ClinVar Miner

List of variants reported as uncertain significance for autosomal dominant distal myopathy by Invitae

Included ClinVar conditions (33):
Minimum submission review status: Collection method:
Minimum conflict level:
ClinVar version:
Total variants: 1763
Download table as spreadsheet
HGVS dbSNP
NC_000002.12:g.(?_219420241)_(219426000_?)dup
NC_000002.12:g.(?_219420485)_(219426000_?)dup
NC_000002.12:g.(?_70212709)_(70248440_?)del
NC_000007.13:g.(?_128470672)_(128498597_?)dup
NC_000007.13:g.(?_128498042)_(128498597_?)dup
NC_000007.13:g.(?_128498052)_(128498587_?)dup
NC_000007.14:g.(?_128830628)_(128858533_?)dup
NC_000007.14:g.(?_128835316)_(128858533_?)dup
NC_000007.14:g.(?_128842221)_(128850084_?)del
NC_000007.14:g.(?_128852581)_(128858533_?)del
NC_000007.14:g.(?_128858326)_(128858533_?)del
NC_000010.10:g.(?_88428443)_(88428547_?)dup
NC_000010.10:g.88469652-?_88492743+?dup
NC_000010.11:g.(?_86668564)_(86700053_?)del
NC_000010.11:g.(?_86668672)_(86710070_?)del
NM_001127487.2(FLNC):c.5200-323G>A rs779856224
NM_001127487.2(FLNC):c.5200-324C>T rs201926772
NM_001127487.2(FLNC):c.5200-327G>A rs376023896
NM_001127487.2(FLNC):c.5200-328C>T
NM_001127487.2(FLNC):c.5200-330G>A rs150986092
NM_001127487.2(FLNC):c.5200-331C>A rs763698034
NM_001127487.2(FLNC):c.5200-335G>A
NM_001127487.2(FLNC):c.5200-336C>T rs369187211
NM_001127487.2(FLNC):c.5200-369G>A rs764373507
NM_001127487.2(FLNC):c.5200-387G>A rs200792813
NM_001135940.2(MYOT):c.-181del rs781353247
NM_001135940.2(MYOT):c.-197+193C>T rs751876756
NM_001458.4(FLNC):c.1000C>T (p.Arg334Cys) rs372497581
NM_001458.4(FLNC):c.1001G>A (p.Arg334His) rs779347920
NM_001458.4(FLNC):c.1027A>G (p.Lys343Glu) rs745495679
NM_001458.4(FLNC):c.1040T>C (p.Leu347Ser) rs1554397631
NM_001458.4(FLNC):c.1054G>A (p.Val352Met) rs773023988
NM_001458.4(FLNC):c.1073A>G (p.Asn358Ser)
NM_001458.4(FLNC):c.1081C>T (p.Arg361Cys) rs200206944
NM_001458.4(FLNC):c.1082G>A (p.Arg361His) rs752888774
NM_001458.4(FLNC):c.1094A>G (p.Glu365Gly) rs752027721
NM_001458.4(FLNC):c.1102G>A (p.Val368Met) rs781718076
NM_001458.4(FLNC):c.1106G>C (p.Gly369Ala) rs754733061
NM_001458.4(FLNC):c.1108A>G (p.Met370Val) rs370406338
NM_001458.4(FLNC):c.1128C>A (p.Asn376Lys) rs773165378
NM_001458.4(FLNC):c.1142G>A (p.Arg381His) rs776469396
NM_001458.4(FLNC):c.1166G>A (p.Gly389Asp) rs763039506
NM_001458.4(FLNC):c.1168A>C (p.Asn390His) rs922960289
NM_001458.4(FLNC):c.1169A>G (p.Asn390Ser) rs188905854
NM_001458.4(FLNC):c.1171G>A (p.Val391Met) rs757887021
NM_001458.4(FLNC):c.1186A>G (p.Thr396Ala) rs1437029966
NM_001458.4(FLNC):c.1205C>T (p.Thr402Ile)
NM_001458.4(FLNC):c.1206T>A (p.Thr402=) rs757898362
NM_001458.4(FLNC):c.1211-5G>A
NM_001458.4(FLNC):c.1216G>A (p.Gly406Ser) rs1343684536
NM_001458.4(FLNC):c.1225G>A (p.Asp409Asn) rs371913931
NM_001458.4(FLNC):c.1228G>C (p.Val410Leu) rs993836469
NM_001458.4(FLNC):c.1243G>A (p.Val415Met) rs369182765
NM_001458.4(FLNC):c.1258C>T (p.Arg420Trp)
NM_001458.4(FLNC):c.1259G>A (p.Arg420Gln) rs371410741
NM_001458.4(FLNC):c.125T>C (p.Phe42Ser) rs777706683
NM_001458.4(FLNC):c.125T>G (p.Phe42Cys) rs777706683
NM_001458.4(FLNC):c.1261C>T (p.Arg421Trp) rs759075520
NM_001458.4(FLNC):c.1262G>A (p.Arg421Gln)
NM_001458.4(FLNC):c.127A>C (p.Thr43Pro)
NM_001458.4(FLNC):c.1282C>G (p.Leu428Val) rs1585154042
NM_001458.4(FLNC):c.1295G>T (p.Gly432Val) rs750350780
NM_001458.4(FLNC):c.1304C>T (p.Thr435Met) rs199935488
NM_001458.4(FLNC):c.1309C>G (p.Arg437Gly) rs374847180
NM_001458.4(FLNC):c.1309C>T (p.Arg437Cys) rs374847180
NM_001458.4(FLNC):c.1310G>A (p.Arg437His)
NM_001458.4(FLNC):c.1310G>T (p.Arg437Leu) rs370138936
NM_001458.4(FLNC):c.131G>T (p.Arg44Leu)
NM_001458.4(FLNC):c.1328C>T (p.Ala443Val)
NM_001458.4(FLNC):c.1348G>A (p.Val450Met) rs747550431
NM_001458.4(FLNC):c.1364C>T (p.Ala455Val) rs777210524
NM_001458.4(FLNC):c.1372C>T (p.Pro458Ser) rs369747694
NM_001458.4(FLNC):c.1373C>G (p.Pro458Arg)
NM_001458.4(FLNC):c.1382G>T (p.Arg461Leu)
NM_001458.4(FLNC):c.140A>G (p.Asn47Ser) rs770861991
NM_001458.4(FLNC):c.1420C>T (p.Pro474Ser) rs1562993431
NM_001458.4(FLNC):c.1426G>T (p.Ala476Ser) rs746359389
NM_001458.4(FLNC):c.142_162dup (p.Glu48_Gly54dup)
NM_001458.4(FLNC):c.1430G>C (p.Cys477Ser) rs560530105
NM_001458.4(FLNC):c.1433G>A (p.Arg478His) rs749593461
NM_001458.4(FLNC):c.1435G>A (p.Ala479Thr) rs772697482
NM_001458.4(FLNC):c.1445G>A (p.Arg482Gln) rs770337434
NM_001458.4(FLNC):c.1448G>A (p.Gly483Asp) rs1562993476
NM_001458.4(FLNC):c.1454A>G (p.Gln485Arg) rs1012536919
NM_001458.4(FLNC):c.1469G>A (p.Arg490His) rs1046320257
NM_001458.4(FLNC):c.1469G>T (p.Arg490Leu)
NM_001458.4(FLNC):c.1471G>A (p.Val491Met) rs770264114
NM_001458.4(FLNC):c.1471G>C (p.Val491Leu) rs770264114
NM_001458.4(FLNC):c.1474A>G (p.Lys492Glu) rs118056738
NM_001458.4(FLNC):c.1492A>G (p.Lys498Glu) rs781127889
NM_001458.4(FLNC):c.1505A>T (p.Lys502Met) rs780486915
NM_001458.4(FLNC):c.1510G>A (p.Ala504Thr) rs1562993551
NM_001458.4(FLNC):c.1513G>A (p.Gly505Ser) rs200935123
NM_001458.4(FLNC):c.1517G>A (p.Ser506Asn) rs1554398094
NM_001458.4(FLNC):c.1528A>C (p.Lys510Gln) rs955475416
NM_001458.4(FLNC):c.1535C>A (p.Thr512Lys) rs775538827
NM_001458.4(FLNC):c.1541A>C (p.Lys514Thr) rs375881193
NM_001458.4(FLNC):c.1564C>G (p.Pro522Ala)
NM_001458.4(FLNC):c.1589A>T (p.Asp530Val) rs1371853934
NM_001458.4(FLNC):c.1599C>A (p.Phe533Leu) rs768072902
NM_001458.4(FLNC):c.15C>A (p.Ser5Arg) rs759632330
NM_001458.4(FLNC):c.1605C>T (p.Cys535=) rs199976790
NM_001458.4(FLNC):c.1616C>T (p.Pro539Leu) rs375570393
NM_001458.4(FLNC):c.1645A>G (p.Ile549Val) rs547997371
NM_001458.4(FLNC):c.1673G>A (p.Arg558His) rs776881635
NM_001458.4(FLNC):c.1673G>T (p.Arg558Leu)
NM_001458.4(FLNC):c.16G>A (p.Gly6Ser)
NM_001458.4(FLNC):c.16G>C (p.Gly6Arg) rs1284761356
NM_001458.4(FLNC):c.170T>C (p.Leu57Pro) rs1585147774
NM_001458.4(FLNC):c.1723C>T (p.Arg575Trp) rs761117952
NM_001458.4(FLNC):c.1757T>C (p.Val586Ala) rs374132023
NM_001458.4(FLNC):c.1766C>T (p.Ser589Leu) rs780098760
NM_001458.4(FLNC):c.176A>G (p.Asp59Gly) rs1164296903
NM_001458.4(FLNC):c.1771G>A (p.Asp591Asn) rs768829742
NM_001458.4(FLNC):c.1802T>C (p.Val601Ala) rs763590899
NM_001458.4(FLNC):c.1813G>A (p.Gly605Ser) rs1562994122
NM_001458.4(FLNC):c.1824C>G (p.Ile608Met) rs753007069
NM_001458.4(FLNC):c.1825G>A (p.Glu609Lys) rs758389160
NM_001458.4(FLNC):c.1825G>C (p.Glu609Gln)
NM_001458.4(FLNC):c.1848C>G (p.Ile616Met) rs770173704
NM_001458.4(FLNC):c.1858G>C (p.Asp620His) rs567514134
NM_001458.4(FLNC):c.185G>A (p.Arg62His)
NM_001458.4(FLNC):c.1885C>T (p.Arg629Trp) rs759376455
NM_001458.4(FLNC):c.1886G>A (p.Arg629Gln) rs765173966
NM_001458.4(FLNC):c.1898C>T (p.Thr633Met) rs1187790496
NM_001458.4(FLNC):c.1899G>A (p.Thr633=)
NM_001458.4(FLNC):c.1915G>A (p.Ala639Thr) rs1175392094
NM_001458.4(FLNC):c.1924G>A (p.Val642Ile) rs369387744
NM_001458.4(FLNC):c.1934A>C (p.Asp645Ala) rs1554398369
NM_001458.4(FLNC):c.1935_1937del (p.Asp646del) rs765300084
NM_001458.4(FLNC):c.1936G>A (p.Asp646Asn) rs372668691
NM_001458.4(FLNC):c.1945_1953dup (p.Ile649_Asp651dup) rs1554398377
NM_001458.4(FLNC):c.1948C>G (p.Arg650Gly) rs770606675
NM_001458.4(FLNC):c.19T>G (p.Tyr7Asp)
NM_001458.4(FLNC):c.2023C>T (p.Pro675Ser) rs1227192105
NM_001458.4(FLNC):c.2033A>G (p.Glu678Gly)
NM_001458.4(FLNC):c.2036C>T (p.Pro679Leu) rs975517733
NM_001458.4(FLNC):c.2041G>A (p.Gly681Ser)
NM_001458.4(FLNC):c.2052G>A (p.Val684=) rs1554398437
NM_001458.4(FLNC):c.205C>T (p.Arg69Trp) rs758342140
NM_001458.4(FLNC):c.2062G>T (p.Ala688Ser) rs774194364
NM_001458.4(FLNC):c.2063C>T (p.Ala688Val) rs772223832
NM_001458.4(FLNC):c.2068T>C (p.Phe690Leu) rs200943714
NM_001458.4(FLNC):c.2075T>C (p.Ile692Thr) rs538863259
NM_001458.4(FLNC):c.2084G>C (p.Arg695Pro)
NM_001458.4(FLNC):c.2084G>T (p.Arg695Leu) rs766592492
NM_001458.4(FLNC):c.2093G>A (p.Gly698Asp) rs1562994518
NM_001458.4(FLNC):c.2107_2119delinsT (p.Lys703_Gln707delinsTer) rs1585156701
NM_001458.4(FLNC):c.2121+4G>A rs372098008
NM_001458.4(FLNC):c.2122-6C>G
NM_001458.4(FLNC):c.212T>C (p.Ile71Thr) rs1554396387
NM_001458.4(FLNC):c.2130C>A (p.Asp710Glu) rs778781499
NM_001458.4(FLNC):c.2141T>C (p.Ile714Thr) rs1554398541
NM_001458.4(FLNC):c.2142C>A (p.Ile714=) rs199595235
NM_001458.4(FLNC):c.2163C>A (p.Asn721Lys) rs370539335
NM_001458.4(FLNC):c.2164G>A (p.Gly722Ser) rs762248114
NM_001458.4(FLNC):c.2166C>T (p.Gly722=)
NM_001458.4(FLNC):c.2171G>A (p.Gly724Asp) rs1554398553
NM_001458.4(FLNC):c.2194C>T (p.Pro732Ser) rs1562994905
NM_001458.4(FLNC):c.2201A>G (p.Lys734Arg) rs1585157281
NM_001458.4(FLNC):c.2245G>A (p.Val749Met) rs763901270
NM_001458.4(FLNC):c.2246T>A (p.Val749Glu) rs932445396
NM_001458.4(FLNC):c.2272G>A (p.Val758Met) rs371418145
NM_001458.4(FLNC):c.2277C>T (p.Gly759=) rs534989876
NM_001458.4(FLNC):c.2278G>A (p.Glu760Lys) rs772574007
NM_001458.4(FLNC):c.2281G>A (p.Gly761Ser) rs374691339
NM_001458.4(FLNC):c.2287C>T (p.His763Tyr) rs1380984220
NM_001458.4(FLNC):c.2293G>A (p.Glu765Lys) rs373798394
NM_001458.4(FLNC):c.2296C>T (p.Arg766Trp) rs200215340
NM_001458.4(FLNC):c.2297G>A (p.Arg766Gln) rs369935650
NM_001458.4(FLNC):c.2305G>T (p.Val769Leu) rs1046022647
NM_001458.4(FLNC):c.2317G>A (p.Gly773Arg) rs1322212555
NM_001458.4(FLNC):c.232A>C (p.Ser78Arg)
NM_001458.4(FLNC):c.2364G>A (p.Thr788=) rs1020284790
NM_001458.4(FLNC):c.2375G>T (p.Ser792Ile)
NM_001458.4(FLNC):c.2376C>T (p.Ser792=) rs754097557
NM_001458.4(FLNC):c.2377G>A (p.Glu793Lys) rs187143486
NM_001458.4(FLNC):c.2380G>A (p.Ala794Thr) rs1198975298
NM_001458.4(FLNC):c.2389+4C>T rs1057523921
NM_001458.4(FLNC):c.2391C>T (p.Gly797=) rs374768092
NM_001458.4(FLNC):c.2392G>T (p.Asp798Tyr)
NM_001458.4(FLNC):c.2395G>A (p.Val799Met)
NM_001458.4(FLNC):c.2404G>A (p.Gly802Ser) rs371398126
NM_001458.4(FLNC):c.2419C>T (p.Pro807Ser) rs946201226
NM_001458.4(FLNC):c.2450T>C (p.Ile817Thr) rs200653747
NM_001458.4(FLNC):c.2459A>T (p.Asp820Val) rs886044638
NM_001458.4(FLNC):c.246G>A (p.Met82Ile) rs1554396403
NM_001458.4(FLNC):c.2470A>T (p.Asn824Tyr) rs1562995383
NM_001458.4(FLNC):c.2491G>A (p.Val831Ile) rs746478952
NM_001458.4(FLNC):c.2500A>G (p.Thr834Ala) rs781169622
NM_001458.4(FLNC):c.2512G>A (p.Ala838Thr)
NM_001458.4(FLNC):c.2513C>T (p.Ala838Val) rs775085661
NM_001458.4(FLNC):c.2519G>A (p.Arg840His)
NM_001458.4(FLNC):c.2546A>G (p.Asn849Ser) rs755425307
NM_001458.4(FLNC):c.2546A>T (p.Asn849Ile)
NM_001458.4(FLNC):c.2550G>A (p.Gln850=) rs1585158097
NM_001458.4(FLNC):c.2560G>A (p.Ala854Thr) rs749855792
NM_001458.4(FLNC):c.2587C>G (p.Pro863Ala) rs754750752
NM_001458.4(FLNC):c.2587C>T (p.Pro863Ser)
NM_001458.4(FLNC):c.2600C>T (p.Ala867Val)
NM_001458.4(FLNC):c.2602A>G (p.Ser868Gly) rs201002262
NM_001458.4(FLNC):c.2617G>A (p.Glu873Lys) rs771092335
NM_001458.4(FLNC):c.2624C>G (p.Pro875Arg) rs1418979185
