ClinVar Miner

List of variants studied for Charcot-Marie-Tooth disease type 4

Included ClinVar conditions (25):
Minimum submission review status: Collection method:
Minimum conflict level:
ClinVar version:
Total variants: 1844
Download table as spreadsheet
HGVS dbSNP
FGD4, 893T-G
GRCh37/hg19 12p11.21(chr12:32717818-32778686)x4
GRCh37/hg19 1q23.3(chr1:161255241-161276497)
MTMR2, 10-BP DEL/2-BP INS
MTMR2, IVS13, G-A, +1
NC_000005.10:g.(?_149062971)_(149063174_?)del
NC_000006.12:g.(?_109691416)_(109691521_?)del
NC_000006.12:g.(?_109741424)_(109743792_?)del
NC_000008.10:g.134265065_134271319dup
NC_000008.9:g.(75248716_75262617)_(75559358_75586021)del
NC_000011.10:g.(?_10193902)_(10193987_?)del
NC_000012.11:g.(?_32786463)_(32832419_?)dup
NC_000012.12:g.(?_32576352)_(32619876_?)del
NC_000012.12:g.(?_32598477)_(32598606_?)del
NC_000019.10:g.(?_40403686)_(40403882_?)del
NG_007943.1:g.(43089_43830)_(47717_51712)dup
NM_000188.2(HK1):c.1370C>T (p.Thr457Met) rs1057517928
NM_000399.4(EGR2):c.1146T>G (p.Ser382Arg) rs281865138
NM_000399.4(EGR2):c.1147G>T (p.Asp383Tyr) rs104894160
NM_000399.4(EGR2):c.803T>A (p.Ile268Asn) rs104894158
NM_000530.6(MPZ):c.133C>T (p.Arg45Trp) rs200151353
NM_000530.6(MPZ):c.371C>T (p.Thr124Met) rs121913595
NM_000530.6(MPZ):c.434A>C (p.Tyr145Ser) rs121913603
NM_000530.6(MPZ):c.499G>C (p.Gly167Arg) rs121913586
NM_000530.6(MPZ):c.637G>C (p.Gly213Arg) rs202176679
NM_000530.6(MPZ):c.684C>T (p.Ser228=) rs34307129
NM_000530.7(MPZ):c.*1020G>A rs886045472
NM_000530.7(MPZ):c.*1048A>T rs71639057
NM_000530.7(MPZ):c.*1074A>C rs886045471
NM_000530.7(MPZ):c.*195G>T rs150182811
NM_000530.7(MPZ):c.*251C>G rs772995394
NM_000530.7(MPZ):c.*52G>A rs774701563
NM_000530.7(MPZ):c.*568C>G rs60731755
NM_000530.7(MPZ):c.*624C>T rs60821801
NM_000530.7(MPZ):c.*681A>T rs886045474
NM_000530.7(MPZ):c.*743C>T rs140992541
NM_000530.7(MPZ):c.*761A>G rs16832786
NM_000530.7(MPZ):c.*858T>C rs886045473
NM_000530.7(MPZ):c.*907_*910dupGAGA rs149030537
NM_000530.7(MPZ):c.*954C>A rs372340608
NM_000530.7(MPZ):c.-49C>A rs750777955
NM_000530.7(MPZ):c.397C>A (p.Pro133Thr) rs1553259648
NM_000530.7(MPZ):c.451C>A (p.Pro151Thr)
NM_000530.7(MPZ):c.504G>A (p.Val168=) rs145592910
NM_000530.7(MPZ):c.515T>C (p.Leu172Pro) rs886045475
NM_000530.7(MPZ):c.600G>A (p.Gly200=) rs16832790
NM_000530.7(MPZ):c.77C>T (p.Pro26Leu) rs530923760
NM_001135242.1(NDRG1):c.442C>T (p.Arg148Ter) rs119483085
NM_001136178.1(EGR2):c.1084C>T (p.Arg362Ter) rs1554853028
NM_001304481.1(FGD4):c.10+15957C>A rs79370524
NM_001304481.1(FGD4):c.3delG (p.Gly3Alafs)
NM_001376.5(DYNC1H1):c.1792C>T (p.Arg598Cys) rs587780564
NM_002972.3(SBF1):c.1249A>G (p.Met417Val) rs587776986
NM_002972.3(SBF1):c.1448C>G (p.Ala483Gly) rs1556430522
NM_002972.3(SBF1):c.2605G>A (p.Val869Met) rs200365973
NM_002972.3(SBF1):c.4378T>G (p.Leu1460Val) rs1404020990
NM_002972.3(SBF1):c.4768A>G (p.Thr1590Ala) rs200488568
NM_002972.3:c.2154_2155delGG
NM_002972.4(SBF1):c.1327G>A (p.Asp443Asn) rs690016543
NM_003001.3(SDHC):c.-38G>A rs112556972
NM_003001.3(SDHC):c.20+11_20+12dupTG rs35215598
NM_003172.3(SURF1):c.107-2A>G rs782726390
NM_003172.3(SURF1):c.312_321delTCTGCCAGCCinsAT (p.Leu105Terfs) rs863224228
NM_003172.3(SURF1):c.574C>T (p.Arg192Trp) rs782190413
NM_003172.3(SURF1):c.588+1G>A rs1219762677
NM_003172.3(SURF1):c.799_800del (p.Leu267Glufs) rs864309500
NM_003172.3(SURF1):c.814_815insGAGCATC (p.Leu272Argfs) rs1554768224
NM_003172.3(SURF1):c.845_846delCT (p.Ser282Cysfs) rs782316919
NM_006096.3(NDRG1):c.*100G>A rs2233348
NM_006096.3(NDRG1):c.*1135G>A rs10675
NM_006096.3(NDRG1):c.*1195G>T rs561506934
NM_006096.3(NDRG1):c.*1294T>C rs144034977
NM_006096.3(NDRG1):c.*1296C>T rs886062711
NM_006096.3(NDRG1):c.*1340G>A rs12668
NM_006096.3(NDRG1):c.*1473G>A rs187466317
NM_006096.3(NDRG1):c.*1622T>G rs7825439
NM_006096.3(NDRG1):c.*1706G>A rs781277187
NM_006096.3(NDRG1):c.*184G>A rs778104868
NM_006096.3(NDRG1):c.*201A>T rs886062715
NM_006096.3(NDRG1):c.*264C>G rs73711834
NM_006096.3(NDRG1):c.*306C>T rs886062714
NM_006096.3(NDRG1):c.*402C>T rs551081194
NM_006096.3(NDRG1):c.*618T>G rs886062713
NM_006096.3(NDRG1):c.*653T>C rs147301529
NM_006096.3(NDRG1):c.*677C>T rs886062712
NM_006096.3(NDRG1):c.*691G>A rs1049694
NM_006096.3(NDRG1):c.*69C>T rs114738844
NM_006096.3(NDRG1):c.*711C>T rs16904866
NM_006096.3(NDRG1):c.*834T>A rs79281324
NM_006096.3(NDRG1):c.*866A>T rs16904865
NM_006096.3(NDRG1):c.*956T>C rs1049697
NM_006096.3(NDRG1):c.-120C>T rs11575971
NM_006096.3(NDRG1):c.-123T>G rs886062718
NM_006096.3(NDRG1):c.-128C>T rs886062719
NM_006096.3(NDRG1):c.-157C>T rs545130040
NM_006096.3(NDRG1):c.-173G>A rs886062720
NM_006096.3(NDRG1):c.-19+14C>G rs886062716
NM_006096.3(NDRG1):c.-64G>A rs886062717
