ClinVar Miner

List of variants in gene TTN studied for familial isolated arrhythmogenic right ventricular dysplasia

Included ClinVar conditions (26):

Arrhythmogenic cardiomyopathy with wooly hair and keratoderma; Arrhythmogenic right ventricular dysplasia 8
Arrhythmogenic cardiomyopathy with wooly hair and keratoderma; Arrhythmogenic right ventricular dysplasia 8; Cardiomyopathy, dilated, with wooly hair, keratoderma, and tooth agenesis
Arrhythmogenic cardiomyopathy with wooly hair and keratoderma; Arrhythmogenic right ventricular dysplasia 8; Lethal acantholytic epidermolysis bullosa; Keratosis palmoplantaris striata 2; Cardiomyopathy, dilated, with wooly hair, keratoderma, and tooth agenesis
Arrhythmogenic cardiomyopathy with wooly hair and keratoderma; Arrhythmogenic right ventricular dysplasia 8; Lethal acantholytic epidermolysis bullosa; Woolly hair-skin fragility syndrome; Keratosis palmoplantaris striata 2; Cardiomyopathy, dilated, with wooly hair, keratoderma, and tooth agenesis
Arrhythmogenic right ventricular dysplasia 1
Arrhythmogenic right ventricular dysplasia 10
Arrhythmogenic right ventricular dysplasia 10; Dilated cardiomyopathy 1BB
Arrhythmogenic right ventricular dysplasia 11
Arrhythmogenic right ventricular dysplasia 12
Arrhythmogenic right ventricular dysplasia 13
Arrhythmogenic right ventricular dysplasia 1; Rienhoff syndrome
Arrhythmogenic right ventricular dysplasia 2
Arrhythmogenic right ventricular dysplasia 2; Catecholaminergic polymorphic ventricular tachycardia 1
Arrhythmogenic right ventricular dysplasia 2; Catecholaminergic polymorphic ventricular tachycardia 1; Ventricular arrhythmias due to cardiac ryanodine receptor calcium release deficiency syndrome
Arrhythmogenic right ventricular dysplasia 5
Arrhythmogenic right ventricular dysplasia 5; Emery-Dreifuss muscular dystrophy 7, autosomal dominant; Auditory neuropathy, autosomal dominant 3
Arrhythmogenic right ventricular dysplasia 8
Arrhythmogenic right ventricular dysplasia 9
Arrhythmogenic right ventricular dysplasia, familial, 14
Arrhythmogenic right ventricular dysplasia, familial, 14; Agenesis of corpus callosum, cardiac, ocular, and genital syndrome
Catecholaminergic polymorphic ventricular tachycardia 1
Catecholaminergic polymorphic ventricular tachycardia 1; Catecholaminergic polymorphic ventricular tachycardia 2
Catecholaminergic polymorphic ventricular tachycardia 1; Catecholaminergic polymorphic ventricular tachycardia 5
Catecholaminergic polymorphic ventricular tachycardia 1; Ventricular arrhythmias due to cardiac ryanodine receptor calcium release deficiency syndrome
Familial isolated arrhythmogenic right ventricular dysplasia
Naxos disease; Arrhythmogenic right ventricular dysplasia 12

Minimum submission review status:		Collection method:
Minimum conflict level: Report conflict between different conditions
Gene type: Distinguish antisense genes from sense genes
		ClinVar version:

Total variants: 6

Download table as spreadsheet

HGVS	dbSNP	gnomAD frequency
NM_001267550.2(TTN):c.59113C>T (p.Arg19705Cys)	rs72646839	0.00024
NM_001267550.2(TTN):c.102877A>G (p.Lys34293Glu)	rs72629783	0.00016
NM_001267550.2(TTN):c.68827G>T (p.Ala22943Ser)	rs878941853	0.00001
NM_001267550.2(TTN):c.104753T>G (p.Leu34918Ter)
NM_001267550.2(TTN):c.34129GTTCTACCTGAAGAAGAGGAA[1] (p.11363VLPEEEE[3])	rs587780487
NM_001267550.2(TTN):c.88825C>T (p.Arg29609Ter)	rs766450773

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.