NM_001458.4(FLNC):c.2635C>T (p.Arg879Cys) rs374983276
NM_001458.4(FLNC):c.2636G>A (p.Arg879His) rs367997079
NM_001458.4(FLNC):c.263C>A (p.Pro88Gln)
NM_001458.4(FLNC):c.2642G>T (p.Gly881Val) rs377095070
NM_001458.4(FLNC):c.2650G>T (p.Val884Phe) rs770379589
NM_001458.4(FLNC):c.2653G>A (p.Gly885Arg) rs769110628
NM_001458.4(FLNC):c.266G>A (p.Arg89His) rs1554396410
NM_001458.4(FLNC):c.2672C>T (p.Thr891Met)
NM_001458.4(FLNC):c.2673G>A (p.Thr891=) rs761823234
NM_001458.4(FLNC):c.2707G>A (p.Asp903Asn)
NM_001458.4(FLNC):c.2736C>T (p.Gly912=) rs768894698
NM_001458.4(FLNC):c.2747G>A (p.Arg916Gln) rs143720860
NM_001458.4(FLNC):c.2747G>T (p.Arg916Leu) rs143720860
NM_001458.4(FLNC):c.2767A>C (p.Asn923His) rs1420123492
NM_001458.4(FLNC):c.2780C>T (p.Ser927Phe) rs1585158690
NM_001458.4(FLNC):c.2782T>A (p.Tyr928Asn)
NM_001458.4(FLNC):c.2800G>A (p.Ala934Thr) rs763954095
NM_001458.4(FLNC):c.2812-4A>T
NM_001458.4(FLNC):c.282A>G (p.Gln94=) rs772401033
NM_001458.4(FLNC):c.2842G>A (p.Gly948Arg) rs768103657
NM_001458.4(FLNC):c.2845G>C (p.Asp949His) rs761905908
NM_001458.4(FLNC):c.2845G>T (p.Asp949Tyr) rs761905908
NM_001458.4(FLNC):c.2851G>T (p.Val951Phe) rs760566825
NM_001458.4(FLNC):c.2890C>A (p.Leu964Met) rs1562996103
NM_001458.4(FLNC):c.290T>C (p.Leu97Pro) rs1585147935
NM_001458.4(FLNC):c.2930-7C>A
NM_001458.4(FLNC):c.2953G>A (p.Ala985Thr) rs1179474749
NM_001458.4(FLNC):c.2967C>A (p.Asn989Lys)
NM_001458.4(FLNC):c.2984G>A (p.Gly995Asp)
NM_001458.4(FLNC):c.3005G>A (p.Arg1002Gln) rs202039743
NM_001458.4(FLNC):c.3007A>C (p.Met1003Leu)
NM_001458.4(FLNC):c.3022C>T (p.Arg1008Cys) rs757969015
NM_001458.4(FLNC):c.302C>T (p.Ser101Phe) rs1554396416
NM_001458.4(FLNC):c.3054C>T (p.Gly1018=) rs769624093
NM_001458.4(FLNC):c.3055G>T (p.Gly1019Cys) rs200864007
NM_001458.4(FLNC):c.3062C>T (p.Ala1021Val) rs574118437
NM_001458.4(FLNC):c.3065A>C (p.Glu1022Ala)
NM_001458.4(FLNC):c.3067G>C (p.Ala1023Pro) rs376107866
NM_001458.4(FLNC):c.3085A>G (p.Met1029Val) rs369078760
NM_001458.4(FLNC):c.3088C>A (p.Pro1030Thr) rs1554399034
NM_001458.4(FLNC):c.3092C>A (p.Pro1031Gln) rs372467579
NM_001458.4(FLNC):c.3092C>T (p.Pro1031Leu) rs372467579
NM_001458.4(FLNC):c.3122C>T (p.Thr1041Ile)
NM_001458.4(FLNC):c.3133C>A (p.His1045Asn) rs201863231
NM_001458.4(FLNC):c.3136C>G (p.Pro1046Ala)
NM_001458.4(FLNC):c.3137C>T (p.Pro1046Leu) rs768820218
NM_001458.4(FLNC):c.3145_3146delinsTT (p.Gly1049Phe) rs1585159401
NM_001458.4(FLNC):c.3148A>G (p.Ser1050Gly) rs773580485
NM_001458.4(FLNC):c.3152C>T (p.Pro1051Leu) rs546130026
NM_001458.4(FLNC):c.31G>A (p.Gly11Ser) rs370512642
NM_001458.4(FLNC):c.31G>T (p.Gly11Cys)
NM_001458.4(FLNC):c.3209C>T (p.Pro1070Leu) rs370391049
NM_001458.4(FLNC):c.3241G>A (p.Ala1081Thr) rs781760817
NM_001458.4(FLNC):c.3241G>T (p.Ala1081Ser) rs781760817
NM_001458.4(FLNC):c.3242C>T (p.Ala1081Val) rs200169573
NM_001458.4(FLNC):c.3260C>G (p.Thr1087Ser) rs372205719
NM_001458.4(FLNC):c.3265G>A (p.Gly1089Arg) rs1554399171
NM_001458.4(FLNC):c.3295G>A (p.Val1099Ile) rs759452636
NM_001458.4(FLNC):c.3304C>T (p.Pro1102Ser) rs199707920
NM_001458.4(FLNC):c.3310G>A (p.Glu1104Lys)
NM_001458.4(FLNC):c.3372G>A (p.Thr1124=) rs556913973
NM_001458.4(FLNC):c.3376C>G (p.Pro1126Ala) rs748785077
NM_001458.4(FLNC):c.3381C>T (p.Gly1127=)
NM_001458.4(FLNC):c.3415C>T (p.His1139Tyr) rs1562996847
NM_001458.4(FLNC):c.3426C>T (p.Gly1142=) rs201313781
NM_001458.4(FLNC):c.3428C>T (p.Ser1143Leu) rs756192123
NM_001458.4(FLNC):c.3430C>T (p.Pro1144Ser) rs1585160095
NM_001458.4(FLNC):c.3449G>A (p.Arg1150Gln)
NM_001458.4(FLNC):c.3458T>G (p.Phe1153Cys) rs138663492
NM_001458.4(FLNC):c.3475C>T (p.Arg1159Trp) rs760500171
NM_001458.4(FLNC):c.3476G>A (p.Arg1159Gln) rs141199483
NM_001458.4(FLNC):c.3488C>A (p.Pro1163Gln)
NM_001458.4(FLNC):c.3488C>T (p.Pro1163Leu) rs377489161
NM_001458.4(FLNC):c.3499C>T (p.Arg1167Cys) rs766439553
NM_001458.4(FLNC):c.3500G>A (p.Arg1167His)
NM_001458.4(FLNC):c.3511G>A (p.Gly1171Ser) rs769490872
NM_001458.4(FLNC):c.3511G>T (p.Gly1171Cys) rs769490872
NM_001458.4(FLNC):c.3518C>T (p.Ala1173Val)
NM_001458.4(FLNC):c.3529A>G (p.Thr1177Ala) rs748850596
NM_001458.4(FLNC):c.3553G>A (p.Glu1185Lys) rs912926530
NM_001458.4(FLNC):c.3581C>T (p.Ser1194Leu) rs773481064
NM_001458.4(FLNC):c.3589G>A (p.Gly1197Arg) rs753812010
NM_001458.4(FLNC):c.3592G>C (p.Val1198Leu) rs201912847
NM_001458.4(FLNC):c.3601G>A (p.Glu1201Lys) rs751963297
NM_001458.4(FLNC):c.3622G>A (p.Ala1208Thr) rs528279616
NM_001458.4(FLNC):c.3623C>T (p.Ala1208Val) rs202184162
NM_001458.4(FLNC):c.3649A>T (p.Ser1217Cys) rs759597112
NM_001458.4(FLNC):c.3680C>T (p.Thr1227Ile) rs373573447
NM_001458.4(FLNC):c.3693C>T (p.Gly1231=) rs765922145
NM_001458.4(FLNC):c.3694G>A (p.Gly1232Arg) rs754533053
NM_001458.4(FLNC):c.3703G>A (p.Val1235Met) rs1208885010
NM_001458.4(FLNC):c.370G>T (p.Asp124Tyr)
NM_001458.4(FLNC):c.3711A>C (p.Lys1237Asn) rs758220780
NM_001458.4(FLNC):c.3745G>A (p.Asp1249Asn) rs774968828
NM_001458.4(FLNC):c.3772C>T (p.Pro1258Ser) rs374764212
NM_001458.4(FLNC):c.3781G>C (p.Glu1261Gln) rs747033771
NM_001458.4(FLNC):c.3790G>A (p.Gly1264Ser) rs201335143
NM_001458.4(FLNC):c.3793G>A (p.Val1265Ile) rs368102638
NM_001458.4(FLNC):c.3799C>T (p.Arg1267Trp) rs371483562
NM_001458.4(FLNC):c.37G>A (p.Gly13Ser) rs760318519
NM_001458.4(FLNC):c.3800G>A (p.Arg1267Gln) rs768767784
NM_001458.4(FLNC):c.3803A>G (p.Glu1268Gly) rs1585161164
NM_001458.4(FLNC):c.3833G>A (p.Arg1278Lys) rs540117605
NM_001458.4(FLNC):c.3835T>C (p.Ser1279Pro) rs1562997744
NM_001458.4(FLNC):c.3853G>A (p.Gly1285Ser) rs200928780
NM_001458.4(FLNC):c.3862G>A (p.Val1288Met) rs750415476
NM_001458.4(FLNC):c.3871C>G (p.Arg1291Gly) rs753591663
NM_001458.4(FLNC):c.3871C>T (p.Arg1291Cys) rs753591663
NM_001458.4(FLNC):c.3872G>A (p.Arg1291His) rs370042010
NM_001458.4(FLNC):c.3881A>G (p.Asn1294Ser) rs944103680
NM_001458.4(FLNC):c.3887C>T (p.Ser1296Leu) rs747587140
NM_001458.4(FLNC):c.3893C>T (p.Ala1298Val) rs1064796931
NM_001458.4(FLNC):c.3905C>T (p.Thr1302Ile) rs746249435
NM_001458.4(FLNC):c.3937C>G (p.Arg1313Gly) rs766330686
NM_001458.4(FLNC):c.3938G>A (p.Arg1313Gln) rs199804244
NM_001458.4(FLNC):c.3949A>G (p.Thr1317Ala) rs377555574
NM_001458.4(FLNC):c.3967G>A (p.Val1323Met) rs771676134
NM_001458.4(FLNC):c.3982G>A (p.Val1328Ile) rs1585161584
NM_001458.4(FLNC):c.398T>C (p.Leu133Pro)
NM_001458.4(FLNC):c.4000G>A (p.Ala1334Thr) rs556477946
NM_001458.4(FLNC):c.4003G>A (p.Val1335Met)
NM_001458.4(FLNC):c.4018T>A (p.Phe1340Ile) rs775383465
NM_001458.4(FLNC):c.4018T>G (p.Phe1340Val) rs775383465
NM_001458.4(FLNC):c.4052C>T (p.Thr1351Ile) rs1585161671
NM_001458.4(FLNC):c.4054C>T (p.Arg1352Cys) rs367931139
NM_001458.4(FLNC):c.4055G>A (p.Arg1352His) rs746731567
NM_001458.4(FLNC):c.4057G>A (p.Val1353Ile)
NM_001458.4(FLNC):c.4060C>G (p.Arg1354Gly) rs138193236
NM_001458.4(FLNC):c.4061G>A (p.Arg1354Gln)
NM_001458.4(FLNC):c.4069G>A (p.Gly1357Arg) rs1218299104
NM_001458.4(FLNC):c.4073C>G (p.Pro1358Arg) rs769586047
NM_001458.4(FLNC):c.4092G>C (p.Leu1364Phe) rs768635501
NM_001458.4(FLNC):c.4097A>G (p.Asn1366Ser) rs185746835
NM_001458.4(FLNC):c.4103C>T (p.Ala1368Val)
NM_001458.4(FLNC):c.4106A>G (p.Asn1369Ser) rs1554399615
NM_001458.4(FLNC):c.4109G>A (p.Arg1370Gln) rs761881020
NM_001458.4(FLNC):c.4133C>T (p.Ala1378Val) rs748008658
NM_001458.4(FLNC):c.4141G>A (p.Gly1381Arg) rs766513255
NM_001458.4(FLNC):c.4159A>G (p.Ile1387Val) rs1032003580
NM_001458.4(FLNC):c.4184T>A (p.Met1395Lys) rs1372801269
NM_001458.4(FLNC):c.4219G>A (p.Val1407Met) rs375366821
NM_001458.4(FLNC):c.4222G>A (p.Glu1408Lys)
NM_001458.4(FLNC):c.4229T>A (p.Ile1410Asn) rs778951900
NM_001458.4(FLNC):c.4270G>A (p.Gly1424Arg) rs1202331272
NM_001458.4(FLNC):c.4289-7_4289-5del rs1286999803
NM_001458.4(FLNC):c.4300C>T (p.Arg1434Cys) rs536331212
NM_001458.4(FLNC):c.4301G>A (p.Arg1434His) rs143623535
NM_001458.4(FLNC):c.4303G>A (p.Val1435Met) rs370643162
NM_001458.4(FLNC):c.4310T>C (p.Val1437Ala) rs754170282
NM_001458.4(FLNC):c.4315G>A (p.Asp1439Asn) rs1562998835
NM_001458.4(FLNC):c.4326C>A (p.Asp1442Glu)
NM_001458.4(FLNC):c.4334A>G (p.Lys1445Arg) rs371591881
NM_001458.4(FLNC):c.4367G>C (p.Gly1456Ala) rs775049569
NM_001458.4(FLNC):c.4372A>G (p.Arg1458Gly) rs762257502
NM_001458.4(FLNC):c.4378C>T (p.Arg1460Trp)
NM_001458.4(FLNC):c.4413A>T (p.Gln1471His) rs765435961
NM_001458.4(FLNC):c.4420C>T (p.Arg1474Trp) rs372454458
NM_001458.4(FLNC):c.4421G>A (p.Arg1474Gln)
NM_001458.4(FLNC):c.4424C>T (p.Ala1475Val) rs369305865
NM_001458.4(FLNC):c.4471G>A (p.Val1491Met)
NM_001458.4(FLNC):c.4474G>A (p.Glu1492Lys) rs71581926
NM_001458.4(FLNC):c.4480C>T (p.Arg1494Trp) rs779079128
NM_001458.4(FLNC):c.4481G>A (p.Arg1494Gln) rs1241325618
NM_001458.4(FLNC):c.4497C>T (p.Gly1499=)
NM_001458.4(FLNC):c.449A>G (p.Asp150Gly) rs760711912
NM_001458.4(FLNC):c.4541C>T (p.Thr1514Met)
NM_001458.4(FLNC):c.4549G>A (p.Val1517Ile) rs532654321
NM_001458.4(FLNC):c.4556A>G (p.Tyr1519Cys) rs1012086057
NM_001458.4(FLNC):c.4565A>G (p.Gln1522Arg) rs1022106059
NM_001458.4(FLNC):c.4566G>T (p.Gln1522His) rs559667295
NM_001458.4(FLNC):c.4570G>A (p.Val1524Met) rs1358403336
NM_001458.4(FLNC):c.4576C>G (p.Arg1526Gly)
NM_001458.4(FLNC):c.4576C>T (p.Arg1526Cys) rs746275035
NM_001458.4(FLNC):c.4579A>G (p.Ser1527Gly) rs747642919
NM_001458.4(FLNC):c.4589A>G (p.Lys1530Arg) rs756526090
NM_001458.4(FLNC):c.4590G>T (p.Lys1530Asn) rs778534100
NM_001458.4(FLNC):c.4593C>G (p.Ile1531Met) rs371988433
NM_001458.4(FLNC):c.4597G>A (p.Val1533Ile) rs1554399973
NM_001458.4(FLNC):c.4616C>T (p.Ala1539Val) rs770746660
NM_001458.4(FLNC):c.4627C>T (p.Arg1543Trp) rs745648230
NM_001458.4(FLNC):c.4628G>A (p.Arg1543Gln) rs369178040
NM_001458.4(FLNC):c.4636G>A (p.Gly1546Ser) rs774263134
NM_001458.4(FLNC):c.4651G>A (p.Ala1551Thr) rs565918031
NM_001458.4(FLNC):c.4660A>C (p.Ile1554Leu) rs754224673
NM_001458.4(FLNC):c.4678G>A (p.Val1560Met)
NM_001458.4(FLNC):c.4699C>T (p.Arg1567Trp) rs369842920
NM_001458.4(FLNC):c.469C>G (p.Arg157Gly) rs759739899
NM_001458.4(FLNC):c.469C>T (p.Arg157Cys) rs759739899
NM_001458.4(FLNC):c.46G>T (p.Asp16Tyr)
NM_001458.4(FLNC):c.4700G>T (p.Arg1567Leu) rs2291569
NM_001458.4(FLNC):c.4705G>A (p.Ala1569Thr) rs768737324
NM_001458.4(FLNC):c.4707G>A (p.Ala1569=) rs541323590
NM_001458.4(FLNC):c.4708G>T (p.Gly1570Cys) rs1562999563
NM_001458.4(FLNC):c.470G>A (p.Arg157His) rs752919962
NM_001458.4(FLNC):c.4710C>T (p.Gly1570=) rs774692750
NM_001458.4(FLNC):c.4724C>G (p.Thr1575Ser)
NM_001458.4(FLNC):c.4744G>A (p.Glu1582Lys) rs753022721
NM_001458.4(FLNC):c.4762G>C (p.Ala1588Pro) rs761482137
NM_001458.4(FLNC):c.4763C>G (p.Ala1588Gly) rs148545460
NM_001458.4(FLNC):c.4771C>T (p.Arg1591Trp) rs576453637
NM_001458.4(FLNC):c.4790C>T (p.Thr1597Met) rs753742681