NM_006096.3(NDRG1):c.1022G>A (p.Arg341His) rs1392179290
NM_006096.3(NDRG1):c.1027C>T (p.Arg343Cys) rs146613168
NM_006096.3(NDRG1):c.1028G>A (p.Arg343His) rs144714216
NM_006096.3(NDRG1):c.1032_1091delCCACACCAGCGAGGGCACCCGAAGCCGCTCCCACACCAGCGAGGGCACCCGCAGCCGCTC (p.Thr350_Gly369del) rs1554747479
NM_006096.3(NDRG1):c.1051C>T (p.Arg351Ter) rs765621411
NM_006096.3(NDRG1):c.106G>T (p.Asp36Tyr) rs745832151
NM_006096.3(NDRG1):c.1077_1106dup (p.Gly369_Ala370insThrArgSerArgSerHisThrSerGluGly) rs1554747463
NM_006096.3(NDRG1):c.1085G>A (p.Ser362Asn) rs749124058
NM_006096.3(NDRG1):c.1086C>T (p.Ser362=) rs1189614460
NM_006096.3(NDRG1):c.1088G>A (p.Arg363His) rs181121989
NM_006096.3(NDRG1):c.1101C>T (p.Ser367=) rs201959970
NM_006096.3(NDRG1):c.1109C>G (p.Ala370Gly) rs367925853
NM_006096.3(NDRG1):c.1109C>T (p.Ala370Val) rs367925853
NM_006096.3(NDRG1):c.1112_1114delACCinsTTT (p.His371Leu) rs1554747447
NM_006096.3(NDRG1):c.1152C>T (p.Ser384=) rs863224413
NM_006096.3(NDRG1):c.122A>G (p.His41Arg) rs2233318
NM_006096.3(NDRG1):c.166C>T (p.Arg56Trp)
NM_006096.3(NDRG1):c.196G>A (p.Gly66Ser) rs780329667
NM_006096.3(NDRG1):c.199A>G (p.Met67Val) rs2233319
NM_006096.3(NDRG1):c.205+1G>A rs1060503092
NM_006096.3(NDRG1):c.212C>A (p.Thr71Asn) rs1554591949
NM_006096.3(NDRG1):c.303C>T (p.Asp101=) rs765528167
NM_006096.3(NDRG1):c.304G>A (p.Gly102Ser) rs200433822
NM_006096.3(NDRG1):c.306C>T (p.Gly102=) rs2233322
NM_006096.3(NDRG1):c.307G>C (p.Ala103Pro) rs374160497
NM_006096.3(NDRG1):c.311C>A (p.Ala104Asp)
NM_006096.3(NDRG1):c.31G>A (p.Ala11Thr) rs145871479
NM_006096.3(NDRG1):c.331A>C (p.Met111Leu) rs2233328
NM_006096.3(NDRG1):c.345G>T (p.Met115Ile)
NM_006096.3(NDRG1):c.373G>A (p.Val125Ile) rs200593999
NM_006096.3(NDRG1):c.389+8C>T rs375532877
NM_006096.3(NDRG1):c.416C>G (p.Thr139Arg) rs863224745
NM_006096.3(NDRG1):c.4T>C (p.Ser2Pro)
NM_006096.3(NDRG1):c.506C>T (p.Ala169Val) rs963190299
NM_006096.3(NDRG1):c.507G>A (p.Ala169=) rs2233331
NM_006096.3(NDRG1):c.528C>G (p.Ala176=) rs191237702
NM_006096.3(NDRG1):c.538-1G>A
NM_006096.3(NDRG1):c.563C>T (p.Pro188Leu)
NM_006096.3(NDRG1):c.594+8G>T rs767524421
NM_006096.3(NDRG1):c.595-6A>G rs1554749794
NM_006096.3(NDRG1):c.613G>A (p.Val205Met) rs138839833
NM_006096.3(NDRG1):c.63+6T>C rs199597649
NM_006096.3(NDRG1):c.64-13dupT rs756038946
NM_006096.3(NDRG1):c.64-6T>C rs2272653
NM_006096.3(NDRG1):c.660C>A (p.Asn220Lys) rs143549909
NM_006096.3(NDRG1):c.663C>T (p.Pro221=) rs377225752
NM_006096.3(NDRG1):c.664G>A (p.Gly222Ser) rs199995009
NM_006096.3(NDRG1):c.686A>G (p.Asn229Ser) rs137993172
NM_006096.3(NDRG1):c.69C>A (p.Ile23=) rs369862936
NM_006096.3(NDRG1):c.703C>T (p.Arg235Cys) rs772268356
NM_006096.3(NDRG1):c.704G>A (p.Arg235His) rs748331213
NM_006096.3(NDRG1):c.755+10T>C rs2233336
NM_006096.3(NDRG1):c.755+9C>T rs756756059
NM_006096.3(NDRG1):c.756-5C>T rs2227262
NM_006096.3(NDRG1):c.789G>A (p.Ser263=) rs61755062
NM_006096.3(NDRG1):c.800A>G (p.Asp267Gly) rs1287073036
NM_006096.3(NDRG1):c.813G>A (p.Glu271=) rs368468160
NM_006096.3(NDRG1):c.855+14_855+15delAG rs780070007
NM_006096.3(NDRG1):c.861G>A (p.Ala287=) rs150101908
NM_006096.3(NDRG1):c.879G>A (p.Pro293=) rs2233340
NM_006096.3(NDRG1):c.891+5G>A rs150968034
NM_006096.3(NDRG1):c.892-5C>T rs2233346
NM_006096.3(NDRG1):c.892-9C>G rs987790520
NM_006096.3(NDRG1):c.893C>T (p.Pro298Leu) rs753836263
NM_006096.3(NDRG1):c.894G>A (p.Pro298=) rs368061370
NM_006096.3(NDRG1):c.904G>A (p.Ala302Thr) rs373637595
NM_006096.3(NDRG1):c.93T>C (p.Asp31=) rs773317729
NM_006096.3(NDRG1):c.950C>T (p.Ser317Leu)
NM_006096.3(NDRG1):c.956G>A (p.Ser319Asn)
NM_006096.3(NDRG1):c.964C>T (p.Arg322Cys) rs368404338
NM_006096.3(NDRG1):c.973C>T (p.Arg325Trp) rs141078746
NM_006096.3(NDRG1):c.980G>A (p.Arg327His) rs565705964
NM_014845.5(FIG4):c.*120C>T rs1127775
NM_014845.5(FIG4):c.*14C>T rs114136062
NM_014845.5(FIG4):c.*150_*151delAT rs886060986
NM_014845.5(FIG4):c.*29G>A rs10659
NM_014845.5(FIG4):c.*7C>T rs113946190
NM_014845.5(FIG4):c.-112G>A rs757848529
NM_014845.5(FIG4):c.-120C>T rs75045314
NM_014845.5(FIG4):c.-121G>A rs75509752
NM_014845.5(FIG4):c.-124A>G rs544958043
NM_014845.5(FIG4):c.-132A>G rs548471516
NM_014845.5(FIG4):c.-134C>G rs560811735
NM_014845.5(FIG4):c.-138T>C rs550585093
NM_014845.5(FIG4):c.-182G>A rs55873083
NM_014845.5(FIG4):c.-84A>G rs764845399
NM_014845.5(FIG4):c.101C>T (p.Thr34Met) rs375691683
NM_014845.5(FIG4):c.1040-4T>C rs374343214
NM_014845.5(FIG4):c.1043_1050delATCAGGCA (p.Asp348Glyfs)
NM_014845.5(FIG4):c.1064A>G (p.His355Arg) rs772356514
NM_014845.5(FIG4):c.1090A>T (p.Met364Leu) rs2295837
NM_014845.5(FIG4):c.109C>T (p.Arg37Cys) rs368625871
NM_014845.5(FIG4):c.110G>A (p.Arg37His)
