078.3(LDB3):c.2050G>A (p.Glu684Lys)
NM_007078.3(LDB3):c.2056C>G (p.Leu686Val)
NM_007078.3(LDB3):c.2066C>G (p.Thr689Ser)
NM_007078.3(LDB3):c.2074G>A (p.Asp692Asn)
NM_007078.3(LDB3):c.2092G>A (p.Ala698Thr) rs45577134
NM_007078.3(LDB3):c.2094+3A>G
NM_007078.3(LDB3):c.2104G>T (p.Val702Leu) rs773235586
NM_007078.3(LDB3):c.2119C>T (p.Gln707Ter) rs771316707
NM_007078.3(LDB3):c.2123C>T (p.Pro708Leu) rs774815578
NM_007078.3(LDB3):c.2124G>A (p.Pro708=) rs759812655
NM_007078.3(LDB3):c.2128T>C (p.Tyr710His)
NM_007078.3(LDB3):c.2136del (p.Lys713fs)
NM_007078.3(LDB3):c.2142C>A (p.Asp714Glu)
NM_007078.3(LDB3):c.2150T>G (p.Leu717Arg)
NM_007078.3(LDB3):c.2155A>C (p.Lys719Gln) rs397517220
NM_007078.3(LDB3):c.2164G>A (p.Ala722Thr) rs727505129
NM_007078.3(LDB3):c.2173A>C (p.Ile725Leu)
NM_007078.3(LDB3):c.2173A>G (p.Ile725Val) rs1554870749
NM_007078.3(LDB3):c.2174T>A (p.Ile725Asn) rs748399477
NM_007078.3(LDB3):c.2177A>G (p.Asn726Ser)
NM_007078.3(LDB3):c.23C>A (p.Thr8Asn) rs1060501317
NM_007078.3(LDB3):c.242del (p.Gln81fs) rs1554849133
NM_007078.3(LDB3):c.269C>G (p.Ser90Cys)
NM_007078.3(LDB3):c.272C>T (p.Thr91Met) rs769237367
NM_007078.3(LDB3):c.281C>T (p.Pro94Leu)
NM_007078.3(LDB3):c.287T>C (p.Val96Ala) rs794729056
NM_007078.3(LDB3):c.290A>G (p.Gln97Arg) rs762580653
NM_007078.3(LDB3):c.304G>A (p.Val102Met)
NM_007078.3(LDB3):c.30C>G (p.Pro10=) rs766817285
NM_007078.3(LDB3):c.319A>T (p.Lys107Ter)
NM_007078.3(LDB3):c.31G>A (p.Gly11Arg)
NM_007078.3(LDB3):c.356C>T (p.Ala119Val) rs397517223
NM_007078.3(LDB3):c.368G>A (p.Ser123Asn)
NM_007078.3(LDB3):c.390AGGCACCCC[1] (p.131GTP[1])
NM_007078.3(LDB3):c.465C>A (p.Leu155=)
NM_007078.3(LDB3):c.47G>A (p.Arg16His)
NM_007078.3(LDB3):c.494G>A (p.Arg165Gln) rs61857115
NM_007078.3(LDB3):c.4T>A (p.Ser2Thr) rs1564626023
NM_007078.3(LDB3):c.529del (p.Ala177fs) rs730880345
NM_007078.3(LDB3):c.529dup (p.Ala177fs) rs730880345
NM_007078.3(LDB3):c.530C>T (p.Ala177Val) rs397517224
NM_007078.3(LDB3):c.548del (p.Pro183fs) rs1285270306
NM_007078.3(LDB3):c.54G>T (p.Gln18His) rs149348427
NM_007078.3(LDB3):c.55G>A (p.Gly19Arg) rs777413488
NM_007078.3(LDB3):c.55G>C (p.Gly19Arg)
NM_007078.3(LDB3):c.55G>T (p.Gly19Trp) rs777413488
NM_007078.3(LDB3):c.566C>T (p.Ser189Leu) rs45487699
NM_007078.3(LDB3):c.56G>A (p.Gly19Glu)
NM_007078.3(LDB3):c.592C>T (p.Pro198Ser) rs1060501318
NM_007078.3(LDB3):c.608C>T (p.Ser203Leu)
NM_007078.3(LDB3):c.626A>T (p.Glu209Val)
NM_007078.3(LDB3):c.655C>T (p.Arg219Ter) rs727503123
NM_007078.3(LDB3):c.656G>A (p.Arg219Gln) rs530979771
NM_007078.3(LDB3):c.664G>A (p.Ala222Thr) rs139922045
NM_007078.3(LDB3):c.668C>T (p.Ser223Leu) rs375306400
NM_007078.3(LDB3):c.690-2A>G rs1060501315
NM_007078.3(LDB3):c.690-4A>G rs45529531
NM_007078.3(LDB3):c.715G>A (p.Val239Ile) rs201417512
NM_007078.3(LDB3):c.723C>T (p.Ser241=) rs200580597
NM_007078.3(LDB3):c.724G>A (p.Ala242Thr)
NM_007078.3(LDB3):c.72C>A (p.Asn24Lys) rs1323002546