NM_001458.4(FLNC):c.4795A>G (p.Thr1599Ala) rs2643767
NM_001458.4(FLNC):c.479C>T (p.Thr160Met) rs1357772572
NM_001458.4(FLNC):c.4812G>A (p.Pro1604=)
NM_001458.4(FLNC):c.4825C>G (p.Arg1609Gly) rs374756527
NM_001458.4(FLNC):c.4825C>T (p.Arg1609Trp) rs374756527
NM_001458.4(FLNC):c.4826G>A (p.Arg1609Gln) rs1168628508
NM_001458.4(FLNC):c.4832C>T (p.Thr1611Ile)
NM_001458.4(FLNC):c.4871C>T (p.Ser1624Leu) rs879255639
NM_001458.4(FLNC):c.4874C>T (p.Pro1625Leu) rs1585164029
NM_001458.4(FLNC):c.4879C>T (p.Arg1627Cys) rs760407609
NM_001458.4(FLNC):c.4880G>A (p.Arg1627His) rs751592993
NM_001458.4(FLNC):c.4888G>T (p.Ala1630Ser) rs1479430297
NM_001458.4(FLNC):c.490C>T (p.Arg164Trp) rs1460797312
NM_001458.4(FLNC):c.4921G>A (p.Val1641Ile) rs575068215
NM_001458.4(FLNC):c.4925C>T (p.Thr1642Ile) rs756074974
NM_001458.4(FLNC):c.4952G>A (p.Gly1651Asp) rs762493974
NM_001458.4(FLNC):c.4970G>A (p.Arg1657Gln) rs374294752
NM_001458.4(FLNC):c.4977G>C (p.Gln1659His) rs1297786780
NM_001458.4(FLNC):c.4991C>T (p.Thr1664Met) rs780829334
NM_001458.4(FLNC):c.5000C>T (p.Thr1667Met) rs753945728
NM_001458.4(FLNC):c.5011A>G (p.Lys1671Glu) rs1563000088
NM_001458.4(FLNC):c.5026G>A (p.Gly1676Arg) rs1585164542
NM_001458.4(FLNC):c.5029A>C (p.Lys1677Gln) rs1554400214
NM_001458.4(FLNC):c.5051C>T (p.Thr1684Met) rs1294213097
NM_001458.4(FLNC):c.5055G>A (p.Pro1685=) rs57797061
NM_001458.4(FLNC):c.5071G>A (p.Asp1691Asn) rs777061037
NM_001458.4(FLNC):c.5123C>T (p.Ala1708Val) rs1011817473
NM_001458.4(FLNC):c.5128G>A (p.Glu1710Lys) rs200077114
NM_001458.4(FLNC):c.5132C>T (p.Pro1711Leu) rs748879903
NM_001458.4(FLNC):c.5155C>T (p.Arg1719Cys) rs773260834
NM_001458.4(FLNC):c.5161G>A (p.Gly1721Arg)
NM_001458.4(FLNC):c.5162G>A (p.Gly1721Glu)
NM_001458.4(FLNC):c.5165G>C (p.Gly1722Ala) rs775405275
NM_001458.4(FLNC):c.517G>T (p.Val173Leu) rs376235207
NM_001458.4(FLNC):c.5181C>A (p.Asn1727Lys) rs764500516
NM_001458.4(FLNC):c.5182A>G (p.Ser1728Gly) rs1554400248
NM_001458.4(FLNC):c.5194G>A (p.Val1732Met) rs374848954
NM_001458.4(FLNC):c.5208C>A (p.Asp1736Glu) rs1291689149
NM_001458.4(FLNC):c.520C>T (p.Pro174Ser) rs1350019040
NM_001458.4(FLNC):c.5216C>A (p.Pro1739Gln) rs745650222
NM_001458.4(FLNC):c.5216C>T (p.Pro1739Leu) rs745650222
NM_001458.4(FLNC):c.5238A>C (p.Glu1746Asp) rs1563000552
NM_001458.4(FLNC):c.5251C>T (p.Arg1751Cys) rs1585165163
NM_001458.4(FLNC):c.5257C>A (p.Pro1753Thr) rs573399358
NM_001458.4(FLNC):c.5261A>G (p.Tyr1754Cys) rs1330454582
NM_001458.4(FLNC):c.5264C>G (p.Ala1755Gly) rs1286156977
NM_001458.4(FLNC):c.5275C>T (p.Pro1759Ser) rs892618706
NM_001458.4(FLNC):c.5291C>A (p.Thr1764Lys) rs1585165259
NM_001458.4(FLNC):c.5296T>C (p.Trp1766Arg) rs751650734
NM_001458.4(FLNC):c.5298+6G>A rs373553314
NM_001458.4(FLNC):c.5311C>G (p.Pro1771Ala) rs200001272
NM_001458.4(FLNC):c.5332A>G (p.Met1778Val)
NM_001458.4(FLNC):c.5343G>A (p.Met1781Ile) rs1554400464
NM_001458.4(FLNC):c.5353T>A (p.Phe1785Ile) rs1035403005
NM_001458.4(FLNC):c.5354T>C (p.Phe1785Ser)
NM_001458.4(FLNC):c.5363T>G (p.Val1788Gly) rs573899913
NM_001458.4(FLNC):c.5374G>A (p.Ala1792Thr) rs201348102
NM_001458.4(FLNC):c.5375C>T (p.Ala1792Val) rs200233856
NM_001458.4(FLNC):c.5376G>A (p.Ala1792=) rs758648462
NM_001458.4(FLNC):c.5377G>A (p.Val1793Met) rs587780337
NM_001458.4(FLNC):c.5397A>C (p.Thr1799=)
NM_001458.4(FLNC):c.5408G>A (p.Arg1803Gln) rs757482925
NM_001458.4(FLNC):c.5410A>T (p.Met1804Leu) rs201949844
NM_001458.4(FLNC):c.5426C>T (p.Thr1809Met) rs369118592
NM_001458.4(FLNC):c.5432G>A (p.Arg1811Gln) rs369759751
NM_001458.4(FLNC):c.5444C>T (p.Thr1815Ile)
NM_001458.4(FLNC):c.5449A>T (p.Asn1817Tyr) rs373146637
NM_001458.4(FLNC):c.5451C>G (p.Asn1817Lys) rs762869314
NM_001458.4(FLNC):c.5468C>T (p.Thr1823Met) rs140857707
NM_001458.4(FLNC):c.5477A>G (p.Tyr1826Cys)
NM_001458.4(FLNC):c.5486C>T (p.Thr1829Ile) rs1585166066
NM_001458.4(FLNC):c.548G>A (p.Arg183His)
NM_001458.4(FLNC):c.5500C>T (p.His1834Tyr) rs377141822
NM_001458.4(FLNC):c.5506A>C (p.Met1836Leu)
NM_001458.4(FLNC):c.5508G>A (p.Met1836Ile)
NM_001458.4(FLNC):c.550G>A (p.Asp184Asn)
NM_001458.4(FLNC):c.5537C>T (p.Pro1846Leu) rs1408298919
NM_001458.4(FLNC):c.5540-6C>A rs201335006
NM_001458.4(FLNC):c.5540-6C>G rs201335006
NM_001458.4(FLNC):c.5545C>A (p.Pro1849Thr)
NM_001458.4(FLNC):c.5579G>A (p.Arg1860His) rs1019973830
NM_001458.4(FLNC):c.5618T>A (p.Met1873Lys)
NM_001458.4(FLNC):c.5668+4A>C rs1259876470
NM_001458.4(FLNC):c.5668+6G>A rs773119692
NM_001458.4(FLNC):c.5686G>A (p.Val1896Met) rs891651799
NM_001458.4(FLNC):c.5709G>T (p.Glu1903Asp)
NM_001458.4(FLNC):c.5716T>C (p.Cys1906Arg) rs1585166667
NM_001458.4(FLNC):c.5746G>A (p.Val1916Met) rs763551371
NM_001458.4(FLNC):c.5770G>A (p.Gly1924Arg) rs1585166739
NM_001458.4(FLNC):c.5777A>G (p.Tyr1926Cys) rs376653815
NM_001458.4(FLNC):c.5791C>T (p.Arg1931Cys) rs562155863
NM_001458.4(FLNC):c.5792G>A (p.Arg1931His) rs780685346
NM_001458.4(FLNC):c.5792G>T (p.Arg1931Leu) rs780685346
NM_001458.4(FLNC):c.5793C>G (p.Arg1931=) rs374631384
NM_001458.4(FLNC):c.5797G>A (p.Asp1933Asn) rs762297336
NM_001458.4(FLNC):c.5807A>C (p.His1936Pro)
NM_001458.4(FLNC):c.5810T>A (p.Ile1937Asn) rs1585166795
NM_001458.4(FLNC):c.5813C>T (p.Pro1938Leu) rs764747370
NM_001458.4(FLNC):c.5822C>T (p.Pro1941Leu)
NM_001458.4(FLNC):c.5828C>T (p.Thr1943Ile) rs376413798
NM_001458.4(FLNC):c.5837T>C (p.Ile1946Thr)
NM_001458.4(FLNC):c.5872A>T (p.Asn1958Tyr) rs567595947
NM_001458.4(FLNC):c.5888C>A (p.Thr1963Lys)
NM_001458.4(FLNC):c.5888C>T (p.Thr1963Met) rs772580545
NM_001458.4(FLNC):c.5893G>A (p.Val1965Met)
NM_001458.4(FLNC):c.5894T>G (p.Val1965Gly) rs1585167670
NM_001458.4(FLNC):c.5909C>T (p.Thr1970Ile) rs1563002254
NM_001458.4(FLNC):c.590A>G (p.Asn197Ser)
NM_001458.4(FLNC):c.5935G>A (p.Ala1979Thr)
NM_001458.4(FLNC):c.5945G>A (p.Arg1982His)
NM_001458.4(FLNC):c.5954C>T (p.Ser1985Leu) rs200415625
NM_001458.4(FLNC):c.5955G>A (p.Ser1985=) rs777895128
NM_001458.4(FLNC):c.595G>A (p.Ala199Thr) rs1410315376
NM_001458.4(FLNC):c.5962G>A (p.Glu1988Lys)
NM_001458.4(FLNC):c.5978T>G (p.Leu1993Arg)
NM_001458.4(FLNC):c.5984G>A (p.Arg1995His) rs371508414
NM_001458.4(FLNC):c.5995C>T (p.Arg1999Trp)
NM_001458.4(FLNC):c.5996G>A (p.Arg1999Gln) rs1346364708
NM_001458.4(FLNC):c.59A>C (p.Glu20Ala) rs1478918808
NM_001458.4(FLNC):c.6002T>C (p.Ile2001Thr) rs1554400940
NM_001458.4(FLNC):c.6005G>T (p.Gly2002Val) rs747796553
NM_001458.4(FLNC):c.6022A>G (p.Lys2008Glu) rs772621794
NM_001458.4(FLNC):c.6040G>A (p.Val2014Met) rs772477251
NM_001458.4(FLNC):c.6041T>C (p.Val2014Ala)
NM_001458.4(FLNC):c.6043G>A (p.Val2015Met) rs775231810
NM_001458.4(FLNC):c.6052C>T (p.Arg2018Cys) rs1335627502
NM_001458.4(FLNC):c.6053G>A (p.Arg2018His) rs764326184
NM_001458.4(FLNC):c.6058A>T (p.Ser2020Cys) rs537114122
NM_001458.4(FLNC):c.6095T>C (p.Leu2032Pro) rs1554400980
NM_001458.4(FLNC):c.6104C>T (p.Pro2035Leu)
NM_001458.4(FLNC):c.6121G>C (p.Ala2041Pro) rs745842738
NM_001458.4(FLNC):c.6122C>A (p.Ala2041Asp) rs1585168065
NM_001458.4(FLNC):c.6134G>A (p.Arg2045Gln) rs747196571
NM_001458.4(FLNC):c.613G>A (p.Asp205Asn) rs767740333
NM_001458.4(FLNC):c.6148G>A (p.Gly2050Arg) rs1585168103
NM_001458.4(FLNC):c.6149G>A (p.Gly2050Glu) rs1261109029
NM_001458.4(FLNC):c.6160G>A (p.Gly2054Arg)
NM_001458.4(FLNC):c.6170T>C (p.Phe2057Ser) rs1554400996
NM_001458.4(FLNC):c.6200G>A (p.Arg2067His) rs776520014
NM_001458.4(FLNC):c.6208+4C>T rs1554401011
NM_001458.4(FLNC):c.6209-3C>G rs896971028
NM_001458.4(FLNC):c.6246C>T (p.Ser2082=) rs1554401089
NM_001458.4(FLNC):c.6278A>C (p.Asp2093Ala) rs749292393
NM_001458.4(FLNC):c.6283A>G (p.Thr2095Ala) rs373022507
NM_001458.4(FLNC):c.6296C>A (p.Thr2099Asn)
NM_001458.4(FLNC):c.6310G>A (p.Glu2104Lys) rs753069149
NM_001458.4(FLNC):c.6325A>G (p.Ile2109Val) rs755736125
NM_001458.4(FLNC):c.6355G>A (p.Val2119Met) rs748095197
NM_001458.4(FLNC):c.6359C>G (p.Pro2120Arg)
NM_001458.4(FLNC):c.635A>G (p.Asn212Ser) rs756723697
NM_001458.4(FLNC):c.635A>T (p.Asn212Ile) rs756723697
NM_001458.4(FLNC):c.6374C>G (p.Thr2125Ser)
NM_001458.4(FLNC):c.6388G>A (p.Gly2130Ser) rs375778608
NM_001458.4(FLNC):c.6390C>T (p.Gly2130=) rs746751083
NM_001458.4(FLNC):c.6391G>A (p.Glu2131Lys)
NM_001458.4(FLNC):c.6397C>T (p.Arg2133Cys) rs1186464414
NM_001458.4(FLNC):c.6419G>A (p.Arg2140Gln) rs368662317
NM_001458.4(FLNC):c.6428A>G (p.Gln2143Arg)
NM_001458.4(FLNC):c.643G>A (p.Val215Met) rs754309921
NM_001458.4(FLNC):c.6451G>A (p.Gly2151Ser)
NM_001458.4(FLNC):c.6451G>T (p.Gly2151Cys) rs1563003159
NM_001458.4(FLNC):c.6460T>A (p.Cys2154Ser) rs1554401153
NM_001458.4(FLNC):c.6490T>C (p.Trp2164Arg)
NM_001458.4(FLNC):c.64C>T (p.Pro22Ser) rs368812043
NM_001458.4(FLNC):c.6517C>T (p.Arg2173Cys) rs767250474
NM_001458.4(FLNC):c.6526C>T (p.Arg2176Cys) rs376885778
NM_001458.4(FLNC):c.652G>A (p.Ala218Thr) rs777415462
NM_001458.4(FLNC):c.6530C>A (p.Thr2177Asn)
NM_001458.4(FLNC):c.6533T>C (p.Phe2178Ser) rs1554401204
NM_001458.4(FLNC):c.6538C>T (p.Arg2180Cys) rs779029827
NM_001458.4(FLNC):c.6539G>A (p.Arg2180His)
NM_001458.4(FLNC):c.6539G>C (p.Arg2180Pro) rs1554401209
NM_001458.4(FLNC):c.6551C>G (p.Thr2184Ser) rs772588219
NM_001458.4(FLNC):c.6569G>A (p.Arg2190His) rs762680314
NM_001458.4(FLNC):c.6572C>T (p.Thr2191Met) rs768329311
NM_001458.4(FLNC):c.6587C>T (p.Thr2196Met)
NM_001458.4(FLNC):c.6590G>A (p.Arg2197Gln) rs760535041
NM_001458.4(FLNC):c.6593G>A (p.Gly2198Asp) rs909093665
NM_001458.4(FLNC):c.6595G>A (p.Gly2199Arg) rs368977589
NM_001458.4(FLNC):c.6602C>T (p.Thr2201Ile) rs1585169205
NM_001458.4(FLNC):c.6607C>T (p.Arg2203Cys)
NM_001458.4(FLNC):c.6608G>A (p.Arg2203His)
NM_001458.4(FLNC):c.661G>A (p.Ala221Thr) rs1585152566
NM_001458.4(FLNC):c.6632C>T (p.Thr2211Ile)
NM_001458.4(FLNC):c.6640G>A (p.Gly2214Ser) rs1431110219
NM_001458.4(FLNC):c.6642C>T (p.Gly2214=) rs546247674
NM_001458.4(FLNC):c.6659C>T (p.Ala2220Val) rs370839908
NM_001458.4(FLNC):c.6665T>C (p.Phe2222Ser) rs1554401281
NM_001458.4(FLNC):c.6683G>A (p.Arg2228Gln) rs765438770
NM_001458.4(FLNC):c.6689G>A (p.Arg2230His) rs376035195
NM_001458.4(FLNC):c.6689G>T (p.Arg2230Leu) rs376035195
NM_001458.4(FLNC):c.6711C>G (p.Ile2237Met) rs781708543
NM_001458.4(FLNC):c.6715C>T (p.Arg2239Trp) rs367820987
NM_001458.4(FLNC):c.6724G>A (p.Glu2242Lys) rs1265897548
NM_001458.4(FLNC):c.6727+3G>A
NM_001458.4(FLNC):c.6728G>A (p.Gly2243Asp)
NM_001458.4(FLNC):c.6748A>C (p.Met2250Leu) rs923795184
NM_001458.4(FLNC):c.6754G>A (p.Ala2252Thr) rs963272191
NM_001458.4(FLNC):c.676G>A (p.Asp226Asn) rs745775171
NM_001458.4(FLNC):c.6779A>G (p.Lys2260Arg) rs751019991
NM_001458.4(FLNC):c.6799G>A (p.Val2267Ile) rs758080422
NM_001458.4(FLNC):c.6817G>A (p.Ala2273Thr) rs372251350
NM_001458.4(FLNC):c.6830G>A (p.Arg2277His)
NM_001458.4(FLNC):c.6849G>A (p.Met2283Ile) rs1375490850
NM_001458.4(FLNC):c.6878G>A (p.Arg2293His) rs1034483511