NM_014845.5(FIG4):c.1141C>T (p.Arg381Ter) rs377357931
NM_014845.5(FIG4):c.1199A>G (p.Tyr400Cys)
NM_014845.5(FIG4):c.1205delA (p.Asn402Thrfs) rs1554303800
NM_014845.5(FIG4):c.120G>T (p.Lys40Asn)
NM_014845.5(FIG4):c.122T>C (p.Ile41Thr) rs121908287
NM_014845.5(FIG4):c.1242T>C (p.Ile414=) rs61729087
NM_014845.5(FIG4):c.1272-10C>G rs201293291
NM_014845.5(FIG4):c.1313A>G (p.Glu438Gly)
NM_014845.5(FIG4):c.1338C>G (p.Phe446Leu)
NM_014845.5(FIG4):c.1348C>T (p.Arg450Cys) rs201072058
NM_014845.5(FIG4):c.1350C>G (p.Arg450=) rs763035100
NM_014845.5(FIG4):c.137C>G (p.Pro46Arg)
NM_014845.5(FIG4):c.1427G>A (p.Arg476His) rs192823053
NM_014845.5(FIG4):c.1435-8C>T rs754607430
NM_014845.5(FIG4):c.14C>T (p.Ala5Val) rs915749340
NM_014845.5(FIG4):c.1525C>T (p.Leu509=) rs146488614
NM_014845.5(FIG4):c.1544T>C (p.Ile515Thr) rs370249754
NM_014845.5(FIG4):c.1584-8T>A rs199522051
NM_014845.5(FIG4):c.173A>G (p.Tyr58Cys) rs145337669
NM_014845.5(FIG4):c.1740T>C (p.Asn580=) rs1554304608
NM_014845.5(FIG4):c.1752T>A (p.Asp584Glu) rs1060501402
NM_014845.5(FIG4):c.1755C>T (p.Ala585=) rs377111248
NM_014845.5(FIG4):c.1793T>A (p.Phe598Tyr) rs751399063
NM_014845.5(FIG4):c.1863C>A (p.Thr621=) rs201744761
NM_014845.5(FIG4):c.1877C>T (p.Pro626Leu)
NM_014845.5(FIG4):c.1879A>G (p.Thr627Ala) rs762859144
NM_014845.5(FIG4):c.1923G>A (p.Lys641=) rs140078026
NM_014845.5(FIG4):c.1940A>G (p.Tyr647Cys) rs150301327
NM_014845.5(FIG4):c.1948+3A>G rs10499054
NM_014845.5(FIG4):c.1961T>C (p.Val654Ala) rs9885672
NM_014845.5(FIG4):c.2011A>G (p.Ile671Val) rs1554307877
NM_014845.5(FIG4):c.2036G>A (p.Arg679Gln)
NM_014845.5(FIG4):c.2042A>G (p.Tyr681Cys)
NM_014845.5(FIG4):c.2095C>T (p.Arg699Cys) rs764799053
NM_014845.5(FIG4):c.2096G>A (p.Arg699His) rs750091928
NM_014845.5(FIG4):c.2097-10C>G rs142482745
NM_014845.5(FIG4):c.2098G>T (p.Asp700Tyr) rs1554308483
NM_014845.5(FIG4):c.2113A>G (p.Thr705Ala) rs766031746
NM_014845.5(FIG4):c.2115C>T (p.Thr705=) rs201271644
NM_014845.5(FIG4):c.2146C>T (p.Arg716Cys) rs139235893
NM_014845.5(FIG4):c.2154A>G (p.Pro718=) rs201138266
NM_014845.5(FIG4):c.2192A>G (p.Asn731Ser) rs1467094847
NM_014845.5(FIG4):c.2199A>G (p.Glu733=) rs537464083
NM_014845.5(FIG4):c.2200G>A (p.Glu734Lys) rs372846619
NM_014845.5(FIG4):c.2223G>T (p.Thr741=) rs181012139
NM_014845.5(FIG4):c.2241G>C (p.Pro747=) rs148589135
NM_014845.5(FIG4):c.2285_2286delCT (p.Ser762Trpfs)
NM_014845.5(FIG4):c.2289G>A (p.Gly763=) rs756539176
NM_014845.5(FIG4):c.2339A>G (p.Lys780Arg) rs373590484
NM_014845.5(FIG4):c.235G>A (p.Gly79Arg) rs886060982
NM_014845.5(FIG4):c.2376+5G>C rs528952794
NM_014845.5(FIG4):c.2377-10T>A rs9481005
NM_014845.5(FIG4):c.2382G>A (p.Val794=) rs1201567620
NM_014845.5(FIG4):c.2386C>T (p.Gln796Ter)
NM_014845.5(FIG4):c.243A>G (p.Lys81=) rs200257799
NM_014845.5(FIG4):c.2459+7T>G rs575271308
NM_014845.5(FIG4):c.2460-8A>G rs201965891
NM_014845.5(FIG4):c.2460A>C (p.Arg820Ser) rs886060984
NM_014845.5(FIG4):c.2464G>C (p.Val822Leu) rs1208125100
NM_014845.5(FIG4):c.2523G>A (p.Arg841=) rs1554309865
NM_014845.5(FIG4):c.2546+5G>A rs1060501401
NM_014845.5(FIG4):c.2547-11A>G rs745613994
NM_014845.5(FIG4):c.2547-3T>A rs537171532
NM_014845.5(FIG4):c.2547-4A>G rs886060985
NM_014845.5(FIG4):c.2547-5T>G rs200267243
NM_014845.5(FIG4):c.2559G>A (p.Ser853=) rs1127771
NM_014845.5(FIG4):c.2567C>T (p.Ser856Leu) rs200970494
NM_014845.5(FIG4):c.2568G>T (p.Ser856=) rs140055056
NM_014845.5(FIG4):c.2695C>T (p.Arg899Ter) rs750069994
NM_014845.5(FIG4):c.2704A>G (p.Ile902Val) rs143685038
NM_014845.5(FIG4):c.27C>T (p.Ile9=) rs141040807
NM_014845.5(FIG4):c.290-2A>T rs587777715
NM_014845.5(FIG4):c.294delT (p.Phe98Leufs)
NM_014845.5(FIG4):c.300G>A (p.Arg100=) rs368831195
NM_014845.5(FIG4):c.301T>C (p.Phe101Leu)
NM_014845.5(FIG4):c.328A>G (p.Ile110Val) rs140331779
NM_014845.5(FIG4):c.350C>T (p.Ala117Val) rs551339249
NM_014845.5(FIG4):c.366T>C (p.His122=) rs772376305
NM_014845.5(FIG4):c.374A>G (p.Tyr125Cys)
NM_014845.5(FIG4):c.3_23dup (p.Pro7_Ile8insMetProThrAlaAlaAlaPro)
NM_014845.5(FIG4):c.414T>A (p.Asp138Glu)
NM_014845.5(FIG4):c.446+3A>G rs201642753
NM_014845.5(FIG4):c.446+9G>A rs190287033
NM_014845.5(FIG4):c.449A>G (p.Tyr150Cys) rs1233666827
NM_014845.5(FIG4):c.498-2A>G rs1554300952
NM_014845.5(FIG4):c.50T>C (p.Leu17Pro) rs587777713
NM_014845.5(FIG4):c.535C>G (p.Leu179Val) rs141116831
NM_014845.5(FIG4):c.547C>T (p.Arg183Ter) rs121908288
NM_014845.5(FIG4):c.584A>T (p.Gln195Leu) rs749696803
NM_014845.5(FIG4):c.589C>T (p.Arg197Cys) rs770528195
NM_014845.5(FIG4):c.590G>T (p.Arg197Leu)
NM_014845.5(FIG4):c.627A>G (p.Leu209=) rs140111406
NM_014845.5(FIG4):c.640G>A (p.Gly214Arg) rs529048339
NM_014845.5(FIG4):c.66+10C>T rs200063827
NM_014845.5(FIG4):c.67-7T>C rs56378532