NM_007078.3(LDB3):c.730C>G (p.Pro244Ala)
NM_007078.3(LDB3):c.733G>A (p.Val245Ile) rs573061464
NM_007078.3(LDB3):c.769G>C (p.Glu257Gln)
NM_007078.3(LDB3):c.778G>A (p.Ala260Thr) rs777637914
NM_007078.3(LDB3):c.782A>C (p.Asp261Ala) rs1285921374
NM_007078.3(LDB3):c.784G>A (p.Glu262Lys)
NM_007078.3(LDB3):c.793C>T (p.Arg265Cys) rs45521338
NM_007078.3(LDB3):c.796C>T (p.Arg266Cys)
NM_007078.3(LDB3):c.80T>C (p.Leu27Pro) rs1057517864
NM_007078.3(LDB3):c.818G>A (p.Arg273His)
NM_007078.3(LDB3):c.826C>T (p.Arg276Cys) rs397517226
NM_007078.3(LDB3):c.827G>A (p.Arg276His) rs774519585
NM_007078.3(LDB3):c.833T>G (p.Leu278Arg)
NM_007078.3(LDB3):c.858C>T (p.Phe286=) rs764056994
NM_007078.3(LDB3):c.886C>T (p.Arg296Ter) rs1060501316
NM_007078.3(LDB3):c.887G>A (p.Arg296Gln) rs201689564
NM_007078.3(LDB3):c.891G>T (p.Arg297Ser) rs374336814
NM_007078.3(LDB3):c.892T>C (p.Ser298Pro)
NM_007078.3(LDB3):c.892T>G (p.Ser298Ala)
NM_007078.3(LDB3):c.896+5G>A
NM_007078.3(LDB3):c.896+6695T>C
NM_007078.3(LDB3):c.896+6717G>A
NM_007078.3(LDB3):c.896+6721C>T rs375798002
NM_007078.3(LDB3):c.896+6723G>C rs868365512
NM_007078.3(LDB3):c.896+6730A>G
NM_007078.3(LDB3):c.896+6730A>T
NM_007078.3(LDB3):c.896+6738C>T rs377201153
NM_007078.3(LDB3):c.896+6739G>A
NM_007078.3(LDB3):c.896+6749A>G
NM_007078.3(LDB3):c.896+6753C>G
NM_007078.3(LDB3):c.896+6753C>T rs121908335
NM_007078.3(LDB3):c.896+6754G>A
NM_007078.3(LDB3):c.896+6761G>A
NM_007078.3(LDB3):c.896+6768G>A rs771037817
NM_007078.3(LDB3):c.896+6781A>C rs1589656313
NM_007078.3(LDB3):c.896+6814G>A
NM_007078.3(LDB3):c.896+6872G>A
NM_007078.3(LDB3):c.896+6957G>A rs886047354
NM_007078.3(LDB3):c.897-1_897del
NM_007078.3(LDB3):c.897-6525T>C rs886047356
NM_007078.3(LDB3):c.897-6664G>A
NM_007078.3(LDB3):c.897-6665C>T rs549156118
NM_007078.3(LDB3):c.897-6692C>T
NM_007078.3(LDB3):c.897-6700G>A
NM_007078.3(LDB3):c.897-6702C>G
NM_007078.3(LDB3):c.897-6707G>A rs537660741
NM_007078.3(LDB3):c.897-6719C>T
NM_007078.3(LDB3):c.897-6745C>T
NM_007078.3(LDB3):c.897-6759C>G rs11594242
NM_007078.3(LDB3):c.897-6831C>T rs886047355
NM_007078.3(LDB3):c.897-6834C>T rs185972751
NM_007078.3(LDB3):c.897-6861G>A
NM_007078.3(LDB3):c.897-6909G>A rs532856980
NM_007078.3(LDB3):c.897-7T>A
NM_007078.3(LDB3):c.89C>A (p.Ser30Tyr)
NM_007078.3(LDB3):c.914C>A (p.Ala305Glu)
NM_007078.3(LDB3):c.91C>G (p.Arg31Gly)
NM_007078.3(LDB3):c.91C>T (p.Arg31Trp) rs367792378
NM_007078.3(LDB3):c.92G>A (p.Arg31Gln) rs1410128172
NM_007078.3(LDB3):c.94-9T>C rs1282721488
NM_007078.3(LDB3):c.940A>G (p.Thr314Ala)
NM_007078.3(LDB3):c.944C>T (p.Pro315Leu)
NM_007078.3(LDB3):c.953C>A (p.Pro318His)
NM_007078.3(LDB3):c.955G>A (p.Ala319Thr) rs151219713
NM_007078.3(LDB3):c.991G>A (p.Ala331Thr) rs749520121
NM_007078.3(LDB3):c.992C>T (p.Ala331Val)
NM_007078.3(LDB3):c.998C>T (p.Ser333Leu)
NM_007078.3(LDB3):c.99dup (p.Pro34fs) rs1554849000

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.