NM_001458.4(FLNC):c.6889G>A (p.Val2297Met) rs1420394583
NM_001458.4(FLNC):c.6893C>T (p.Pro2298Leu) rs1382734231
NM_001458.4(FLNC):c.6895G>A (p.Gly2299Ser) rs756870838
NM_001458.4(FLNC):c.6923C>T (p.Pro2308Leu) rs369250297
NM_001458.4(FLNC):c.6953G>A (p.Arg2318Gln) rs749235580
NM_001458.4(FLNC):c.6958G>A (p.Gly2320Arg) rs867808948
NM_001458.4(FLNC):c.6977G>A (p.Arg2326Gln) rs201028676
NM_001458.4(FLNC):c.6986C>G (p.Ala2329Gly) rs746991573
NM_001458.4(FLNC):c.6997+4A>G rs1227552125
NM_001458.4(FLNC):c.6998-6C>G
NM_001458.4(FLNC):c.7000G>A (p.Glu2334Lys)
NM_001458.4(FLNC):c.7016C>T (p.Thr2339Ile) rs1554401463
NM_001458.4(FLNC):c.7070_7072del (p.Ala2357del) rs1554401479
NM_001458.4(FLNC):c.7075A>G (p.Ile2359Val) rs1554401481
NM_001458.4(FLNC):c.7078G>A (p.Ala2360Thr) rs1390516682
NM_001458.4(FLNC):c.7090C>A (p.Arg2364Ser) rs374973240
NM_001458.4(FLNC):c.7090C>T (p.Arg2364Cys) rs374973240
NM_001458.4(FLNC):c.7094A>G (p.Lys2365Arg) rs751765487
NM_001458.4(FLNC):c.7108G>A (p.Gly2370Ser) rs201917318
NM_001458.4(FLNC):c.7111G>A (p.Val2371Ile) rs552252122
NM_001458.4(FLNC):c.7123G>A (p.Val2375Ile) rs768941858
NM_001458.4(FLNC):c.7138G>C (p.Asp2380His) rs1334300883
NM_001458.4(FLNC):c.7171C>T (p.His2391Tyr) rs1554401558
NM_001458.4(FLNC):c.7176C>G (p.Ile2392Met) rs1585170543
NM_001458.4(FLNC):c.7177C>G (p.Pro2393Ala) rs1554401559
NM_001458.4(FLNC):c.7180G>C (p.Asp2394His) rs1554401561
NM_001458.4(FLNC):c.7198C>G (p.Pro2400Ala) rs1390223951
NM_001458.4(FLNC):c.7222G>A (p.Ala2408Thr) rs376257910
NM_001458.4(FLNC):c.7226G>A (p.Arg2409His) rs767279710
NM_001458.4(FLNC):c.7229G>A (p.Arg2410His) rs558239439
NM_001458.4(FLNC):c.7280C>T (p.Ala2427Val) rs1343869103
NM_001458.4(FLNC):c.7289C>T (p.Ala2430Val) rs200516164
NM_001458.4(FLNC):c.7309C>T (p.Arg2437Trp) rs756353876
NM_001458.4(FLNC):c.7310G>A (p.Arg2437Gln) rs201762568
NM_001458.4(FLNC):c.7313_7330dup (p.Gly2438_Arg2443dup) rs1554401762
NM_001458.4(FLNC):c.7319T>C (p.Ile2440Thr) rs764628080
NM_001458.4(FLNC):c.731A>G (p.Asn244Ser) rs773579752
NM_001458.4(FLNC):c.7327C>T (p.Arg2443Trp) rs1585171621
NM_001458.4(FLNC):c.7328G>A (p.Arg2443Gln) rs370293647
NM_001458.4(FLNC):c.7339C>A (p.Pro2447Thr) rs1554401770
NM_001458.4(FLNC):c.7343C>T (p.Ser2448Leu)
NM_001458.4(FLNC):c.7364A>G (p.Tyr2455Cys) rs769298304
NM_001458.4(FLNC):c.7366G>A (p.Val2456Ile) rs770796119
NM_001458.4(FLNC):c.7382G>A (p.Ser2461Asn) rs550547714
NM_001458.4(FLNC):c.7390C>G (p.His2464Asp) rs1269055454
NM_001458.4(FLNC):c.7399C>T (p.Arg2467Cys) rs1278916117
NM_001458.4(FLNC):c.7400G>A (p.Arg2467His) rs775910704
NM_001458.4(FLNC):c.7423G>A (p.Val2475Ile) rs191224002
NM_001458.4(FLNC):c.7432A>G (p.Ile2478Val) rs1430261045
NM_001458.4(FLNC):c.7450G>A (p.Gly2484Ser) rs778922568
NM_001458.4(FLNC):c.7455C>G (p.Ala2485=) rs1554401819
NM_001458.4(FLNC):c.7462C>T (p.Pro2488Ser) rs1563005191
NM_001458.4(FLNC):c.7484G>A (p.Arg2495His) rs757219498
NM_001458.4(FLNC):c.7487T>C (p.Val2496Ala)
NM_001458.4(FLNC):c.7529C>T (p.Ala2510Val)
NM_001458.4(FLNC):c.7546G>A (p.Glu2516Lys) rs373691962
NM_001458.4(FLNC):c.7560C>T (p.Thr2520=) rs527921534
NM_001458.4(FLNC):c.7564G>A (p.Val2522Met)
NM_001458.4(FLNC):c.7580T>C (p.Ile2527Thr) rs749891076
NM_001458.4(FLNC):c.7604C>T (p.Ser2535Leu) rs201895675
NM_001458.4(FLNC):c.7605G>A (p.Ser2535=) rs777724201
NM_001458.4(FLNC):c.7606G>A (p.Gly2536Arg)
NM_001458.4(FLNC):c.7610C>A (p.Ala2537Asp) rs1394723230
NM_001458.4(FLNC):c.7618G>C (p.Val2540Leu) rs746349463
NM_001458.4(FLNC):c.7626T>G (p.Ile2542Met) rs1554401890
NM_001458.4(FLNC):c.7636T>A (p.Ser2546Thr) rs200673841
NM_001458.4(FLNC):c.7647G>T (p.Gln2549His)
NM_001458.4(FLNC):c.7651G>C (p.Asp2551His) rs1187923021
NM_001458.4(FLNC):c.7657C>T (p.Arg2553Trp) rs199519281
NM_001458.4(FLNC):c.7658G>A (p.Arg2553Gln) rs375213102
NM_001458.4(FLNC):c.7664G>C (p.Cys2555Ser) rs1585172407
NM_001458.4(FLNC):c.7679T>C (p.Val2560Ala) rs931678640
NM_001458.4(FLNC):c.7693C>T (p.Pro2565Ser) rs1554401906
NM_001458.4(FLNC):c.76A>G (p.Lys26Glu) rs1562988843
NM_001458.4(FLNC):c.7727A>C (p.Lys2576Thr) rs1554401912
NM_001458.4(FLNC):c.7732G>A (p.Gly2578Ser) rs566747845
NM_001458.4(FLNC):c.7781-3C>T rs1444704657
NM_001458.4(FLNC):c.7784C>T (p.Pro2595Leu) rs756144972
NM_001458.4(FLNC):c.7813G>A (p.Glu2605Lys) rs1480530077
NM_001458.4(FLNC):c.7823C>T (p.Thr2608Met) rs1175931652
NM_001458.4(FLNC):c.7834G>A (p.Glu2612Lys) rs1183050599
NM_001458.4(FLNC):c.7861C>T (p.Arg2621Trp) rs1411832198
NM_001458.4(FLNC):c.7877G>A (p.Ser2626Asn) rs2639142
NM_001458.4(FLNC):c.7903G>A (p.Ala2635Thr) rs1009545372
NM_001458.4(FLNC):c.7906A>T (p.Ser2636Cys) rs1563005954
NM_001458.4(FLNC):c.7922G>A (p.Arg2641Gln) rs760857362
NM_001458.4(FLNC):c.7929del (p.Leu2645fs) rs1554402015
NM_001458.4(FLNC):c.7948G>A (p.Val2650Met) rs372172779
NM_001458.4(FLNC):c.7972G>A (p.Val2658Met) rs1269145751
NM_001458.4(FLNC):c.8013C>T (p.Gly2671=) rs369678123
NM_001458.4(FLNC):c.8019C>G (p.His2673Gln) rs112180788
NM_001458.4(FLNC):c.8020G>A (p.Gly2674Ser) rs372338218
NM_001458.4(FLNC):c.8047T>A (p.Tyr2683Asn)
NM_001458.4(FLNC):c.8051T>C (p.Val2684Ala) rs1585173265
NM_001458.4(FLNC):c.8059A>G (p.Met2687Val)
NM_001458.4(FLNC):c.8069G>A (p.Arg2690Gln) rs1585173273
NM_001458.4(FLNC):c.806G>A (p.Arg269Gln) rs1585152863
NM_001458.4(FLNC):c.8070G>T (p.Arg2690=) rs373087529
NM_001458.4(FLNC):c.8089A>G (p.Thr2697Ala) rs1292665355
NM_001458.4(FLNC):c.8107del (p.Asp2703fs) rs1563006160
NM_001458.4(FLNC):c.8113A>C (p.Ile2705Leu)
NM_001458.4(FLNC):c.8114T>C (p.Ile2705Thr)
NM_001458.4(FLNC):c.8121T>G (p.Ile2707Met)
NM_001458.4(FLNC):c.8140dup (p.Ser2714fs) rs1554402084
NM_001458.4(FLNC):c.8156C>T (p.Pro2719Leu) rs1585173375
NM_001458.4(FLNC):c.8178A>G (p.Ter2726Trp) rs1563006225
NM_001458.4(FLNC):c.81C>A (p.Asp27Glu)
NM_001458.4(FLNC):c.824C>T (p.Pro275Leu) rs1249075788
NM_001458.4(FLNC):c.850+4T>G
NM_001458.4(FLNC):c.856G>C (p.Glu286Gln) rs1274480597
NM_001458.4(FLNC):c.874G>A (p.Val292Met) rs1275499234
NM_001458.4(FLNC):c.874G>T (p.Val292Leu) rs1275499234
NM_001458.4(FLNC):c.896C>T (p.Thr299Ile)
NM_001458.4(FLNC):c.896_897delinsTT (p.Thr299Ile) rs1562992080
NM_001458.4(FLNC):c.898G>A (p.Val300Met)
NM_001458.4(FLNC):c.904A>G (p.Thr302Ala) rs1410531577
NM_001458.4(FLNC):c.905C>T (p.Thr302Met)
NM_001458.4(FLNC):c.907G>A (p.Val303Met) rs1554397562
NM_001458.4(FLNC):c.919G>A (p.Val307Met) rs763968152
NM_001458.4(FLNC):c.925G>A (p.Glu309Lys) rs781212262
NM_001458.4(FLNC):c.949C>A (p.Pro317Thr) rs1562992145
NM_001458.4(FLNC):c.967G>A (p.Glu323Lys) rs1562992158
NM_001458.4(FLNC):c.969+4T>G rs953435954
NM_001458.4(FLNC):c.970-4A>G rs532143625
NM_001458.4(FLNC):c.992A>G (p.Asp331Gly)
NM_001458.5(FLNC):c.1007A>G (p.Tyr336Cys)
NM_001458.5(FLNC):c.1019A>G (p.Tyr340Cys)
NM_001458.5(FLNC):c.1066G>A (p.Gly356Ser)
NM_001458.5(FLNC):c.1097T>C (p.Val366Ala)
NM_001458.5(FLNC):c.1123G>A (p.Ala375Thr)
NM_001458.5(FLNC):c.1129A>G (p.Lys377Glu)
NM_001458.5(FLNC):c.1131G>C (p.Lys377Asn)
NM_001458.5(FLNC):c.1135T>G (p.Ser379Ala)
NM_001458.5(FLNC):c.1141C>T (p.Arg381Cys)
NM_001458.5(FLNC):c.1208C>A (p.Ala403Glu)
NM_001458.5(FLNC):c.1209G>A (p.Ala403=)
NM_001458.5(FLNC):c.1210+5G>A
NM_001458.5(FLNC):c.1301G>A (p.Ser434Asn)
NM_001458.5(FLNC):c.1303A>G (p.Thr435Ala)
NM_001458.5(FLNC):c.130C>T (p.Arg44Cys)
NM_001458.5(FLNC):c.1332G>A (p.Met444Ile)
NM_001458.5(FLNC):c.1381C>T (p.Arg461Cys)
NM_001458.5(FLNC):c.1382G>A (p.Arg461His)
NM_001458.5(FLNC):c.1406C>T (p.Ser469Leu)
NM_001458.5(FLNC):c.1407G>A (p.Ser469=)
NM_001458.5(FLNC):c.1412-3del
NM_001458.5(FLNC):c.1432C>T (p.Arg478Cys)
NM_001458.5(FLNC):c.152A>G (p.Lys51Arg)
NM_001458.5(FLNC):c.1603T>G (p.Cys535Gly)
NM_001458.5(FLNC):c.1609T>G (p.Tyr537Asp)
NM_001458.5(FLNC):c.1618G>T (p.Val540Leu)
NM_001458.5(FLNC):c.161G>A (p.Gly54Asp)
NM_001458.5(FLNC):c.161G>T (p.Gly54Val)
NM_001458.5(FLNC):c.1672C>T (p.Arg558Cys)
NM_001458.5(FLNC):c.1688T>C (p.Val563Ala)
NM_001458.5(FLNC):c.1712T>C (p.Val571Ala)
NM_001458.5(FLNC):c.1724G>C (p.Arg575Pro)
NM_001458.5(FLNC):c.1735C>A (p.Pro579Thr)
NM_001458.5(FLNC):c.179T>A (p.Leu60Gln)
NM_001458.5(FLNC):c.1814-3C>G
NM_001458.5(FLNC):c.1816T>G (p.Phe606Val)
NM_001458.5(FLNC):c.1822A>G (p.Ile608Val)
NM_001458.5(FLNC):c.1840G>A (p.Ala614Thr)
NM_001458.5(FLNC):c.1851A>T (p.Glu617Asp)
NM_001458.5(FLNC):c.1857C>G (p.Asp619Glu)
NM_001458.5(FLNC):c.1858G>A (p.Asp620Asn)
NM_001458.5(FLNC):c.1867G>A (p.Asp623Asn)
NM_001458.5(FLNC):c.1893G>C (p.Trp631Cys)
NM_001458.5(FLNC):c.1958C>T (p.Pro653Leu)
NM_001458.5(FLNC):c.1963A>G (p.Ile655Val)
NM_001458.5(FLNC):c.200G>T (p.Gly67Val)
NM_001458.5(FLNC):c.2035C>T (p.Pro679Ser)
NM_001458.5(FLNC):c.2050G>A (p.Val684Met)
NM_001458.5(FLNC):c.2062G>A (p.Ala688Thr)
NM_001458.5(FLNC):c.2072C>T (p.Thr691Ile)
NM_001458.5(FLNC):c.2081C>T (p.Ala694Val)
NM_001458.5(FLNC):c.2084G>A (p.Arg695His)
NM_001458.5(FLNC):c.2092G>A (p.Gly698Ser)
NM_001458.5(FLNC):c.2114A>C (p.Tyr705Ser)
NM_001458.5(FLNC):c.2124C>A (p.Asp708Glu)
NM_001458.5(FLNC):c.2155A>T (p.Ile719Phe)
NM_001458.5(FLNC):c.2167G>A (p.Asp723Asn)
NM_001458.5(FLNC):c.2168A>T (p.Asp723Val)
NM_001458.5(FLNC):c.2179C>T (p.Arg727Cys)
NM_001458.5(FLNC):c.2191G>A (p.Val731Met)
NM_001458.5(FLNC):c.2202G>C (p.Lys734Asn)
NM_001458.5(FLNC):c.2212C>G (p.His738Asp)
NM_001458.5(FLNC):c.2216C>T (p.Thr739Ile)
NM_001458.5(FLNC):c.2224A>G (p.Ile742Val)
NM_001458.5(FLNC):c.2239G>A (p.Val747Ile)
NM_001458.5(FLNC):c.2248C>G (p.Pro750Ala)
NM_001458.5(FLNC):c.2263C>T (p.Arg755Trp)
NM_001458.5(FLNC):c.2264G>A (p.Arg755Gln)
NM_001458.5(FLNC):c.2265+5G>A
NM_001458.5(FLNC):c.2311G>A (p.Gly771Ser)
NM_001458.5(FLNC):c.2321T>C (p.Val774Ala)
NM_001458.5(FLNC):c.2329A>G (p.Thr777Ala)
NM_001458.5(FLNC):c.2353A>G (p.Thr785Ala)
NM_001458.5(FLNC):c.2361C>G (p.Phe787Leu)
NM_001458.5(FLNC):c.2363C>G (p.Thr788Arg)
NM_001458.5(FLNC):c.2363C>T (p.Thr788Met)
NM_001458.5(FLNC):c.2389+5G>A
NM_001458.5(FLNC):c.2406C>T (p.Gly802=)
NM_001458.5(FLNC):c.2416G>A (p.Ala806Thr)
NM_001458.5(FLNC):c.241C>T (p.Arg81Cys)
NM_001458.5(FLNC):c.2424C>T (p.Gly808=)
NM_001458.5(FLNC):c.2425G>A (p.Val809Met)
NM_001458.5(FLNC):c.2426TGG[1] (p.Val810del) rs1585157919
NM_001458.5(FLNC):c.2428G>C (p.Val810Leu)
NM_001458.5(FLNC):c.2434C>T (p.Pro812Ser)
NM_001458.5(FLNC):c.2458G>A (p.Asp820Asn)
NM_001458.5(FLNC):c.245T>G (p.Met82Arg)
NM_001458.5(FLNC):c.2489C>T (p.Thr830Ile)
NM_001458.5(FLNC):c.2518C>T (p.Arg840Cys)
NM_001458.5(FLNC):c.2527A>T (p.Ile843Phe)
NM_001458.5(FLNC):c.2551-3C>T
NM_001458.5(FLNC):c.2557C>T (p.Pro853Ser)
NM_001458.5(FLNC):c.2582T>G (p.Val861Gly)
NM_001458.5(FLNC):c.2596G>A (p.Asp866Asn)
NM_001458.5(FLNC):c.2627G>T (p.Gly876Val)
NM_001458.5(FLNC):c.2639C>T (p.Thr880Ile)