NM_014845.5(FIG4):c.705G>T (p.Leu235=) rs1026195072
NM_014845.5(FIG4):c.737G>A (p.Trp246Ter) rs776005417
NM_014845.5(FIG4):c.759delG (p.Phe254Serfs) rs764717219
NM_014845.5(FIG4):c.762C>T (p.Phe254=) rs201013726
NM_014845.5(FIG4):c.805G>T (p.Val269Phe)
NM_014845.5(FIG4):c.808A>G (p.Thr270Ala) rs61729092
NM_014845.5(FIG4):c.80T>C (p.Val27Ala) rs769687105
NM_014845.5(FIG4):c.815T>C (p.Ile272Thr) rs765737780
NM_014845.5(FIG4):c.834A>T (p.Lys278Asn) rs138048706
NM_014845.5(FIG4):c.848G>A (p.Arg283His)
NM_014845.5(FIG4):c.870C>T (p.Asn290=) rs1236653957
NM_014845.5(FIG4):c.904G>A (p.Glu302Lys) rs587777714
NM_014845.5(FIG4):c.918C>T (p.Cys306=) rs369159531
NM_014845.5(FIG4):c.974G>C (p.Arg325Thr) rs1060501400
NM_014874.3(MFN2):c.*1068C>T rs886045229
NM_014874.3(MFN2):c.*1100A>G rs41278638
NM_014874.3(MFN2):c.*1153C>T rs542684406
NM_014874.3(MFN2):c.*1161C>A rs115706485
NM_014874.3(MFN2):c.*121A>G rs886045222
NM_014874.3(MFN2):c.*1258G>A rs116156978
NM_014874.3(MFN2):c.*1276G>A rs766342161
NM_014874.3(MFN2):c.*1295G>A rs763783578
NM_014874.3(MFN2):c.*1392A>G rs886045230
NM_014874.3(MFN2):c.*1488C>T rs11554507
NM_014874.3(MFN2):c.*1539G>A rs557643473
NM_014874.3(MFN2):c.*1546G>A rs3737960
NM_014874.3(MFN2):c.*1562G>A rs551566332
NM_014874.3(MFN2):c.*1576C>T rs78523898
NM_014874.3(MFN2):c.*1640delA rs35943162
NM_014874.3(MFN2):c.*1640dupA rs35943162
NM_014874.3(MFN2):c.*1706T>G rs543365043
NM_014874.3(MFN2):c.*1794_*1796delATT rs540280019
NM_014874.3(MFN2):c.*1800_*1802delGTT rs140537612
NM_014874.3(MFN2):c.*221_*222dupTT rs558848411
NM_014874.3(MFN2):c.*231G>A rs41278636
NM_014874.3(MFN2):c.*256G>A rs557772799
NM_014874.3(MFN2):c.*297T>A rs886045224
NM_014874.3(MFN2):c.*36G>A rs377468070
NM_014874.3(MFN2):c.*413C>T rs558887681
NM_014874.3(MFN2):c.*57C>T rs886045221
NM_014874.3(MFN2):c.*58A>G rs1042842
NM_014874.3(MFN2):c.*610delG rs747291228
NM_014874.3(MFN2):c.*730C>T rs112550280
NM_014874.3(MFN2):c.*777T>C rs112854268
NM_014874.3(MFN2):c.*864T>C rs886045226
NM_014874.3(MFN2):c.*870C>T rs886045227
NM_014874.3(MFN2):c.*896G>C rs3088064
NM_014874.3(MFN2):c.*912C>T rs14305
NM_014874.3(MFN2):c.*935G>T rs886045228
NM_014874.3(MFN2):c.*946C>A rs765105334
NM_014874.3(MFN2):c.-149-15T>G rs114306601
NM_014874.3(MFN2):c.-161G>A rs140094248
NM_014874.3(MFN2):c.-212T>C rs2180183
NM_014874.3(MFN2):c.-217C>A rs886045218
NM_014874.3(MFN2):c.-249T>A rs2180182
NM_014874.3(MFN2):c.-287C>T rs2180181
NM_014874.3(MFN2):c.-328T>A rs886045217
NM_014874.3(MFN2):c.-344C>T rs886045216
NM_014874.3(MFN2):c.-367A>G rs2236054
NM_014874.3(MFN2):c.-4-13G>T rs373679523
NM_014874.3(MFN2):c.1269G>A (p.Thr423=) rs145994616
NM_014874.3(MFN2):c.1403G>A (p.Arg468His) rs138382758
NM_014874.3(MFN2):c.1452G>A (p.Thr484=) rs150043585
NM_014874.3(MFN2):c.150C>A (p.Ile50=) rs78841746
NM_014874.3(MFN2):c.153G>T (p.Gln51His) rs886045219
NM_014874.3(MFN2):c.1569C>T (p.Ser523=) rs1042837
NM_014874.3(MFN2):c.159C>T (p.Ser53=) rs61733200
NM_014874.3(MFN2):c.1659G>A (p.Val553=) rs886045220
NM_014874.3(MFN2):c.165C>T (p.Thr55=) rs77458527
NM_014874.3(MFN2):c.179C>T (p.Thr60Met) rs138345244
NM_014874.3(MFN2):c.1806C>T (p.Ser602=) rs201258935
NM_014874.3(MFN2):c.1818C>T (p.Gly606=) rs373843969
NM_014874.3(MFN2):c.1827C>T (p.Ser609=) rs138724074
NM_014874.3(MFN2):c.1950G>A (p.Leu650=) rs772030424
NM_014874.3(MFN2):c.2145C>T (p.Ala715=) rs571011689
NM_014874.3(MFN2):c.2146G>A (p.Ala716Thr) rs144860227
NM_014874.3(MFN2):c.2204+15T>C rs77262016
NM_014874.3(MFN2):c.2205-13C>A rs76020240
NM_014874.3(MFN2):c.408A>T (p.Val136=) rs78814413
NM_014874.3(MFN2):c.474+4A>G rs141974160
NM_014874.3(MFN2):c.58C>T (p.His20Tyr) rs201715603
NM_014874.3(MFN2):c.891C>T (p.Ala297=) rs11554508
NM_014874.3(MFN2):c.892G>A (p.Gly298Arg) rs41278630
NM_014874.3(MFN2):c.957C>T (p.Gly319=) rs41278632
NM_014874.3(MFN2):c.975C>T (p.Gly325=) rs141475476
NM_016156.5(MTMR2):c.*1066T>C rs16922622
NM_016156.5(MTMR2):c.*1089C>G rs147982779
NM_016156.5(MTMR2):c.*1100_*1103dupATTT rs886048767
NM_016156.5(MTMR2):c.*1150C>T rs886048766
NM_016156.5(MTMR2):c.*1226_*1228delCTT rs142663762
NM_016156.5(MTMR2):c.*133C>G rs367677499
NM_016156.5(MTMR2):c.*1343_*1344delCA rs886048765
NM_016156.5(MTMR2):c.*1396C>T rs16922615
NM_016156.5(MTMR2):c.*1419G>A rs496305
NM_016156.5(MTMR2):c.*1425A>G rs886048764
NM_016156.5(MTMR2):c.*1444C>G rs149223349
NM_016156.5(MTMR2):c.*1568C>T rs596277
NM_016156.5(MTMR2):c.*1684A>C rs79576160
NM_016156.5(MTMR2):c.*1822T>G rs562826516
NM_016156.5(MTMR2):c.*1826C>A rs145394232
NM_016156.5(MTMR2):c.*1888delC rs775823662
NM_016156.5(MTMR2):c.*190G>A rs886048769
NM_016156.5(MTMR2):c.*1934T>C rs525404
NM_016156.5(MTMR2):c.*1952G>A rs118033833