NM_001458.5(FLNC):c.2642-3C>T
NM_001458.5(FLNC):c.2674G>A (p.Val892Met)
NM_001458.5(FLNC):c.269C>G (p.Pro90Arg)
NM_001458.5(FLNC):c.2710G>A (p.Val904Met)
NM_001458.5(FLNC):c.2737G>A (p.Glu913Lys)
NM_001458.5(FLNC):c.273C>A (p.Asn91Lys)
NM_001458.5(FLNC):c.2776T>G (p.Tyr926Asp)
NM_001458.5(FLNC):c.2780C>A (p.Ser927Tyr)
NM_001458.5(FLNC):c.2780_2782del (p.Ser927del)
NM_001458.5(FLNC):c.2782T>C (p.Tyr928His)
NM_001458.5(FLNC):c.2794T>A (p.Tyr932Asn)
NM_001458.5(FLNC):c.2811+5G>A
NM_001458.5(FLNC):c.2811+6C>T
NM_001458.5(FLNC):c.2821G>A (p.Ala941Thr)
NM_001458.5(FLNC):c.2825T>C (p.Val942Ala)
NM_001458.5(FLNC):c.2843G>A (p.Gly948Glu)
NM_001458.5(FLNC):c.2847C>A (p.Asp949Glu)
NM_001458.5(FLNC):c.2847C>G (p.Asp949Glu)
NM_001458.5(FLNC):c.2862C>G (p.Ser954Arg)
NM_001458.5(FLNC):c.2884C>A (p.Pro962Thr)
NM_001458.5(FLNC):c.2888C>T (p.Pro963Leu)
NM_001458.5(FLNC):c.290T>G (p.Leu97Arg)
NM_001458.5(FLNC):c.2930-5C>G
NM_001458.5(FLNC):c.2930A>G (p.Lys977Arg)
NM_001458.5(FLNC):c.2975G>A (p.Gly992Glu)
NM_001458.5(FLNC):c.2983G>A (p.Gly995Ser)
NM_001458.5(FLNC):c.3001G>A (p.Val1001Met)
NM_001458.5(FLNC):c.3004C>T (p.Arg1002Trp)
NM_001458.5(FLNC):c.3023G>A (p.Arg1008His)
NM_001458.5(FLNC):c.3032T>C (p.Ile1011Thr)
NM_001458.5(FLNC):c.3079C>T (p.Arg1027Cys)
NM_001458.5(FLNC):c.3093G>A (p.Pro1031=)
NM_001458.5(FLNC):c.3115G>A (p.Asp1039Asn)
NM_001458.5(FLNC):c.3118A>G (p.Ile1040Val)
NM_001458.5(FLNC):c.3127G>A (p.Asp1043Asn)
NM_001458.5(FLNC):c.3234C>T (p.Gly1078=)
NM_001458.5(FLNC):c.3238C>T (p.Pro1080Ser)
NM_001458.5(FLNC):c.3256G>A (p.Asp1086Asn)
NM_001458.5(FLNC):c.3264G>A (p.Lys1088=)
NM_001458.5(FLNC):c.3266G>A (p.Gly1089Glu)
NM_001458.5(FLNC):c.3275C>A (p.Thr1092Lys)
NM_001458.5(FLNC):c.3278G>A (p.Gly1093Asp)
NM_001458.5(FLNC):c.3313G>T (p.Ala1105Ser)
NM_001458.5(FLNC):c.3322G>A (p.Glu1108Lys)
NM_001458.5(FLNC):c.3358A>G (p.Ser1120Gly)
NM_001458.5(FLNC):c.3371C>A (p.Thr1124Lys)
NM_001458.5(FLNC):c.3371C>T (p.Thr1124Met)
NM_001458.5(FLNC):c.3377C>G (p.Pro1126Arg)
NM_001458.5(FLNC):c.3382G>A (p.Glu1128Lys)
NM_001458.5(FLNC):c.3391A>G (p.Ile1131Val)
NM_001458.5(FLNC):c.341T>C (p.Leu114Pro)
NM_001458.5(FLNC):c.3431C>T (p.Pro1144Leu)
NM_001458.5(FLNC):c.3443C>T (p.Thr1148Ile)
NM_001458.5(FLNC):c.3448C>T (p.Arg1150Trp)
NM_001458.5(FLNC):c.3454G>T (p.Val1152Leu)
NM_001458.5(FLNC):c.3463C>G (p.Pro1155Ala)
NM_001458.5(FLNC):c.3467G>A (p.Ser1156Asn)
NM_001458.5(FLNC):c.3502G>A (p.Gly1168Ser)
NM_001458.5(FLNC):c.3512G>A (p.Gly1171Asp)
NM_001458.5(FLNC):c.352+3C>T
NM_001458.5(FLNC):c.3539G>T (p.Cys1180Phe)
NM_001458.5(FLNC):c.3541T>C (p.Ser1181Pro)
NM_001458.5(FLNC):c.3572A>G (p.Glu1191Gly)
NM_001458.5(FLNC):c.3601G>C (p.Glu1201Gln)
NM_001458.5(FLNC):c.3621C>G (p.Asn1207Lys)
NM_001458.5(FLNC):c.3692G>A (p.Gly1231Asp)
NM_001458.5(FLNC):c.3693_3695dup (p.Gly1232dup)
NM_001458.5(FLNC):c.3706C>T (p.Pro1236Ser)
NM_001458.5(FLNC):c.3713T>C (p.Phe1238Ser)
NM_001458.5(FLNC):c.3713T>G (p.Phe1238Cys)
NM_001458.5(FLNC):c.3722G>A (p.Arg1241His)
NM_001458.5(FLNC):c.3781G>A (p.Glu1261Lys)
NM_001458.5(FLNC):c.37G>C (p.Gly13Arg)
NM_001458.5(FLNC):c.3805G>T (p.Val1269Leu)
NM_001458.5(FLNC):c.3829G>A (p.Ala1277Thr)
NM_001458.5(FLNC):c.3832A>G (p.Arg1278Gly)
NM_001458.5(FLNC):c.3851G>A (p.Gly1284Asp)
NM_001458.5(FLNC):c.3862G>C (p.Val1288Leu)
NM_001458.5(FLNC):c.3866C>T (p.Thr1289Met)
NM_001458.5(FLNC):c.3881A>T (p.Asn1294Ile)
NM_001458.5(FLNC):c.3905_3919dup (p.Thr1302_Asp1306dup)
NM_001458.5(FLNC):c.3908A>T (p.Tyr1303Phe)
NM_001458.5(FLNC):c.3956A>G (p.Tyr1319Cys)
NM_001458.5(FLNC):c.3958G>A (p.Glu1320Lys)
NM_001458.5(FLNC):c.400A>G (p.Ile134Val)
NM_001458.5(FLNC):c.4030G>A (p.Val1344Met)
NM_001458.5(FLNC):c.4055G>T (p.Arg1352Leu)
NM_001458.5(FLNC):c.4066T>G (p.Phe1356Val)
NM_001458.5(FLNC):c.407C>T (p.Thr136Met)
NM_001458.5(FLNC):c.4108C>G (p.Arg1370Gly)
NM_001458.5(FLNC):c.4117G>A (p.Val1373Met)
NM_001458.5(FLNC):c.4141G>T (p.Gly1381Trp)
NM_001458.5(FLNC):c.4145G>A (p.Gly1382Asp)
NM_001458.5(FLNC):c.4159A>T (p.Ile1387Phe)
NM_001458.5(FLNC):c.4172C>T (p.Ser1391Leu)
NM_001458.5(FLNC):c.4202A>C (p.Lys1401Thr)
NM_001458.5(FLNC):c.4255G>A (p.Val1419Ile)
NM_001458.5(FLNC):c.4280C>T (p.Pro1427Leu)
NM_001458.5(FLNC):c.4287A>C (p.Pro1429=)
NM_001458.5(FLNC):c.4342T>C (p.Cys1448Arg)
NM_001458.5(FLNC):c.43G>A (p.Gly15Ser)
NM_001458.5(FLNC):c.4468C>T (p.Pro1490Ser)
NM_001458.5(FLNC):c.446A>T (p.Glu149Val)
NM_001458.5(FLNC):c.4483G>A (p.Asp1495Asn)
NM_001458.5(FLNC):c.44G>T (p.Gly15Val)
NM_001458.5(FLNC):c.4513T>C (p.Tyr1505His)
NM_001458.5(FLNC):c.4517C>G (p.Thr1506Ser)
NM_001458.5(FLNC):c.4577G>A (p.Arg1526His)
NM_001458.5(FLNC):c.4607C>T (p.Ala1536Val)
NM_001458.5(FLNC):c.4687A>C (p.Thr1563Pro)
NM_001458.5(FLNC):c.4702G>A (p.Asp1568Asn)
NM_001458.5(FLNC):c.4737+5G>A
NM_001458.5(FLNC):c.4742C>A (p.Pro1581His)
NM_001458.5(FLNC):c.4769T>G (p.Ile1590Ser)
NM_001458.5(FLNC):c.4772G>A (p.Arg1591Gln)
NM_001458.5(FLNC):c.4775A>G (p.Asp1592Gly)
NM_001458.5(FLNC):c.4779T>G (p.Asn1593Lys)
NM_001458.5(FLNC):c.4811C>T (p.Pro1604Leu)
NM_001458.5(FLNC):c.4817T>A (p.Met1606Lys)
NM_001458.5(FLNC):c.4831A>T (p.Thr1611Ser)
NM_001458.5(FLNC):c.4858G>A (p.Glu1620Lys)
NM_001458.5(FLNC):c.4868A>G (p.Tyr1623Cys)
NM_001458.5(FLNC):c.4911C>G (p.Ser1637Arg)
NM_001458.5(FLNC):c.4926A>G (p.Thr1642=)
NM_001458.5(FLNC):c.4951+3G>A
NM_001458.5(FLNC):c.4952-9G>A
NM_001458.5(FLNC):c.4969C>G (p.Arg1657Gly)
NM_001458.5(FLNC):c.4979T>C (p.Ile1660Thr)
NM_001458.5(FLNC):c.5036C>A (p.Thr1679Lys)
NM_001458.5(FLNC):c.5039G>C (p.Cys1680Ser)
NM_001458.5(FLNC):c.5054C>T (p.Pro1685Leu)
NM_001458.5(FLNC):c.5059G>A (p.Gly1687Arg)
NM_001458.5(FLNC):c.5064_5084dup (p.Leu1690_Glu1696dup)
NM_001458.5(FLNC):c.5111T>C (p.Ile1704Thr)
NM_001458.5(FLNC):c.5156G>A (p.Arg1719His)
NM_001458.5(FLNC):c.5164G>A (p.Gly1722Ser)
NM_001458.5(FLNC):c.5191C>T (p.His1731Tyr)
NM_001458.5(FLNC):c.519_525delinsT (p.Pro174_Gln175del)
NM_001458.5(FLNC):c.5242C>T (p.Pro1748Ser)
NM_001458.5(FLNC):c.5263G>A (p.Ala1755Thr)
NM_001458.5(FLNC):c.5265TCC[1] (p.Pro1757del)
NM_001458.5(FLNC):c.5272C>G (p.Arg1758Gly)
NM_001458.5(FLNC):c.5279G>A (p.Gly1760Asp)
NM_001458.5(FLNC):c.5303C>G (p.Thr1768Arg)
NM_001458.5(FLNC):c.5307G>C (p.Glu1769Asp)
NM_001458.5(FLNC):c.5320C>T (p.Pro1774Ser)
NM_001458.5(FLNC):c.5358C>G (p.Asn1786Lys)
NM_001458.5(FLNC):c.5362G>T (p.Val1788Phe)
NM_001458.5(FLNC):c.5395A>C (p.Thr1799Pro)
NM_001458.5(FLNC):c.5407C>T (p.Arg1803Trp)
NM_001458.5(FLNC):c.5412G>A (p.Met1804Ile)
NM_001458.5(FLNC):c.5413C>A (p.Pro1805Thr)
NM_001458.5(FLNC):c.5414C>T (p.Pro1805Leu)
NM_001458.5(FLNC):c.5431C>T (p.Arg1811Trp)
NM_001458.5(FLNC):c.5446G>A (p.Asp1816Asn)
NM_001458.5(FLNC):c.5448CAA[1] (p.Asn1817del) rs1312829675
NM_001458.5(FLNC):c.5455G>A (p.Asp1819Asn)
NM_001458.5(FLNC):c.5455G>T (p.Asp1819Tyr)
NM_001458.5(FLNC):c.5470G>A (p.Val1824Met)
NM_001458.5(FLNC):c.547C>T (p.Arg183Cys)
NM_001458.5(FLNC):c.5495G>T (p.Gly1832Val)
NM_001458.5(FLNC):c.5524G>A (p.Gly1842Ser)
NM_001458.5(FLNC):c.5624A>G (p.Asn1875Ser)
NM_001458.5(FLNC):c.5657A>G (p.Asp1886Gly)
NM_001458.5(FLNC):c.5677_5682del (p.Ser1893_Leu1894del)
NM_001458.5(FLNC):c.5693G>A (p.Gly1898Asp)
NM_001458.5(FLNC):c.5713A>G (p.Thr1905Ala)
NM_001458.5(FLNC):c.5723A>C (p.Asp1908Ala)
NM_001458.5(FLNC):c.5724CAA[1] (p.Asn1909del)
NM_001458.5(FLNC):c.5753A>G (p.Tyr1918Cys)
NM_001458.5(FLNC):c.5758C>A (p.Pro1920Thr)
NM_001458.5(FLNC):c.5776T>G (p.Tyr1926Asp)
NM_001458.5(FLNC):c.5788G>A (p.Val1930Met)
NM_001458.5(FLNC):c.5803A>G (p.Lys1935Glu)
NM_001458.5(FLNC):c.5826C>G (p.Phe1942Leu)
NM_001458.5(FLNC):c.5842+6G>A
NM_001458.5(FLNC):c.587A>T (p.Asp196Val)
NM_001458.5(FLNC):c.5882C>T (p.Thr1961Ile)
NM_001458.5(FLNC):c.5903A>C (p.Lys1968Thr)
NM_001458.5(FLNC):c.5915G>A (p.Ser1972Asn)
NM_001458.5(FLNC):c.5941A>G (p.Ile1981Val)
NM_001458.5(FLNC):c.5999A>C (p.His2000Pro)
NM_001458.5(FLNC):c.6000C>G (p.His2000Gln)
NM_001458.5(FLNC):c.6004+6C>T
NM_001458.5(FLNC):c.601G>A (p.Gly201Ser)
NM_001458.5(FLNC):c.602-3C>T
NM_001458.5(FLNC):c.6040G>C (p.Val2014Leu)
NM_001458.5(FLNC):c.6049G>A (p.Val2017Met)
NM_001458.5(FLNC):c.606C>G (p.Leu202=)
NM_001458.5(FLNC):c.6094C>G (p.Leu2032Val)
NM_001458.5(FLNC):c.6121G>A (p.Ala2041Thr)
NM_001458.5(FLNC):c.6121G>T (p.Ala2041Ser)
NM_001458.5(FLNC):c.6133C>A (p.Arg2045=)
NM_001458.5(FLNC):c.6166A>G (p.Thr2056Ala)
NM_001458.5(FLNC):c.61A>G (p.Met21Val)
NM_001458.5(FLNC):c.6208+3A>G
NM_001458.5(FLNC):c.6218G>C (p.Gly2073Ala)
NM_001458.5(FLNC):c.6233T>C (p.Ile2078Thr)
NM_001458.5(FLNC):c.6238G>C (p.Gly2080Arg)
NM_001458.5(FLNC):c.6257T>C (p.Ile2086Thr)
NM_001458.5(FLNC):c.6271A>G (p.Met2091Val)
NM_001458.5(FLNC):c.6280G>A (p.Gly2094Arg)
NM_001458.5(FLNC):c.6283A>T (p.Thr2095Ser)
NM_001458.5(FLNC):c.6310G>C (p.Glu2104Gln)
NM_001458.5(FLNC):c.6361+5G>A
NM_001458.5(FLNC):c.6381_6386dup (p.Val2128_Thr2129dup)
NM_001458.5(FLNC):c.6398G>A (p.Arg2133His)
NM_001458.5(FLNC):c.6400A>G (p.Met2134Val)
NM_001458.5(FLNC):c.6422G>A (p.Arg2141Gln)
NM_001458.5(FLNC):c.6450C>A (p.Ile2150=)
NM_001458.5(FLNC):c.6484+6A>T
NM_001458.5(FLNC):c.6523A>C (p.Thr2175Pro)
NM_001458.5(FLNC):c.6529A>G (p.Thr2177Ala)
NM_001458.5(FLNC):c.6559CGCACGGAG[3] (p.2187RTE[3])
NM_001458.5(FLNC):c.6568C>T (p.Arg2190Cys)
NM_001458.5(FLNC):c.6570C>T (p.Arg2190=)
NM_001458.5(FLNC):c.6607C>G (p.Arg2203Gly)
NM_001458.5(FLNC):c.6609C>T (p.Arg2203=)
NM_001458.5(FLNC):c.6610G>A (p.Glu2204Lys)
NM_001458.5(FLNC):c.6617G>A (p.Arg2206Gln)
NM_001458.5(FLNC):c.6617G>C (p.Arg2206Pro)
NM_001458.5(FLNC):c.6646G>A (p.Asp2216Asn)
NM_001458.5(FLNC):c.664A>T (p.Met222Leu)
NM_001458.5(FLNC):c.6662T>C (p.Val2221Ala)
NM_001458.5(FLNC):c.6703G>A (p.Gly2235Ser)
NM_001458.5(FLNC):c.6707G>C (p.Ser2236Thr)
NM_001458.5(FLNC):c.6713C>T (p.Thr2238Ile)
NM_001458.5(FLNC):c.6716G>A (p.Arg2239Gln)
NM_001458.5(FLNC):c.673G>T (p.Ala225Ser)
NM_001458.5(FLNC):c.6809A>T (p.Glu2270Val)
NM_001458.5(FLNC):c.6826G>A (p.Val2276Met)
NM_001458.5(FLNC):c.6845A>G (p.Glu2282Gly)
NM_001458.5(FLNC):c.6860C>T (p.Thr2287Met)
NM_001458.5(FLNC):c.6862G>C (p.Val2288Leu)
NM_001458.5(FLNC):c.6877C>T (p.Arg2293Cys)
NM_001458.5(FLNC):c.6938G>A (p.Gly2313Asp)
NM_001458.5(FLNC):c.6991G>T (p.Val2331Leu)
NM_001458.5(FLNC):c.6998-6C>T
NM_001458.5(FLNC):c.7030G>A (p.Ala2344Thr)
NM_001458.5(FLNC):c.7030G>C (p.Ala2344Pro)
NM_001458.5(FLNC):c.707C>T (p.Ala236Val)
NM_001458.5(FLNC):c.7135+6C>T
NM_001458.5(FLNC):c.71C>A (p.Thr24Lys)
NM_001458.5(FLNC):c.720_721inv (p.Val241Met)
NM_001458.5(FLNC):c.7210C>T (p.Leu2404Phe)
NM_001458.5(FLNC):c.7225C>T (p.Arg2409Cys)
NM_001458.5(FLNC):c.7228C>T (p.Arg2410Cys)
NM_001458.5(FLNC):c.7251+4T>G
NM_001458.5(FLNC):c.7275G>C (p.Gln2425His)
NM_001458.5(FLNC):c.7315G>A (p.Val2439Met)
NM_001458.5(FLNC):c.7349C>A (p.Ala2450Asp)