NM_016156.5(MTMR2):c.*2014T>G rs112404010
NM_016156.5(MTMR2):c.*2038C>G rs886048763
NM_016156.5(MTMR2):c.*207A>G rs185702937
NM_016156.5(MTMR2):c.*2187A>G rs141738388
NM_016156.5(MTMR2):c.*2357T>C rs886048762
NM_016156.5(MTMR2):c.*2406C>T rs16922613
NM_016156.5(MTMR2):c.*347_*348delCT rs762396029
NM_016156.5(MTMR2):c.*549G>A rs611020
NM_016156.5(MTMR2):c.*660G>A rs886048768
NM_016156.5(MTMR2):c.*679A>C rs776788118
NM_016156.5(MTMR2):c.*837G>A rs532069328
NM_016156.5(MTMR2):c.*85A>C rs578159
NM_016156.5(MTMR2):c.*910T>A rs555290971
NM_016156.5(MTMR2):c.*987T>C rs57807625
NM_016156.5(MTMR2):c.-222G>C rs746848952
NM_016156.5(MTMR2):c.-82C>T rs886048773
NM_016156.5(MTMR2):c.1034delA (p.Asn345Metfs) rs863224516
NM_016156.5(MTMR2):c.1131C>T (p.Thr377=) rs566204
NM_016156.5(MTMR2):c.1164G>A (p.Trp388Ter) rs1555060024
NM_016156.5(MTMR2):c.1175T>C (p.Ile392Thr) rs1555060014
NM_016156.5(MTMR2):c.1190C>G (p.Ala397Gly)
NM_016156.5(MTMR2):c.1233G>A (p.Thr411=) rs113897932
NM_016156.5(MTMR2):c.1276C>T (p.Gln426Ter) rs121434402
NM_016156.5(MTMR2):c.1303T>C (p.Leu435=) rs767737380
NM_016156.5(MTMR2):c.130G>A (p.Val44Ile) rs146004831
NM_016156.5(MTMR2):c.1336G>A (p.Glu446Lys) rs146572467
NM_016156.5(MTMR2):c.1339G>A (p.Val447Ile) rs769693714
NM_016156.5(MTMR2):c.1364G>A (p.Ser455Asn)
NM_016156.5(MTMR2):c.1386A>G (p.Leu462=) rs139369561
NM_016156.5(MTMR2):c.1402G>C (p.Asp468His) rs142460913
NM_016156.5(MTMR2):c.1444C>T (p.Gln482Ter) rs121434404
NM_016156.5(MTMR2):c.1446A>G (p.Gln482=) rs376166939
NM_016156.5(MTMR2):c.1450A>G (p.Ile484Val) rs886048771
NM_016156.5(MTMR2):c.1488C>T (p.Thr496=) rs112327353
NM_016156.5(MTMR2):c.14C>G (p.Ser5Trp) rs778430688
NM_016156.5(MTMR2):c.1504G>C (p.Glu502Gln) rs61735578
NM_016156.5(MTMR2):c.1511T>C (p.Phe504Ser)
NM_016156.5(MTMR2):c.1523T>C (p.Ile508Thr) rs769280444
NM_016156.5(MTMR2):c.1537_1538dupTA (p.Ser514Thrfs) rs1555057316
NM_016156.5(MTMR2):c.1551C>T (p.Phe517=) rs775961979
NM_016156.5(MTMR2):c.1552G>A (p.Gly518Arg) rs1014132718
NM_016156.5(MTMR2):c.1562T>A (p.Leu521His)
NM_016156.5(MTMR2):c.1630A>G (p.Ile544Val) rs781368440
NM_016156.5(MTMR2):c.1634A>G (p.Asn545Ser) rs558018
NM_016156.5(MTMR2):c.1674C>T (p.Ser558=) rs1555056924
NM_016156.5(MTMR2):c.16A>T (p.Ser6Cys) rs377006678
NM_016156.5(MTMR2):c.1741A>G (p.Ile581Val) rs149476960
NM_016156.5(MTMR2):c.1756C>A (p.Arg586=) rs61735577
NM_016156.5(MTMR2):c.1757G>A (p.Arg586Gln) rs61735576
NM_016156.5(MTMR2):c.1768C>T (p.Gln590Ter)
NM_016156.5(MTMR2):c.1770+4T>C
NM_016156.5(MTMR2):c.1770+7_1770+12delGCCTTA rs754608173
NM_016156.5(MTMR2):c.1770G>A (p.Gln590=) rs778532655
NM_016156.5(MTMR2):c.1805C>G (p.Ala602Gly) rs76784113
NM_016156.5(MTMR2):c.1843C>G (p.Gln615Glu) rs886048770
NM_016156.5(MTMR2):c.184_186delAGG (p.Arg62del) rs141498429
NM_016156.5(MTMR2):c.1855T>C (p.Ser619Pro) rs116750638
NM_016156.5(MTMR2):c.1861C>T (p.Arg621Ter) rs753364428
NM_016156.5(MTMR2):c.1862G>A (p.Arg621Gln) rs371925152
NM_016156.5(MTMR2):c.1882_1885dup (p.Ala629Glufs)
NM_016156.5(MTMR2):c.1900C>T (p.Gln634Ter) rs923973985
NM_016156.5(MTMR2):c.1916delT (p.Val639Alafs) rs779740723
NM_016156.5(MTMR2):c.212C>T (p.Ala71Val) rs886048772
NM_016156.5(MTMR2):c.232T>A (p.Leu78Met)
NM_016156.5(MTMR2):c.240A>C (p.Pro80=) rs201920176
NM_016156.5(MTMR2):c.262+4C>T rs760282236
NM_016156.5(MTMR2):c.262+5G>A
NM_016156.5(MTMR2):c.297C>T (p.Gly99=) rs772347980
NM_016156.5(MTMR2):c.350T>C (p.Met117Thr)
NM_016156.5(MTMR2):c.355C>G (p.Arg119Gly) rs142774695
NM_016156.5(MTMR2):c.357+4A>C rs863224750
NM_016156.5(MTMR2):c.35C>T (p.Ser12Phe)
NM_016156.5(MTMR2):c.408A>C (p.Glu136Asp) rs1555065024
NM_016156.5(MTMR2):c.431G>A (p.Arg144Gln) rs1555065007
NM_016156.5(MTMR2):c.444T>G (p.Ser148=) rs1555065002
NM_016156.5(MTMR2):c.464_465delGT (p.Cys155Terfs) rs1358449243
NM_016156.5(MTMR2):c.469-9C>A rs779741464
NM_016156.5(MTMR2):c.507G>A (p.Gly169=) rs753188177
NM_016156.5(MTMR2):c.547G>T (p.Ala183Ser) rs142155860
NM_016156.5(MTMR2):c.54G>A (p.Arg18=) rs372164252
NM_016156.5(MTMR2):c.570+11T>C rs182582445
NM_016156.5(MTMR2):c.604C>G (p.Pro202Ala) rs186380748
NM_016156.5(MTMR2):c.624A>G (p.Leu208=) rs979063255
NM_016156.5(MTMR2):c.655-7C>T rs775390447
NM_016156.5(MTMR2):c.655-8A>G rs768562214
NM_016156.5(MTMR2):c.756_758delTGA (p.Asp252del) rs878855016
NM_016156.5(MTMR2):c.75G>A (p.Leu25=) rs1376231939
NM_016156.5(MTMR2):c.80+13C>T rs139510268
NM_016156.5(MTMR2):c.804+1G>C
NM_016156.5(MTMR2):c.804+2T>G rs1555061026
NM_016156.5(MTMR2):c.810A>C (p.Leu270Phe) rs587779385
NM_016156.5(MTMR2):c.826G>T (p.Glu276Ter) rs121434403
NM_016156.5(MTMR2):c.832C>T (p.Gln278Ter) rs757563721
NM_016156.5(MTMR2):c.894A>T (p.Glu298Asp) rs200898934
NM_016156.5(MTMR2):c.8A>C (p.Lys3Thr) rs3824874
NM_016156.5(MTMR2):c.960T>C (p.Asp320=) rs776038747
NM_016156.5(MTMR2):c.993+1G>A rs1555060614
NM_018972.2(GDAP1):c.1019dupT (p.Arg341Glnfs) rs756461496
NM_018972.2(GDAP1):c.310+6delG rs780828430
NM_018972.2(GDAP1):c.311-1790_408del
NM_018972.2(GDAP1):c.347T>G (p.Met116Arg) rs281865060
NM_018972.2(GDAP1):c.458C>T (p.Pro153Leu) rs538412810
NM_018972.2(GDAP1):c.503_504delAG (p.Glu168Valfs) rs1221804567
NM_018972.2(GDAP1):c.579+1G>A rs864622501
NM_018972.2(GDAP1):c.579delA (p.Lys193Asnfs) rs1060500979
NM_018972.2(GDAP1):c.715C>T (p.Leu239Phe) rs104894080
NM_018972.2(GDAP1):c.786delG (p.Phe263Leufs) rs1060500978
NM_018972.2(GDAP1):c.845G>A (p.Arg282His)
NM_018972.2(GDAP1):c.[347T>C];[62delA]
NM_018972.3(GDAP1):c.1006G>T (p.Ala336Ser) rs140811185
NM_018972.3(GDAP1):c.102C>G (p.Ser34=) rs7828201
NM_018972.3(GDAP1):c.1037G>A (p.Ser346Asn)
NM_018972.3(GDAP1):c.1045T>C (p.Leu349=) rs368943246
NM_018972.3(GDAP1):c.106A>C (p.Ser36Arg) rs1448664085
NM_018972.3(GDAP1):c.109T>A (p.Ser37Thr) rs756121249
NM_018972.3(GDAP1):c.112C>T (p.Gln38Ter)
NM_018972.3(GDAP1):c.161A>G (p.His54Arg) rs1441803924
NM_018972.3(GDAP1):c.169A>C (p.Ser57Arg) rs863224774
NM_018972.3(GDAP1):c.216C>T (p.Asn72=) rs760859999
NM_018972.3(GDAP1):c.225A>G (p.Gly75=) rs761890773
NM_018972.3(GDAP1):c.248G>C (p.Gly83Ala) rs371138642
NM_018972.3(GDAP1):c.256A>G (p.Ile86Val)
NM_018972.3(GDAP1):c.260T>C (p.Ile87Thr) rs751297226
NM_018972.3(GDAP1):c.310+8del rs1279865642
NM_018972.3(GDAP1):c.338A>G (p.Lys113Arg) rs1290008555
NM_018972.3(GDAP1):c.33C>G (p.Ser11Arg) rs202010117
NM_018972.3(GDAP1):c.358C>T (p.Arg120Trp) rs104894078
NM_018972.3(GDAP1):c.368A>G (p.His123Arg) rs397515442
NM_018972.3(GDAP1):c.373C>T (p.Arg125Ter) rs745663149
NM_018972.3(GDAP1):c.385G>A (p.Asp129Asn) rs1279013936
NM_018972.3(GDAP1):c.399G>A (p.Met133Ile) rs139808557
NM_018972.3(GDAP1):c.419G>T (p.Cys140Phe)
NM_018972.3(GDAP1):c.430C>A (p.Pro144Thr) rs570990910
NM_018972.3(GDAP1):c.459G>A (p.Pro153=) rs149804782
NM_018972.3(GDAP1):c.474A>G (p.Thr158=) rs202215041
NM_018972.3(GDAP1):c.482G>A (p.Arg161His) rs104894076
NM_018972.3(GDAP1):c.487C>T (p.Gln163Ter) rs104894077
NM_018972.3(GDAP1):c.556A>G (p.Ile186Val) rs148508128
NM_018972.3(GDAP1):c.581C>G (p.Ser194Ter) rs104894075
NM_018972.3(GDAP1):c.5C>G (p.Ala2Gly) rs376868259
NM_018972.3(GDAP1):c.614T>C (p.Leu205Ser) rs878855054
NM_018972.3(GDAP1):c.620A>C (p.Lys207Thr) rs140384868
NM_018972.3(GDAP1):c.653A>G (p.Gln218Arg) rs556827873
NM_018972.3(GDAP1):c.692C>T (p.Pro231Leu) rs121908114
NM_018972.3(GDAP1):c.693A>T (p.Pro231=) rs181157785
NM_018972.3(GDAP1):c.694+1G>A
NM_018972.3(GDAP1):c.694+5G>A rs752550394
NM_018972.3(GDAP1):c.695-9T>A rs906225606
NM_018972.3(GDAP1):c.703C>T (p.Gln235Ter) rs1554548334
NM_018972.3(GDAP1):c.710C>G (p.Pro237Arg) rs763963750
NM_018972.3(GDAP1):c.72T>C (p.Val24=) rs142674939
NM_018972.3(GDAP1):c.744C>T (p.Asp248=) rs370099528
NM_018972.3(GDAP1):c.754G>A (p.Ala252Thr) rs778105019
NM_018972.3(GDAP1):c.770G>A (p.Arg257Gln) rs1425323007
NM_018972.3(GDAP1):c.776A>G (p.Lys259Arg) rs778557691
NM_018972.3(GDAP1):c.785G>A (p.Gly262Glu)
NM_018972.3(GDAP1):c.820C>G (p.Pro274Ala)
NM_018972.3(GDAP1):c.840C>T (p.Tyr280=) rs374624466
NM_018972.3(GDAP1):c.86A>C (p.Tyr29Ser)
NM_018972.3(GDAP1):c.907G>T (p.Ala303Ser) rs368055667
NM_018972.3(GDAP1):c.90T>C (p.His30=) rs555369956
NM_018972.3(GDAP1):c.92G>A (p.Trp31Ter) rs121908112
NM_018972.3(GDAP1):c.965C>T (p.Thr322Met) rs199529910
NM_018972.3(GDAP1):c.977T>A (p.Val326Asp)
NM_018972.4(GDAP1):c.507T>G (p.Ser169=) rs11554166
NM_018972.4(GDAP1):c.571C>T (p.Arg191Ter) rs1554547986
NM_018972.4(GDAP1):c.811G>A (p.Gly271Arg) rs775622226
NM_020956.2(PRX):c.80C>A (p.Thr27Asn) rs1291881750
NM_024577.3(SH3TC2):c.*10006A>T rs201998002
NM_024577.3(SH3TC2):c.*10010A>T rs886060145
NM_024577.3(SH3TC2):c.*10010_*10013dupATCC rs201323132
NM_024577.3(SH3TC2):c.*10018A>T rs866934630
NM_024577.3(SH3TC2):c.*10022A>T rs56245745
NM_024577.3(SH3TC2):c.*10052C>T rs113802539
NM_024577.3(SH3TC2):c.*10060C>A rs886060143
NM_024577.3(SH3TC2):c.*1006C>T rs886060185
NM_024577.3(SH3TC2):c.*10079A>G rs886060142
NM_024577.3(SH3TC2):c.*10083A>G rs886060141
NM_024577.3(SH3TC2):c.*10099A>T rs570266229
NM_024577.3(SH3TC2):c.*10101C>T rs552099019
NM_024577.3(SH3TC2):c.*10103A>T rs754724940
NM_024577.3(SH3TC2):c.*10103_*10110delACCAACCA rs57301725
NM_024577.3(SH3TC2):c.*10105C>T rs753563756
NM_024577.3(SH3TC2):c.*10107_*10110delACCA rs57301725
NM_024577.3(SH3TC2):c.*10107_*10110dupACCA rs57301725
NM_024577.3(SH3TC2):c.*10111_*10114delTCTA rs777886659
NM_024577.3(SH3TC2):c.*10120C>A rs13355933