NM_001458.5(FLNC):c.7400G>C (p.Arg2467Pro)
NM_001458.5(FLNC):c.7411C>A (p.His2471Asn)
NM_001458.5(FLNC):c.7414G>A (p.Glu2472Lys)
NM_001458.5(FLNC):c.7439T>C (p.Val2480Ala)
NM_001458.5(FLNC):c.748G>A (p.Val250Ile)
NM_001458.5(FLNC):c.7507G>A (p.Gly2503Arg)
NM_001458.5(FLNC):c.7516G>A (p.Gly2506Ser)
NM_001458.5(FLNC):c.7559C>A (p.Thr2520Asn)
NM_001458.5(FLNC):c.7561G>A (p.Gly2521Ser)
NM_001458.5(FLNC):c.7562-2_7581dup
NM_001458.5(FLNC):c.7582G>A (p.Val2528Met)
NM_001458.5(FLNC):c.7589C>A (p.Thr2530Asn)
NM_001458.5(FLNC):c.7606G>C (p.Gly2536Arg)
NM_001458.5(FLNC):c.7652A>G (p.Asp2551Gly)
NM_001458.5(FLNC):c.7666C>T (p.Pro2556Ser)
NM_001458.5(FLNC):c.7691C>T (p.Thr2564Ile)
NM_001458.5(FLNC):c.7709A>G (p.Asn2570Ser)
NM_001458.5(FLNC):c.7765A>G (p.Lys2589Glu)
NM_001458.5(FLNC):c.777G>A (p.Lys259=)
NM_001458.5(FLNC):c.7807C>T (p.Leu2603Phe)
NM_001458.5(FLNC):c.7819T>G (p.Ser2607Ala)
NM_001458.5(FLNC):c.7824G>A (p.Thr2608=)
NM_001458.5(FLNC):c.7832T>G (p.Val2611Gly)
NM_001458.5(FLNC):c.783G>C (p.Lys261Asn)
NM_001458.5(FLNC):c.7840G>A (p.Val2614Met)
NM_001458.5(FLNC):c.7841_7842del (p.Val2614fs) rs1554402003
NM_001458.5(FLNC):c.7893CTC[1] (p.Ser2633del)
NM_001458.5(FLNC):c.7907G>T (p.Ser2636Ile)
NM_001458.5(FLNC):c.7931G>C (p.Gly2644Ala)
NM_001458.5(FLNC):c.7946T>C (p.Phe2649Ser)
NM_001458.5(FLNC):c.7999ATG[2] (p.Met2669del)
NM_001458.5(FLNC):c.802G>A (p.Val268Ile)
NM_001458.5(FLNC):c.8109C>G (p.Asp2703Glu)
NM_001458.5(FLNC):c.8131G>T (p.Gly2711Cys)
NM_001458.5(FLNC):c.8143G>T (p.Val2715Phe)
NM_001458.5(FLNC):c.8171T>C (p.Val2724Ala)
NM_001458.5(FLNC):c.824C>A (p.Pro275His)
NM_001458.5(FLNC):c.842A>G (p.Tyr281Cys)
NM_001458.5(FLNC):c.863A>G (p.Gln288Arg)
NM_001458.5(FLNC):c.868A>G (p.Asn290Asp)
NM_001458.5(FLNC):c.913G>A (p.Ala305Thr)
NM_001458.5(FLNC):c.914C>G (p.Ala305Gly)
NM_001458.5(FLNC):c.918C>T (p.Gly306=)
NM_001458.5(FLNC):c.935T>G (p.Val312Gly)
NM_001458.5(FLNC):c.943G>A (p.Glu315Lys)
NM_001458.5(FLNC):c.95C>T (p.Ala32Val)
NM_001458.5(FLNC):c.970-5A>C
NM_001458.5(FLNC):c.977T>C (p.Val326Ala)
NM_001458.5(FLNC):c.987C>A (p.Asn329Lys)
NM_001927.4(DES):c.1000G>A (p.Glu334Lys) rs1227068284
NM_001927.4(DES):c.1004T>C (p.Ile335Thr)
NM_001927.4(DES):c.1009G>A (p.Ala337Thr) rs59962885
NM_001927.4(DES):c.1010C>A (p.Ala337Asp)
NM_001927.4(DES):c.1013T>C (p.Leu338Pro) rs57496341
NM_001927.4(DES):c.1017G>C (p.Lys339Asn)
NM_001927.4(DES):c.1019G>A (p.Gly340Asp) rs1559353118
NM_001927.4(DES):c.1022C>T (p.Thr341Ile)
NM_001927.4(DES):c.1023+6T>G
NM_001927.4(DES):c.1024-3C>A rs1553603530
NM_001927.4(DES):c.1024-7C>G rs779098835
NM_001927.4(DES):c.1027G>A (p.Asp343Asn) rs763903197
NM_001927.4(DES):c.1038G>A (p.Met346Ile) rs778340812
NM_001927.4(DES):c.1049G>A (p.Arg350Gln) rs57965306
NM_001927.4(DES):c.1049G>T (p.Arg350Leu)
NM_001927.4(DES):c.104T>C (p.Phe35Ser) rs1575012999
NM_001927.4(DES):c.1055T>C (p.Leu352Ser)
NM_001927.4(DES):c.1063C>G (p.Arg355Gly) rs762808690
NM_001927.4(DES):c.1064G>A (p.Arg355Gln) rs61368398
NM_001927.4(DES):c.1064G>C (p.Arg355Pro) rs61368398
NM_001927.4(DES):c.1079C>T (p.Ala360Val)
NM_001927.4(DES):c.1090C>A (p.Gln364Lys)
NM_001927.4(DES):c.1094ACA[1] (p.Asn366del) rs58687088
NM_001927.4(DES):c.1099A>C (p.Ile367Leu)
NM_001927.4(DES):c.109C>G (p.Arg37Gly) rs537881554
NM_001927.4(DES):c.109C>T (p.Arg37Trp) rs537881554
NM_001927.4(DES):c.10G>A (p.Ala4Thr)
NM_001927.4(DES):c.1100T>C (p.Ile367Thr) rs1480755998
NM_001927.4(DES):c.1103C>T (p.Ala368Val)
NM_001927.4(DES):c.1105C>T (p.Arg369Cys) rs1475674849
NM_001927.4(DES):c.1106G>T (p.Arg369Leu)
NM_001927.4(DES):c.110G>T (p.Arg37Leu)
NM_001927.4(DES):c.1110GGA[2] (p.Glu373del)
NM_001927.4(DES):c.1119A>C (p.Glu373Asp)
NM_001927.4(DES):c.1123C>T (p.Arg375Trp) rs375218723
NM_001927.4(DES):c.1142T>C (p.Met381Thr)
NM_001927.4(DES):c.1144G>A (p.Ala382Thr)
NM_001927.4(DES):c.1147C>T (p.Arg383Cys)
NM_001927.4(DES):c.1148G>A (p.Arg383His) rs1292042317
NM_001927.4(DES):c.1148G>C (p.Arg383Pro)
NM_001927.4(DES):c.1158C>T (p.Arg386=) rs774323736
NM_001927.4(DES):c.1158_1160del (p.Glu387del) rs1559353314
NM_001927.4(DES):c.1159G>A (p.Glu387Lys) rs865961434
NM_001927.4(DES):c.115G>A (p.Gly39Ser)
NM_001927.4(DES):c.1172T>C (p.Leu391Pro)
NM_001927.4(DES):c.1172T>G (p.Leu391Arg)
NM_001927.4(DES):c.1180G>T (p.Val394Leu) rs776786349
NM_001927.4(DES):c.1193T>C (p.Leu398Pro)
NM_001927.4(DES):c.1202A>G (p.Glu401Gly)
NM_001927.4(DES):c.1205T>C (p.Ile402Thr) rs1553603571
NM_001927.4(DES):c.1205T>G (p.Ile402Ser)
NM_001927.4(DES):c.1217G>A (p.Arg406Gln) rs1057520275
NM_001927.4(DES):c.1219A>C (p.Lys407Gln) rs1553603573
NM_001927.4(DES):c.1228G>A (p.Glu410Lys)
NM_001927.4(DES):c.1238A>G (p.Glu413Gly)
NM_001927.4(DES):c.1243C>G (p.Arg415Gly)
NM_001927.4(DES):c.1243C>T (p.Arg415Trp) rs751942358
NM_001927.4(DES):c.1243del (p.Arg415fs)
NM_001927.4(DES):c.1244G>A (p.Arg415Gln) rs1262288015
NM_001927.4(DES):c.1250A>G (p.Asn417Ser)
NM_001927.4(DES):c.1255C>A (p.Pro419Thr) rs62635763
NM_001927.4(DES):c.1262A>G (p.Gln421Arg) rs756613339
NM_001927.4(DES):c.1279A>T (p.Asn427Tyr)
NM_001927.4(DES):c.1285del (p.Arg429fs)
NM_001927.4(DES):c.1286G>A (p.Arg429Gln) rs200580581
NM_001927.4(DES):c.1300G>A (p.Glu434Lys) rs952020807
NM_001927.4(DES):c.1310G>A (p.Gly437Asp) rs878854471
NM_001927.4(DES):c.1312T>G (p.Ser438Ala) rs1553603818
NM_001927.4(DES):c.131G>T (p.Gly44Val)
NM_001927.4(DES):c.1322A>T (p.His441Leu) rs1064796937
NM_001927.4(DES):c.1323T>G (p.His441Gln)
NM_001927.4(DES):c.1325C>A (p.Thr442Asn) rs121913005
NM_001927.4(DES):c.1353C>G (p.Ile451Met) rs121913002
NM_001927.4(DES):c.1354_1358del (p.Glu452fs) rs1060503171
NM_001927.4(DES):c.1371+1G>A rs748323823
NM_001927.4(DES):c.1385_1386delinsAG (p.Ala462Glu) rs1060503170
NM_001927.4(DES):c.1408C>T (p.Leu470Phe) rs1060503172
NM_001927.4(DES):c.1409T>C (p.Leu470Pro)
NM_001927.4(DES):c.1411T>C (p.Ter471Gln) rs886044329
NM_001927.4(DES):c.154C>A (p.Arg52Ser) rs794728990
NM_001927.4(DES):c.157G>A (p.Val53Met)
NM_001927.4(DES):c.166G>C (p.Val56Leu) rs578066781
NM_001927.4(DES):c.167T>A (p.Val56Glu) rs1170549656
NM_001927.4(DES):c.170C>T (p.Ser57Leu) rs372825868
NM_001927.4(DES):c.176C>T (p.Thr59Met)
NM_001927.4(DES):c.17C>T (p.Ser6Leu) rs1214936508
NM_001927.4(DES):c.182G>A (p.Gly61Asp)
NM_001927.4(DES):c.184G>A (p.Gly62Arg) rs886044090
NM_001927.4(DES):c.186G>T (p.Gly62=)
NM_001927.4(DES):c.188C>A (p.Ala63Asp)
NM_001927.4(DES):c.193G>A (p.Gly65Ser) rs397516692
NM_001927.4(DES):c.196C>A (p.Leu66Met) rs1320380570
NM_001927.4(DES):c.208C>T (p.Arg70Trp)
NM_001927.4(DES):c.209G>C (p.Arg70Pro) rs933438188
NM_001927.4(DES):c.212C>T (p.Ala71Val) rs759235186
NM_001927.4(DES):c.216C>A (p.Ser72Arg) rs375719734
NM_001927.4(DES):c.218G>A (p.Arg73Gln) rs752518966
NM_001927.4(DES):c.218G>T (p.Arg73Leu) rs752518966
NM_001927.4(DES):c.221T>A (p.Leu74Gln)
NM_001927.4(DES):c.229A>G (p.Thr77Ala) rs769034192
NM_001927.4(DES):c.233G>T (p.Arg78Leu) rs573916832
NM_001927.4(DES):c.250G>A (p.Gly84Ser) rs200545412
NM_001927.4(DES):c.258C>T (p.Gly86=)
NM_001927.4(DES):c.268G>C (p.Asp90His) rs1267102255
NM_001927.4(DES):c.269A>T (p.Asp90Val)
NM_001927.4(DES):c.275C>T (p.Ser92Leu)
NM_001927.4(DES):c.280G>A (p.Ala94Thr)
NM_001927.4(DES):c.284A>T (p.Asp95Val)
NM_001927.4(DES):c.286G>T (p.Ala96Ser) rs201190593
NM_001927.4(DES):c.28C>A (p.Arg10Ser) rs1196125127
NM_001927.4(DES):c.295C>G (p.Gln99Glu) rs794728992
NM_001927.4(DES):c.298G>A (p.Glu100Lys)
NM_001927.4(DES):c.310A>G (p.Thr104Ala) rs1559352310
NM_001927.4(DES):c.311C>T (p.Thr104Met)
NM_001927.4(DES):c.313C>T (p.Arg105Cys) rs794728993
NM_001927.4(DES):c.314G>T (p.Arg105Leu)
NM_001927.4(DES):c.320A>C (p.Asn107Thr)
NM_001927.4(DES):c.322G>A (p.Glu108Lys) rs62636490
NM_001927.4(DES):c.323A>G (p.Glu108Gly)
NM_001927.4(DES):c.325A>G (p.Lys109Glu)
NM_001927.4(DES):c.326A>G (p.Lys109Arg)
NM_001927.4(DES):c.328G>C (p.Val110Leu) rs373081285
NM_001927.4(DES):c.335T>G (p.Leu112Arg)
NM_001927.4(DES):c.347A>T (p.Asn116Ile) rs267607499
NM_001927.4(DES):c.349G>C (p.Asp117His)
NM_001927.4(DES):c.352C>A (p.Arg118Ser) rs1188232371
NM_001927.4(DES):c.359C>A (p.Ala120Asp)
NM_001927.4(DES):c.361A>C (p.Asn121His)
NM_001927.4(DES):c.367A>G (p.Ile123Val)
NM_001927.4(DES):c.371A>C (p.Glu124Ala) rs564121737
NM_001927.4(DES):c.371A>G (p.Glu124Gly)
NM_001927.4(DES):c.376G>T (p.Val126Leu) rs876657770
NM_001927.4(DES):c.379C>G (p.Arg127Gly)
NM_001927.4(DES):c.37T>C (p.Ser13Pro)
NM_001927.4(DES):c.380G>C (p.Arg127Pro) rs397516694
NM_001927.4(DES):c.38C>A (p.Ser13Tyr) rs62636495
NM_001927.4(DES):c.391C>A (p.Gln131Lys) rs771499260
NM_001927.4(DES):c.404C>G (p.Ala135Gly)
NM_001927.4(DES):c.406C>G (p.Leu136Val)
NM_001927.4(DES):c.407T>A (p.Leu136His) rs397516695
NM_001927.4(DES):c.410C>A (p.Ala137Asp) rs775115627
NM_001927.4(DES):c.415G>A (p.Glu139Lys) rs763769862
NM_001927.4(DES):c.427C>G (p.Leu143Val)
NM_001927.4(DES):c.434G>A (p.Gly145Asp) rs1553603267
NM_001927.4(DES):c.449G>A (p.Arg150Gln) rs876661344
NM_001927.4(DES):c.461T>A (p.Leu154His) rs755106109
NM_001927.4(DES):c.467A>T (p.Glu156Val)
NM_001927.4(DES):c.469G>A (p.Glu157Lys)
NM_001927.4(DES):c.488G>A (p.Arg163Gln) rs1457012198
NM_001927.4(DES):c.488_505dup (p.Arg163_Val168dup)
NM_001927.4(DES):c.50C>A (p.Thr17Asn)
NM_001927.4(DES):c.517C>A (p.Arg173Ser)
NM_001927.4(DES):c.524G>A (p.Arg175His) rs878854472
NM_001927.4(DES):c.541G>C (p.Asp181His) rs1297244198
NM_001927.4(DES):c.544_555del (p.Asn182_Asp185del)
NM_001927.4(DES):c.556G>T (p.Asp186Tyr) rs878854473
NM_001927.4(DES):c.558C>G (p.Asp186Glu) rs1575013561
NM_001927.4(DES):c.55G>C (p.Gly19Arg) rs936853024
NM_001927.4(DES):c.560T>G (p.Leu187Arg)
NM_001927.4(DES):c.565C>T (p.Arg189Trp) rs1223277151
NM_001927.4(DES):c.566G>A (p.Arg189Gln) rs1025323214
NM_001927.4(DES):c.571A>G (p.Lys191Glu)
NM_001927.4(DES):c.58G>A (p.Gly20Arg) rs759306707
NM_001927.4(DES):c.5G>T (p.Ser2Ile) rs58999456
NM_001927.4(DES):c.603G>C (p.Lys201Asn) rs765376573
NM_001927.4(DES):c.609A>C (p.Glu203Asp) rs369495436
NM_001927.4(DES):c.610G>T (p.Ala204Ser) rs1575014034
NM_001927.4(DES):c.623T>C (p.Leu208Ser) rs373062962
NM_001927.4(DES):c.629C>T (p.Ala210Val) rs1060503169
NM_001927.4(DES):c.62C>A (p.Ala21Asp)
NM_001927.4(DES):c.635G>A (p.Arg212Gln) rs144261171
NM_001927.4(DES):c.637G>A (p.Ala213Thr) rs918962036
NM_001927.4(DES):c.639G>A (p.Ala213=) rs377337947
NM_001927.4(DES):c.643G>A (p.Val215Met) rs144908941
NM_001927.4(DES):c.65C>G (p.Pro22Arg) rs748158450
NM_001927.4(DES):c.662C>T (p.Ala221Val) rs746814065
NM_001927.4(DES):c.665G>A (p.Arg222His) rs367961979
NM_001927.4(DES):c.669_670delinsCC (p.Asp224His)
NM_001927.4(DES):c.66G>A (p.Pro22=)
NM_001927.4(DES):c.679C>T (p.Arg227Cys) rs767743962
NM_001927.4(DES):c.680G>A (p.Arg227His) rs141486420