NM_024577.3(SH3TC2):c.*10132A>G rs886060138
NM_024577.3(SH3TC2):c.*10177T>A rs149759395
NM_024577.3(SH3TC2):c.*10485G>A rs76931184
NM_024577.3(SH3TC2):c.*10505A>G rs886060137
NM_024577.3(SH3TC2):c.*10546C>T rs186003687
NM_024577.3(SH3TC2):c.*10573T>C rs886060136
NM_024577.3(SH3TC2):c.*10756G>T rs886060135
NM_024577.3(SH3TC2):c.*10767G>A rs139720866
NM_024577.3(SH3TC2):c.*10863C>T rs181346624
NM_024577.3(SH3TC2):c.*10864G>A rs189701174
NM_024577.3(SH3TC2):c.*10875T>C rs184560843
NM_024577.3(SH3TC2):c.*10968G>A rs13166730
NM_024577.3(SH3TC2):c.*10984G>T rs868782614
NM_024577.3(SH3TC2):c.*11010A>G rs114735628
NM_024577.3(SH3TC2):c.*11054G>C rs886060134
NM_024577.3(SH3TC2):c.*11055T>C rs886060133
NM_024577.3(SH3TC2):c.*11120G>A rs2069087
NM_024577.3(SH3TC2):c.*11160C>T rs886060132
NM_024577.3(SH3TC2):c.*11390A>G rs3213854
NM_024577.3(SH3TC2):c.*11506C>T rs886060131
NM_024577.3(SH3TC2):c.*11542G>A rs886060130
NM_024577.3(SH3TC2):c.*11593G>A rs886060129
NM_024577.3(SH3TC2):c.*11621G>A rs886060128
NM_024577.3(SH3TC2):c.*11852G>T rs13359285
NM_024577.3(SH3TC2):c.*12088_*12091delGAAA rs886060127
NM_024577.3(SH3TC2):c.*12108_*12110delAAA rs35182601
NM_024577.3(SH3TC2):c.*12109_*12110dupAA rs35182601
NM_024577.3(SH3TC2):c.*12110dupA rs35182601
NM_024577.3(SH3TC2):c.*12111_*12112insAA rs886060126
NM_024577.3(SH3TC2):c.*12114dupA rs886060125
NM_024577.3(SH3TC2):c.*12126C>T rs886060124
NM_024577.3(SH3TC2):c.*12146C>G rs886060123
NM_024577.3(SH3TC2):c.*122G>T rs114151926
NM_024577.3(SH3TC2):c.*12469T>A rs886060122
NM_024577.3(SH3TC2):c.*12509T>C rs550901114
NM_024577.3(SH3TC2):c.*1254T>C rs752672326
NM_024577.3(SH3TC2):c.*12637A>G rs536941130
NM_024577.3(SH3TC2):c.*12653C>A rs886060121
NM_024577.3(SH3TC2):c.*12752T>A rs886060120
NM_024577.3(SH3TC2):c.*12807G>A rs150317192
NM_024577.3(SH3TC2):c.*12969C>A rs76955068
NM_024577.3(SH3TC2):c.*1309C>T rs1007401
NM_024577.3(SH3TC2):c.*1310G>A rs886060184
NM_024577.3(SH3TC2):c.*13230C>T rs138600983
NM_024577.3(SH3TC2):c.*13293T>C rs886060119
NM_024577.3(SH3TC2):c.*13352G>A rs192178726
NM_024577.3(SH3TC2):c.*13465C>A rs186009343
NM_024577.3(SH3TC2):c.*13514A>G rs78516040
NM_024577.3(SH3TC2):c.*13598A>G rs141011337
NM_024577.3(SH3TC2):c.*13923T>C rs534282709
NM_024577.3(SH3TC2):c.*14411G>A rs143623684
NM_024577.3(SH3TC2):c.*14429T>G rs577465518
NM_024577.3(SH3TC2):c.*14562G>A rs17109198
NM_024577.3(SH3TC2):c.*14621G>T rs17795097
NM_024577.3(SH3TC2):c.*14628C>T rs886060118
NM_024577.3(SH3TC2):c.*14766T>A rs891919
NM_024577.3(SH3TC2):c.*14781C>A rs886060117
NM_024577.3(SH3TC2):c.*147A>T rs147796833
NM_024577.3(SH3TC2):c.*14827T>A rs569378409
NM_024577.3(SH3TC2):c.*14856C>A rs891920
NM_024577.3(SH3TC2):c.*14894G>A rs17109192
NM_024577.3(SH3TC2):c.*14985A>G rs886060116
NM_024577.3(SH3TC2):c.*15061C>T rs115722370
NM_024577.3(SH3TC2):c.*15062G>A rs886060115
NM_024577.3(SH3TC2):c.*15125C>G rs181229340
NM_024577.3(SH3TC2):c.*15235A>G rs145210501
NM_024577.3(SH3TC2):c.*15311delA rs886060114
NM_024577.3(SH3TC2):c.*15339G>A rs886060113
NM_024577.3(SH3TC2):c.*15383C>A rs186004627
NM_024577.3(SH3TC2):c.*15489G>A rs115194965
NM_024577.3(SH3TC2):c.*15680T>C rs886060112
NM_024577.3(SH3TC2):c.*15823T>A rs4562031
NM_024577.3(SH3TC2):c.*15823T>C rs4562031
NM_024577.3(SH3TC2):c.*15824G>A rs530880070
NM_024577.3(SH3TC2):c.*16020A>C rs4543254
NM_024577.3(SH3TC2):c.*16056C>T rs147906062
NM_024577.3(SH3TC2):c.*16169G>A rs191600511
NM_024577.3(SH3TC2):c.*16257T>C rs572081330
NM_024577.3(SH3TC2):c.*16261C>T rs150690882
NM_024577.3(SH3TC2):c.*16378C>A rs144423228
NM_024577.3(SH3TC2):c.*1639T>C rs1007400
NM_024577.3(SH3TC2):c.*16507C>T rs886060111
NM_024577.3(SH3TC2):c.*16509A>G rs886060110
NM_024577.3(SH3TC2):c.*16562G>T rs369963209
NM_024577.3(SH3TC2):c.*16631G>A rs4705303
NM_024577.3(SH3TC2):c.*16711C>G rs886060109
NM_024577.3(SH3TC2):c.*16784C>T rs144720540
NM_024577.3(SH3TC2):c.*16855A>G rs886060108
NM_024577.3(SH3TC2):c.*16896_*16901dupCACACA rs71957589
NM_024577.3(SH3TC2):c.*16898_*16901delCACA rs71957589
NM_024577.3(SH3TC2):c.*16900_*16901delCA rs71957589
NM_024577.3(SH3TC2):c.*16900_*16901dupCA rs71957589
NM_024577.3(SH3TC2):c.*16902G>A rs886060107
NM_024577.3(SH3TC2):c.*16905T>G rs886060105
NM_024577.3(SH3TC2):c.*16928A>G rs760134609
NM_024577.3(SH3TC2):c.*16947C>T rs142551288
NM_024577.3(SH3TC2):c.*16950T>C rs10040798
NM_024577.3(SH3TC2):c.*17036C>G rs75086059
NM_024577.3(SH3TC2):c.*17036C>T rs75086059
NM_024577.3(SH3TC2):c.*17192C>T rs886060104
NM_024577.3(SH3TC2):c.*17317G>A rs78254952
NM_024577.3(SH3TC2):c.*1750C>T rs146276637
NM_024577.3(SH3TC2):c.*17662T>C rs556308084
NM_024577.3(SH3TC2):c.*17703A>G rs4235739
NM_024577.3(SH3TC2):c.*17833T>G rs886060103