NM_001927.4(DES):c.680G>T (p.Arg227Leu)
NM_001927.4(DES):c.694C>T (p.Leu232Phe) rs764764823
NM_001927.4(DES):c.700G>A (p.Glu234Lys) rs774739275
NM_001927.4(DES):c.709G>A (p.Ala237Thr) rs397516697
NM_001927.4(DES):c.718A>G (p.Lys240Glu)
NM_001927.4(DES):c.727C>T (p.His243Tyr) rs769647148
NM_001927.4(DES):c.734A>G (p.Glu245Gly) rs1575014243
NM_001927.4(DES):c.735+3A>T rs267607483
NM_001927.4(DES):c.735+6C>T
NM_001927.4(DES):c.735G>A (p.Glu245=) rs267607486
NM_001927.4(DES):c.735_735+3dup
NM_001927.4(DES):c.738G>C (p.Glu246Asp)
NM_001927.4(DES):c.742C>T (p.Arg248Cys) rs772117708
NM_001927.4(DES):c.746A>C (p.Glu249Ala)
NM_001927.4(DES):c.74_75insGCTCGGCTCCCC (p.Gly27_Leu30dup)
NM_001927.4(DES):c.761T>G (p.Leu254Arg) rs1559352926
NM_001927.4(DES):c.767A>G (p.Glu256Gly) rs1553603440
NM_001927.4(DES):c.770A>G (p.Gln257Arg)
NM_001927.4(DES):c.796T>C (p.Ser266Pro)
NM_001927.4(DES):c.79G>A (p.Gly27Ser) rs727504877
NM_001927.4(DES):c.802C>G (p.Pro268Ala) rs1434613160
NM_001927.4(DES):c.80G>A (p.Gly27Asp) rs1575012966
NM_001927.4(DES):c.817G>A (p.Ala273Thr)
NM_001927.4(DES):c.817G>T (p.Ala273Ser) rs770258461
NM_001927.4(DES):c.826G>A (p.Asp276Asn)
NM_001927.4(DES):c.830T>A (p.Ile277Asn)
NM_001927.4(DES):c.832C>T (p.Arg278Trp) rs794728985
NM_001927.4(DES):c.833G>C (p.Arg278Pro) rs761475402
NM_001927.4(DES):c.839A>G (p.Gln280Arg) rs750160975
NM_001927.4(DES):c.840G>C (p.Gln280His)
NM_001927.4(DES):c.853G>A (p.Ala285Thr) rs876657771
NM_001927.4(DES):c.869C>A (p.Ser290Tyr) rs981782522
NM_001927.4(DES):c.86C>T (p.Pro29Leu)
NM_001927.4(DES):c.883T>G (p.Trp295Gly) rs794728986
NM_001927.4(DES):c.893C>T (p.Ser298Leu) rs62636491
NM_001927.4(DES):c.897+4G>A
NM_001927.4(DES):c.897+6T>G
NM_001927.4(DES):c.8A>G (p.Gln3Arg)
NM_001927.4(DES):c.906C>A (p.Asp302Glu)
NM_001927.4(DES):c.934G>A (p.Asp312Asn) rs34337334
NM_001927.4(DES):c.937G>A (p.Ala313Thr) rs766252091
NM_001927.4(DES):c.93T>G (p.Ser31Arg) rs2017800
NM_001927.4(DES):c.943C>T (p.Arg315Cys) rs748742357
NM_001927.4(DES):c.944G>A (p.Arg315His) rs771455648
NM_001927.4(DES):c.974G>A (p.Arg325Gln) rs766035912
NM_001927.4(DES):c.976C>T (p.His326Tyr) rs794728987
NM_001927.4(DES):c.986A>C (p.Gln329Pro) rs1060503168
NM_001927.4(DES):c.992A>C (p.Tyr331Ser)
NM_001927.4(DES):c.995C>T (p.Thr332Ile) rs368453327
NM_001927.4(DES):c.999C>T (p.Cys333=) rs1157722667
NM_006790.2(MYOT):c.1139T>C (p.Leu380Pro) rs902179316
NM_006790.2(MYOT):c.1159G>A (p.Glu387Lys) rs373489115
NM_006790.2(MYOT):c.1195T>C (p.Tyr399His) rs147239483
NM_006790.2(MYOT):c.1286C>G (p.Ala429Gly) rs144731446
NM_006790.2(MYOT):c.1300T>C (p.Cys434Arg) rs769872126
NM_006790.2(MYOT):c.1345C>G (p.Pro449Ala) rs766650528
NM_006790.2(MYOT):c.1364G>A (p.Arg455Gln) rs141801816
NM_006790.2(MYOT):c.1364G>C (p.Arg455Pro) rs141801816
NM_006790.2(MYOT):c.1401T>A (p.Asn467Lys) rs145427063
NM_006790.2(MYOT):c.1413G>T (p.Leu471Phe) rs146426896
NM_006790.2(MYOT):c.145G>C (p.Glu49Gln) rs199760778
NM_006790.2(MYOT):c.1497A>T (p.Ter499Tyr) rs779978043
NM_006790.2(MYOT):c.17G>A (p.Arg6His) rs387906882
NM_006790.2(MYOT):c.182A>C (p.His61Pro) rs372276337
NM_006790.2(MYOT):c.1A>T (p.Met1Leu) rs1561657261
NM_006790.2(MYOT):c.257C>A (p.Thr86Lys) rs1205992276
NM_006790.2(MYOT):c.335T>A (p.Ile112Asn) rs752723849
NM_006790.2(MYOT):c.387A>G (p.Ile129Met) rs1554102960
NM_006790.2(MYOT):c.391G>T (p.Ala131Ser) rs1554102961
NM_006790.2(MYOT):c.392C>A (p.Ala131Glu) rs982468554
NM_006790.2(MYOT):c.398C>T (p.Pro133Leu) rs779568205
NM_006790.2(MYOT):c.563G>T (p.Arg188Ile) rs370165036
NM_006790.2(MYOT):c.629C>T (p.Ser210Leu) rs756669574
NM_006790.2(MYOT):c.650A>G (p.His217Arg) rs758565747
NM_006790.2(MYOT):c.653C>A (p.Ala218Glu) rs533510304
NM_006790.2(MYOT):c.656G>A (p.Arg219Gln) rs745792335
NM_006790.2(MYOT):c.758T>C (p.Ile253Thr) rs201113539
NM_006790.2(MYOT):c.782T>C (p.Ile261Thr) rs764439615
NM_006790.2(MYOT):c.784G>C (p.Asp262His) rs1271782226
NM_006790.2(MYOT):c.816+5G>T rs750433300
NM_006790.2(MYOT):c.83C>T (p.Thr28Ile) rs767662244
NM_006790.2(MYOT):c.86C>T (p.Ser29Phe) rs1580847200
NM_006790.2(MYOT):c.937G>A (p.Val313Ile) rs760955035
NM_006790.2(MYOT):c.98G>T (p.Ser33Ile) rs1554102559
NM_006790.3(MYOT):c.1015G>A (p.Asp339Asn)
NM_006790.3(MYOT):c.1025-3T>C
NM_006790.3(MYOT):c.1084G>C (p.Glu362Gln)
NM_006790.3(MYOT):c.1122del (p.Ile375fs)
NM_006790.3(MYOT):c.1184G>A (p.Arg395Gln)
NM_006790.3(MYOT):c.1266T>A (p.Thr422=)
NM_006790.3(MYOT):c.1291G>A (p.Val431Met)
NM_006790.3(MYOT):c.1370G>A (p.Arg457Gln)
NM_006790.3(MYOT):c.137A>T (p.Gln46Leu)
NM_006790.3(MYOT):c.1418T>C (p.Val473Ala)
NM_006790.3(MYOT):c.1442G>A (p.Gly481Glu)
NM_006790.3(MYOT):c.1457T>C (p.Leu486Ser)
NM_006790.3(MYOT):c.1471G>A (p.Gly491Arg)
NM_006790.3(MYOT):c.147G>C (p.Glu49Asp)
NM_006790.3(MYOT):c.151A>G (p.Arg51Gly)
NM_006790.3(MYOT):c.232G>A (p.Gly78Ser)
NM_006790.3(MYOT):c.252G>C (p.Arg84Ser)
NM_006790.3(MYOT):c.385A>G (p.Ile129Val)
NM_006790.3(MYOT):c.436C>T (p.Pro146Ser)
NM_006790.3(MYOT):c.449T>C (p.Ile150Thr)
NM_006790.3(MYOT):c.490A>C (p.Lys164Gln)
NM_006790.3(MYOT):c.511C>T (p.Leu171Phe)
NM_006790.3(MYOT):c.524G>A (p.Gly175Glu)
NM_006790.3(MYOT):c.560G>A (p.Arg187His)
NM_006790.3(MYOT):c.609T>A (p.Asp203Glu)
NM_006790.3(MYOT):c.642C>A (p.Asn214Lys)
NM_006790.3(MYOT):c.655C>T (p.Arg219Ter)
NM_006790.3(MYOT):c.67C>A (p.Pro23Thr)
NM_006790.3(MYOT):c.680_683del (p.Val227fs)
NM_006790.3(MYOT):c.686G>A (p.Ser229Asn)
NM_006790.3(MYOT):c.701G>A (p.Arg234Lys)
NM_006790.3(MYOT):c.751C>T (p.Arg251Cys)
NM_006790.3(MYOT):c.752G>A (p.Arg251His)
NM_006790.3(MYOT):c.859G>A (p.Gly287Arg) rs374221793
NM_006790.3(MYOT):c.951T>G (p.Asp317Glu)
NM_006790.3(MYOT):c.966A>G (p.Ala322=)
NM_007078.2(LDB3):c.-23-?_93+?dup
NM_007078.3(LDB3):c.1018G>C (p.Ala340Pro) rs755329877
NM_007078.3(LDB3):c.1049C>T (p.Thr350Ile) rs200796750
NM_007078.3(LDB3):c.1071T>A (p.Pro357=) rs143823978
NM_007078.3(LDB3):c.1086-247_1231+2del rs1564653469
NM_007078.3(LDB3):c.1094C>T (p.Ala365Val)
NM_007078.3(LDB3):c.1121C>T (p.Ala374Val) rs1554860812
NM_007078.3(LDB3):c.1132C>T (p.Pro378Ser) rs373546361
NM_007078.3(LDB3):c.1147A>G (p.Ser383Gly)
NM_007078.3(LDB3):c.1150T>A (p.Tyr384Asn) rs1554860857
NM_007078.3(LDB3):c.1153A>G (p.Ser385Gly) rs777547764
NM_007078.3(LDB3):c.115G>C (p.Ala39Pro)
NM_007078.3(LDB3):c.1165G>A (p.Ala389Thr) rs924634578
NM_007078.3(LDB3):c.1211G>A (p.Arg404Gln) rs150868546
NM_007078.3(LDB3):c.1225C>A (p.Gln409Lys) rs139104492
NM_007078.3(LDB3):c.1231G>C (p.Val411Leu)
NM_007078.3(LDB3):c.1253C>G (p.Pro418Arg) rs141870580
NM_007078.3(LDB3):c.1253C>T (p.Pro418Leu) rs141870580
NM_007078.3(LDB3):c.1256C>A (p.Ser419Tyr) rs368888118
NM_007078.3(LDB3):c.1289C>A (p.Thr430Asn) rs746183666
NM_007078.3(LDB3):c.1294del (p.Ser432fs)
NM_007078.3(LDB3):c.1296CCCTGCCCCTGCCTACACCCCCTC[1] (p.434APAYTPSP[1]) rs397517209
NM_007078.3(LDB3):c.1296CCCTGCCCCTGCCTACACCCCCTC[3] (p.434APAYTPSP[3]) rs397517209
NM_007078.3(LDB3):c.1312A>G (p.Thr438Ala) rs111941389
NM_007078.3(LDB3):c.1313C>A (p.Thr438Asn)
NM_007078.3(LDB3):c.1313C>G (p.Thr438Ser) rs767914340
NM_007078.3(LDB3):c.1321C>T (p.Pro441Ser) rs757728320
NM_007078.3(LDB3):c.1328C>T (p.Pro443Leu) rs1554863327
NM_007078.3(LDB3):c.1337C>T (p.Thr446Ile)
NM_007078.3(LDB3):c.1339C>G (p.Pro447Ala) rs397517211
NM_007078.3(LDB3):c.1351C>G (p.Pro451Ala)
NM_007078.3(LDB3):c.1361C>T (p.Thr454Ile)
NM_007078.3(LDB3):c.1381T>G (p.Tyr461Asp) rs145655904
NM_007078.3(LDB3):c.139G>A (p.Asp47Asn) rs397517212
NM_007078.3(LDB3):c.1403A>G (p.Asn468Ser) rs730880129
NM_007078.3(LDB3):c.1418C>A (p.Pro473His)
NM_007078.3(LDB3):c.1421C>T (p.Ser474Leu) rs1011836119
NM_007078.3(LDB3):c.1426G>T (p.Ala476Ser)
NM_007078.3(LDB3):c.1435G>A (p.Gly479Arg) rs370521488
NM_007078.3(LDB3):c.1445C>T (p.Ala482Val) rs774313535
NM_007078.3(LDB3):c.1446G>A (p.Ala482=)
NM_007078.3(LDB3):c.1453G>T (p.Ala485Ser) rs397517214
NM_007078.3(LDB3):c.1457dup (p.Ser486fs)
NM_007078.3(LDB3):c.1459C>T (p.Arg487Cys)
NM_007078.3(LDB3):c.145G>A (p.Val49Met)
NM_007078.3(LDB3):c.145G>C (p.Val49Leu)
NM_007078.3(LDB3):c.1468T>C (p.Trp490Arg) rs1589675054
NM_007078.3(LDB3):c.1471G>A (p.Val491Met)
NM_007078.3(LDB3):c.1471G>T (p.Val491Leu) rs397517215
NM_007078.3(LDB3):c.1472T>A (p.Val491Glu) rs139709036
NM_007078.3(LDB3):c.1487T>C (p.Phe496Ser) rs147072071
NM_007078.3(LDB3):c.1497G>T (p.Lys499Asn) rs1278770988
NM_007078.3(LDB3):c.149T>C (p.Val50Ala)
NM_007078.3(LDB3):c.1502C>T (p.Ala501Val) rs755362259
NM_007078.3(LDB3):c.1505C>T (p.Pro502Leu) rs528611881
NM_007078.3(LDB3):c.1520C>A (p.Thr507Asn) rs150188572
NM_007078.3(LDB3):c.1535A>G (p.Gln512Arg)
NM_007078.3(LDB3):c.1547G>A (p.Arg516Gln)
NM_007078.3(LDB3):c.1556C>A (p.Pro519Gln)
NM_007078.3(LDB3):c.1565C>A (p.Thr522Asn)
NM_007078.3(LDB3):c.1599G>C (p.Arg533Ser)
NM_007078.3(LDB3):c.1601_1602dup (p.Thr535fs)
NM_007078.3(LDB3):c.1603_1605delinsTGCCACTCA (p.Thr535delinsCysHisSer) rs1589675306
NM_007078.3(LDB3):c.1606G>A (p.Val536Ile) rs113817827
NM_007078.3(LDB3):c.1607T>C (p.Val536Ala) rs727503128
NM_007078.3(LDB3):c.1609del (p.Gln537fs) rs727503129
NM_007078.3(LDB3):c.160G>A (p.Gly54Ser) rs201786090
NM_007078.3(LDB3):c.1631C>A (p.Ala544Asp)
NM_007078.3(LDB3):c.1633A>G (p.Ser545Gly) rs1370639524
NM_007078.3(LDB3):c.1639C>T (p.Arg547Trp) rs374426474
NM_007078.3(LDB3):c.1640G>A (p.Arg547Gln) rs201968826
NM_007078.3(LDB3):c.1649T>C (p.Leu550Pro) rs1589675409
NM_007078.3(LDB3):c.1654G>A (p.Gly552Ser)
NM_007078.3(LDB3):c.1664A>G (p.Asn555Ser) rs760635362
NM_007078.3(LDB3):c.1667A>G (p.Asn556Ser) rs372583830
NM_007078.3(LDB3):c.1675C>T (p.Arg559Trp) rs142947567
NM_007078.3(LDB3):c.1676G>A (p.Arg559Gln) rs763908636
NM_007078.3(LDB3):c.1677G>A (p.Arg559=)
NM_007078.3(LDB3):c.167A>G (p.Asn56Ser)
NM_007078.3(LDB3):c.1690G>A (p.Val564Ile)
NM_007078.3(LDB3):c.1696A>G (p.Met566Val) rs775232208
NM_007078.3(LDB3):c.1703G>A (p.Arg568His) rs769156627
NM_007078.3(LDB3):c.172G>A (p.Asp58Asn) rs730880127
NM_007078.3(LDB3):c.1736A>G (p.Tyr579Cys) rs199749907
NM_007078.3(LDB3):c.1745C>G (p.Thr582Ser)
NM_007078.3(LDB3):c.1752G>C (p.Leu584=) rs1589676711
NM_007078.3(LDB3):c.1763G>A (p.Cys588Tyr)
NM_007078.3(LDB3):c.1773del (p.Glu592fs) rs776530913
NM_007078.3(LDB3):c.1774G>C (p.Glu592Gln) rs727504944
NM_007078.3(LDB3):c.1789T>A (p.Tyr597Asn) rs727503131
NM_007078.3(LDB3):c.1798C>T (p.Arg600Ter) rs727503132
NM_007078.3(LDB3):c.1799G>A (p.Arg600Gln) rs747523570
NM_007078.3(LDB3):c.1805A>C (p.Tyr602Ser)
NM_007078.3(LDB3):c.1812A>G (p.Gln604=)
NM_007078.3(LDB3):c.1823C>T (p.Pro608Leu) rs145983824
NM_007078.3(LDB3):c.1857+3A>G
NM_007078.3(LDB3):c.1858-3C>A
NM_007078.3(LDB3):c.1885T>C (p.Trp629Arg) rs773554501
NM_007078.3(LDB3):c.1894A>G (p.Thr632Ala) rs770525232
NM_007078.3(LDB3):c.1902C>A (p.Phe634Leu) rs773904344
NM_007078.3(LDB3):c.1903G>C (p.Val635Leu) rs45618633
NM_007078.3(LDB3):c.1904T>A (p.Val635Asp)
NM_007078.3(LDB3):c.1904T>G (p.Val635Gly)
NM_007078.3(LDB3):c.1907G>A (p.Cys636Tyr) rs397517218
NM_007078.3(LDB3):c.1910C>T (p.Ala637Val) rs141569007
NM_007078.3(LDB3):c.1957G>C (p.Gly653Arg) rs149945820
NM_007078.3(LDB3):c.196C>T (p.Gln66Ter) rs1554849100
NM_007078.3(LDB3):c.1971C>T (p.Cys657=) rs140552419
NM_007078.3(LDB3):c.1972G>A (p.Glu658Lys) rs760563152
NM_007078.3(LDB3):c.1978+2_1978+5del rs1554864768
NM_007078.3(LDB3):c.1978+6A>G
NM_007078.3(LDB3):c.2017G>A (p.Asp673Asn) rs45514002
NM_007078.3(LDB3):c.2037C>T (p.Gly679=)
NM_007078.3(LDB3):c.2050G>A (p.Glu684Lys)
NM_007078.3(LDB3):c.2056C>G (p.Leu686Val)
NM_007078.3(LDB3):c.2066C>G (p.Thr689Ser)
NM_007078.3(LDB3):c.2074G>A (p.Asp692Asn)
NM_007078.3(LDB3):c.2092G>A (p.Ala698Thr) rs45577134
NM_007078.3(LDB3):c.2094+3A>G
NM_007078.3(LDB3):c.2104G>T (p.Val702Leu) rs773235586
NM_007078.3(LDB3):c.2119C>T (p.Gln707Ter) rs771316707
NM_007078.3(LDB3):c.2123C>T (p.Pro708Leu) rs774815578
NM_007078.3(LDB3):c.2124G>A (p.Pro708=) rs759812655
NM_007078.3(LDB3):c.2128T>C (p.Tyr710His)
NM_007078.3(LDB3):c.2136del (p.Lys713fs)
NM_007078.3(LDB3):c.2142C>A (p.Asp714Glu)
NM_007078.3(LDB3):c.2150T>G (p.Leu717Arg)
NM_007078.3(LDB3):c.2155A>C (p.Lys719Gln) rs397517220
NM_007078.3(LDB3):c.2164G>A (p.Ala722Thr) rs727505129
NM_007078.3(LDB3):c.2173A>C (p.Ile725Leu)
NM_007078.3(LDB3):c.2173A>G (p.Ile725Val) rs1554870749
NM_007078.3(LDB3):c.2174T>A (p.Ile725Asn) rs748399477
NM_007078.3(LDB3):c.2177A>G (p.Asn726Ser)
NM_007078.3(LDB3):c.23C>A (p.Thr8Asn) rs1060501317
NM_007078.3(LDB3):c.242del (p.Gln81fs) rs1554849133
NM_007078.3(LDB3):c.269C>G (p.Ser90Cys)
NM_007078.3(LDB3):c.272C>T (p.Thr91Met) rs769237367
NM_007078.3(LDB3):c.281C>T (p.Pro94Leu)
NM_007078.3(LDB3):c.287T>C (p.Val96Ala) rs794729056
NM_007078.3(LDB3):c.290A>G (p.Gln97Arg) rs762580653
NM_007078.3(LDB3):c.304G>A (p.Val102Met)
NM_007078.3(LDB3):c.319A>T (p.Lys107Ter)
NM_007078.3(LDB3):c.31G>A (p.Gly11Arg)
NM_007078.3(LDB3):c.356C>T (p.Ala119Val) rs397517223
NM_007078.3(LDB3):c.368G>A (p.Ser123Asn)
NM_007078.3(LDB3):c.390AGGCACCCC[1] (p.131GTP[1])
NM_007078.3(LDB3):c.465C>A (p.Leu155=)
NM_007078.3(LDB3):c.47G>A (p.Arg16His)
NM_007078.3(LDB3):c.494G>A (p.Arg165Gln) rs61857115
NM_007078.3(LDB3):c.4T>A (p.Ser2Thr) rs1564626023
NM_007078.3(LDB3):c.529del (p.Ala177fs) rs730880345
NM_007078.3(LDB3):c.529dup (p.Ala177fs) rs730880345
NM_007078.3(LDB3):c.530C>T (p.Ala177Val) rs397517224
NM_007078.3(LDB3):c.548del (p.Pro183fs) rs1285270306
NM_007078.3(LDB3):c.54G>T (p.Gln18His) rs149348427
NM_007078.3(LDB3):c.55G>A (p.Gly19Arg) rs777413488
NM_007078.3(LDB3):c.55G>C (p.Gly19Arg)
NM_007078.3(LDB3):c.55G>T (p.Gly19Trp) rs777413488
NM_007078.3(LDB3):c.566C>T (p.Ser189Leu) rs45487699
NM_007078.3(LDB3):c.56G>A (p.Gly19Glu)
NM_007078.3(LDB3):c.592C>T (p.Pro198Ser) rs1060501318
NM_007078.3(LDB3):c.608C>T (p.Ser203Leu)
NM_007078.3(LDB3):c.626A>T (p.Glu209Val)
NM_007078.3(LDB3):c.655C>T (p.Arg219Ter) rs727503123
NM_007078.3(LDB3):c.656G>A (p.Arg219Gln) rs530979771
NM_007078.3(LDB3):c.668C>T (p.Ser223Leu) rs375306400
NM_007078.3(LDB3):c.689+3877G>A rs397516556
NM_007078.3(LDB3):c.689+3879T>G
NM_007078.3(LDB3):c.689+3885A>G
NM_007078.3(LDB3):c.689+3886C>G rs369470035
NM_007078.3(LDB3):c.689+3899T>C rs1264291601
NM_007078.3(LDB3):c.690-2A>G rs1060501315
NM_007078.3(LDB3):c.690-4619_690-4618delinsTA rs1060501314
NM_007078.3(LDB3):c.690-4621A>G rs370053163
NM_007078.3(LDB3):c.690-4642A>G rs1310394018
NM_007078.3(LDB3):c.690-4655C>A rs1220958570
NM_007078.3(LDB3):c.690-4661G>T
NM_007078.3(LDB3):c.690-4682G>C rs1000020884
NM_007078.3(LDB3):c.690-4692G>A rs1413446799
NM_007078.3(LDB3):c.690-4700A>G
NM_007078.3(LDB3):c.690-4705C>T rs778658354
NM_007078.3(LDB3):c.690-4717C>A
NM_007078.3(LDB3):c.690-4739G>A rs376489385
NM_007078.3(LDB3):c.690-4742G>A rs915830221
NM_007078.3(LDB3):c.690-4767C>G rs928294708
NM_007078.3(LDB3):c.690-4802C>A rs755513516
NM_007078.3(LDB3):c.690-4808T>A
NM_007078.3(LDB3):c.690-4811C>T rs750606592
NM_007078.3(LDB3):c.690-4817C>T rs1564639205
NM_007078.3(LDB3):c.690-4819A>C
NM_007078.3(LDB3):c.690-4826G>A rs200458194
NM_007078.3(LDB3):c.690-4827C>T
NM_007078.3(LDB3):c.715G>A (p.Val239Ile) rs201417512
NM_007078.3(LDB3):c.724G>A (p.Ala242Thr)
NM_007078.3(LDB3):c.72C>A (p.Asn24Lys) rs1323002546
NM_007078.3(LDB3):c.730C>G (p.Pro244Ala)
NM_007078.3(LDB3):c.733G>A (p.Val245Ile) rs573061464
NM_007078.3(LDB3):c.769G>C (p.Glu257Gln)
NM_007078.3(LDB3):c.778G>A (p.Ala260Thr) rs777637914
NM_007078.3(LDB3):c.782A>C (p.Asp261Ala) rs1285921374
NM_007078.3(LDB3):c.784G>A (p.Glu262Lys)
NM_007078.3(LDB3):c.793C>T (p.Arg265Cys) rs45521338
NM_007078.3(LDB3):c.796C>T (p.Arg266Cys)
NM_007078.3(LDB3):c.80T>C (p.Leu27Pro) rs1057517864
NM_007078.3(LDB3):c.818G>A (p.Arg273His)
NM_007078.3(LDB3):c.826C>T (p.Arg276Cys) rs397517226
NM_007078.3(LDB3):c.827G>A (p.Arg276His) rs774519585
NM_007078.3(LDB3):c.833T>G (p.Leu278Arg)
NM_007078.3(LDB3):c.858C>T (p.Phe286=) rs764056994
NM_007078.3(LDB3):c.886C>T (p.Arg296Ter) rs1060501316
NM_007078.3(LDB3):c.887G>A (p.Arg296Gln) rs201689564
NM_007078.3(LDB3):c.891G>T (p.Arg297Ser) rs374336814
NM_007078.3(LDB3):c.892T>C (p.Ser298Pro)
NM_007078.3(LDB3):c.892T>G (p.Ser298Ala)
NM_007078.3(LDB3):c.896+5G>A
NM_007078.3(LDB3):c.896+6717G>A
NM_007078.3(LDB3):c.896+6721C>T rs375798002
NM_007078.3(LDB3):c.896+6723G>C rs868365512
NM_007078.3(LDB3):c.896+6730A>G
NM_007078.3(LDB3):c.896+6730A>T
NM_007078.3(LDB3):c.896+6738C>T rs377201153
NM_007078.3(LDB3):c.896+6739G>A
NM_007078.3(LDB3):c.896+6749A>G
NM_007078.3(LDB3):c.896+6753C>G
NM_007078.3(LDB3):c.896+6753C>T rs121908335
NM_007078.3(LDB3):c.896+6754G>A
NM_007078.3(LDB3):c.896+6761G>A
NM_007078.3(LDB3):c.896+6768G>A rs771037817
NM_007078.3(LDB3):c.896+6781A>C rs1589656313
NM_007078.3(LDB3):c.897-1_897del
NM_007078.3(LDB3):c.897-6759C>G rs11594242
NM_007078.3(LDB3):c.897-7T>A
NM_007078.3(LDB3):c.89C>A (p.Ser30Tyr)
NM_007078.3(LDB3):c.914C>A (p.Ala305Glu)
NM_007078.3(LDB3):c.91C>G (p.Arg31Gly)
NM_007078.3(LDB3):c.91C>T (p.Arg31Trp) rs367792378
NM_007078.3(LDB3):c.92G>A (p.Arg31Gln) rs1410128172
NM_007078.3(LDB3):c.94-9T>C rs1282721488
NM_007078.3(LDB3):c.940A>G (p.Thr314Ala)
NM_007078.3(LDB3):c.944C>T (p.Pro315Leu)
NM_007078.3(LDB3):c.953C>A (p.Pro318His)
NM_007078.3(LDB3):c.955G>A (p.Ala319Thr) rs151219713
NM_007078.3(LDB3):c.991G>A (p.Ala331Thr) rs749520121
NM_007078.3(LDB3):c.992C>T (p.Ala331Val)
NM_007078.3(LDB3):c.998C>T (p.Ser333Leu)
NM_007078.3(LDB3):c.99dup (p.Pro34fs) rs1554849000
NM_018834.6(MATR3):c.1090C>T (p.His364Tyr)
NM_018834.6(MATR3):c.1132G>A (p.Ala378Thr) rs201075828
NM_018834.6(MATR3):c.1139A>G (p.Asn380Ser)
NM_018834.6(MATR3):c.1363A>G (p.Thr455Ala) rs781213918
NM_018834.6(MATR3):c.1435-10T>C rs772340385
NM_018834.6(MATR3):c.1464T>A (p.Phe488Leu)
NM_018834.6(MATR3):c.1572G>T (p.Lys524Asn) rs1581251198
NM_018834.6(MATR3):c.1598G>A (p.Ser533Asn) rs1033118784
NM_018834.6(MATR3):c.1638G>A (p.Met546Ile)
NM_018834.6(MATR3):c.1778+5T>C
NM_018834.6(MATR3):c.1874A>C (p.Lys625Thr) rs1488614478
NM_018834.6(MATR3):c.1885_1887del (p.Glu629del)
NM_018834.6(MATR3):c.1904G>A (p.Gly635Asp)
NM_018834.6(MATR3):c.1912G>C (p.Asp638His) rs1554148872
NM_018834.6(MATR3):c.1948A>C (p.Met650Leu) rs749026971
NM_018834.6(MATR3):c.2038G>A (p.Asp680Asn) rs752161415
NM_018834.6(MATR3):c.2038G>C (p.Asp680His)
NM_018834.6(MATR3):c.2066C>A (p.Ser689Tyr)
NM_018834.6(MATR3):c.2133G>C (p.Lys711Asn)
NM_018834.6(MATR3):c.2161G>A (p.Glu721Lys) rs764645698
NM_018834.6(MATR3):c.2180A>G (p.Asn727Ser) rs1468138513
NM_018834.6(MATR3):c.2213A>G (p.Glu738Gly) rs538917496
NM_018834.6(MATR3):c.2227C>T (p.Pro743Ser)
NM_018834.6(MATR3):c.2234C>T (p.Ala745Val) rs199797401
NM_018834.6(MATR3):c.2254GAT[1] (p.Asp753del)
NM_018834.6(MATR3):c.2273C>A (p.Thr758Lys) rs757346695
NM_018834.6(MATR3):c.2282A>G (p.Asn761Ser) rs758675030
NM_018834.6(MATR3):c.2310G>C (p.Lys770Asn)
NM_018834.6(MATR3):c.2314G>A (p.Asp772Asn)
NM_018834.6(MATR3):c.2318A>G (p.Tyr773Cys)
NM_018834.6(MATR3):c.2357C>G (p.Pro786Arg)
NM_018834.6(MATR3):c.2372-3dup rs1561945483
NM_018834.6(MATR3):c.2504A>G (p.Asn835Ser) rs201165929
NM_018834.6(MATR3):c.2521C>T (p.Arg841Cys) rs781050726
NM_018834.6(MATR3):c.2525G>C (p.Arg842Thr) rs749235364
NM_018834.6(MATR3):c.272G>A (p.Ser91Asn)
NM_018834.6(MATR3):c.304C>T (p.Arg102Cys) rs1327023414
NM_018834.6(MATR3):c.322G>T (p.Ala108Ser) rs745440760
NM_018834.6(MATR3):c.449C>G (p.Thr150Ser)
NM_018834.6(MATR3):c.493_495del (p.Ala165del)
NM_018834.6(MATR3):c.561T>G (p.Asp187Glu) rs374819399
NM_018834.6(MATR3):c.628_630del (p.Glu210del)
NM_018834.6(MATR3):c.689G>T (p.Cys230Phe)
NM_018834.6(MATR3):c.793C>A (p.Leu265Ile) rs1554146560
NM_018834.6(MATR3):c.813C>T (p.Gly271=)
NM_018834.6(MATR3):c.857C>T (p.Pro286Leu)
NM_018834.6(MATR3):c.85C>T (p.Leu29Phe)
NM_022173.4(TIA1):c.1006G>A (p.Gly336Ser)
NM_022173.4(TIA1):c.1078G>A (p.Val360Met) rs201905164
NM_022173.4(TIA1):c.1082A>C (p.Gln361Pro) rs556545503
NM_022173.4(TIA1):c.1085C>T (p.Pro362Leu)
NM_022173.4(TIA1):c.1096C>T (p.Gln366Ter)
NM_022173.4(TIA1):c.1108A>G (p.Met370Val)
NM_022173.4(TIA1):c.1117A>G (p.Asn373Asp)
NM_022173.4(TIA1):c.1118A>G (p.Asn373Ser)
NM_022173.4(TIA1):c.1146G>T (p.Gly382=)
NM_022173.4(TIA1):c.1156del (p.Gln386fs) rs1553422555
NM_022173.4(TIA1):c.143A>G (p.Tyr48Cys)
NM_022173.4(TIA1):c.154G>A (p.Glu52Lys)
NM_022173.4(TIA1):c.167A>G (p.His56Arg)
NM_022173.4(TIA1):c.209A>T (p.Lys70Met)
NM_022173.4(TIA1):c.223-3T>A rs750261656
NM_022173.4(TIA1):c.27-6T>A rs1573660635
NM_022173.4(TIA1):c.277+3_277+5dup rs1266600719
NM_022173.4(TIA1):c.277+6T>G
NM_022173.4(TIA1):c.311A>T (p.Asp104Val) rs143209672
NM_022173.4(TIA1):c.328G>A (p.Val110Ile)
NM_022173.4(TIA1):c.380C>T (p.Ala127Val) rs1558837955
NM_022173.4(TIA1):c.398+3A>G
NM_022173.4(TIA1):c.398C>T (p.Ser133Leu)
NM_022173.4(TIA1):c.422T>C (p.Met141Thr) rs1558817897
NM_022173.4(TIA1):c.475-3C>T rs200499196
NM_022173.4(TIA1):c.562G>T (p.Ala188Ser)
NM_022173.4(TIA1):c.597G>C (p.Gln199His)
NM_022173.4(TIA1):c.683A>T (p.Gln228Leu)
NM_022173.4(TIA1):c.689T>C (p.Met230Thr)
NM_022173.4(TIA1):c.70C>G (p.Leu24Val)
NM_022173.4(TIA1):c.770A>T (p.Asn257Ile) rs765028674
NM_022173.4(TIA1):c.805G>A (p.Val269Ile)
NM_022173.4(TIA1):c.869T>C (p.Met290Thr) rs116707801
NM_022173.4(TIA1):c.880G>A (p.Val294Met) rs144296151
NM_022173.4(TIA1):c.913C>T (p.Pro305Ser)
NM_022173.4(TIA1):c.971C>G (p.Pro324Arg)
NM_022173.4(TIA1):c.98G>T (p.Cys33Phe)
NM_022173.4(TIA1):c.992C>T (p.Ala331Val)
Single allele

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.