NM_024577.3(SH3TC2):c.*17903A>G rs76444127
NM_024577.3(SH3TC2):c.*18234G>A rs886060102
NM_024577.3(SH3TC2):c.*18299C>T rs147903089
NM_024577.3(SH3TC2):c.*18476T>C rs185251230
NM_024577.3(SH3TC2):c.*18483dupT rs536826583
NM_024577.3(SH3TC2):c.*18554G>T rs10040598
NM_024577.3(SH3TC2):c.*18606T>G rs182775401
NM_024577.3(SH3TC2):c.*18635C>T rs886060101
NM_024577.3(SH3TC2):c.*19002A>G rs546701780
NM_024577.3(SH3TC2):c.*19040A>G rs930205
NM_024577.3(SH3TC2):c.*1909G>T rs998304
NM_024577.3(SH3TC2):c.*19182A>C rs886060100
NM_024577.3(SH3TC2):c.*19250T>A rs886060099
NM_024577.3(SH3TC2):c.*19270G>A rs149188140
NM_024577.3(SH3TC2):c.*19342A>G rs886060098
NM_024577.3(SH3TC2):c.*1935T>C rs6883926
NM_024577.3(SH3TC2):c.*19406A>G rs72835351
NM_024577.3(SH3TC2):c.*19406A>T rs72835351
NM_024577.3(SH3TC2):c.*19411T>C rs780022559
NM_024577.3(SH3TC2):c.*1942delC rs886060183
NM_024577.3(SH3TC2):c.*1946_*1947delTC rs397883732
NM_024577.3(SH3TC2):c.*19519G>A rs10039839
NM_024577.3(SH3TC2):c.*19563_*19564dupTT rs5872105
NM_024577.3(SH3TC2):c.*19564dupT rs5872105
NM_024577.3(SH3TC2):c.*19573G>A rs4560536
NM_024577.3(SH3TC2):c.*1979C>T rs886060181
NM_024577.3(SH3TC2):c.*1982C>A rs535127091
NM_024577.3(SH3TC2):c.*19919T>C rs2217638
NM_024577.3(SH3TC2):c.*19989G>A rs560779315
NM_024577.3(SH3TC2):c.*20142A>G rs189978591
NM_024577.3(SH3TC2):c.*20166T>A rs17795091
NM_024577.3(SH3TC2):c.*20362T>C rs571268825
NM_024577.3(SH3TC2):c.*20412A>T rs774453230
NM_024577.3(SH3TC2):c.*20463T>C rs77021631
NM_024577.3(SH3TC2):c.*20469C>T rs886060097
NM_024577.3(SH3TC2):c.*20564A>T rs150905092
NM_024577.3(SH3TC2):c.*20773G>T rs113020040
NM_024577.3(SH3TC2):c.*2081T>G rs543206033
NM_024577.3(SH3TC2):c.*20919_*20920delAA rs886060096
NM_024577.3(SH3TC2):c.*210C>A rs886060192
NM_024577.3(SH3TC2):c.*21118G>T rs886060095
NM_024577.3(SH3TC2):c.*21395T>C rs886060094
NM_024577.3(SH3TC2):c.*2141C>T rs535223944
NM_024577.3(SH3TC2):c.*21472A>G rs59731646
NM_024577.3(SH3TC2):c.*21482_*21485delAAAC rs146796490
NM_024577.3(SH3TC2):c.*21532C>A rs763141563
NM_024577.3(SH3TC2):c.*21539T>C rs542529184
NM_024577.3(SH3TC2):c.*21658A>G rs145964634
NM_024577.3(SH3TC2):c.*21703G>A rs761390238
NM_024577.3(SH3TC2):c.*21728T>C rs142485824
NM_024577.3(SH3TC2):c.*21786G>A rs6890482
NM_024577.3(SH3TC2):c.*21955A>G rs575501943
NM_024577.3(SH3TC2):c.*22034C>T rs886060093
NM_024577.3(SH3TC2):c.*22035G>A rs544954149
NM_024577.3(SH3TC2):c.*22168C>G rs886060092
NM_024577.3(SH3TC2):c.*22199C>T rs778637809
NM_024577.3(SH3TC2):c.*22212G>A rs149300520
NM_024577.3(SH3TC2):c.*22291T>C rs886060091
NM_024577.3(SH3TC2):c.*22357T>C rs191754280
NM_024577.3(SH3TC2):c.*2248A>G rs187399485
NM_024577.3(SH3TC2):c.*22552_*22553dupAA rs55932017
NM_024577.3(SH3TC2):c.*22553delA rs55932017
NM_024577.3(SH3TC2):c.*22553dupA rs55932017
NM_024577.3(SH3TC2):c.*2341A>G rs531168193
NM_024577.3(SH3TC2):c.*2361A>T rs146327509
NM_024577.3(SH3TC2):c.*2394C>T rs368101139
NM_024577.3(SH3TC2):c.*2397G>A rs17722155
NM_024577.3(SH3TC2):c.*2428C>T rs149384180
NM_024577.3(SH3TC2):c.*2500C>A rs559833500
NM_024577.3(SH3TC2):c.*2624A>G rs762855152
NM_024577.3(SH3TC2):c.*281A>G rs886060191
NM_024577.3(SH3TC2):c.*2862G>A rs116548620
NM_024577.3(SH3TC2):c.*2900G>T rs3763019
NM_024577.3(SH3TC2):c.*2956C>T rs3763020
NM_024577.3(SH3TC2):c.*2982T>C rs886060180
NM_024577.3(SH3TC2):c.*2987C>T rs565331463
NM_024577.3(SH3TC2):c.*3058A>G rs563916447
NM_024577.3(SH3TC2):c.*3061A>G rs138823547
NM_024577.3(SH3TC2):c.*3077C>T rs1045942
NM_024577.3(SH3TC2):c.*3079G>A rs185297430
NM_024577.3(SH3TC2):c.*3136G>A rs1019927
NM_024577.3(SH3TC2):c.*3165G>A rs886060179
NM_024577.3(SH3TC2):c.*3196T>C rs3763022
NM_024577.3(SH3TC2):c.*3202T>C rs188625202
NM_024577.3(SH3TC2):c.*3411C>T rs886060178
NM_024577.3(SH3TC2):c.*341A>G rs868833114
NM_024577.3(SH3TC2):c.*3430T>A rs184043381
NM_024577.3(SH3TC2):c.*3694T>A rs115774169
NM_024577.3(SH3TC2):c.*3860G>A rs1432797
NM_024577.3(SH3TC2):c.*3903A>G rs750071171
NM_024577.3(SH3TC2):c.*391G>C rs117139060
NM_024577.3(SH3TC2):c.*4131T>C rs141113906
NM_024577.3(SH3TC2):c.*4182A>G rs886060177
NM_024577.3(SH3TC2):c.*4183T>C rs886060176
NM_024577.3(SH3TC2):c.*4209A>G rs886060175
NM_024577.3(SH3TC2):c.*4232G>A rs886060174
NM_024577.3(SH3TC2):c.*4240C>A rs765837919
NM_024577.3(SH3TC2):c.*4279C>G rs74578025
NM_024577.3(SH3TC2):c.*4298C>T rs145849837
NM_024577.3(SH3TC2):c.*4409T>A rs886060173
NM_024577.3(SH3TC2):c.*4446G>C rs186152591
NM_024577.3(SH3TC2):c.*4511T>C rs578024597
NM_024577.3(SH3TC2):c.*4555A>G rs117287440
NM_024577.3(SH3TC2):c.*4604G>A rs886060172
NM_024577.3(SH3TC2):c.*4691C>T rs574710725
NM_024577.3(SH3TC2):c.*4713G>A rs191742061
NM_024577.3(SH3TC2):c.*4719C>G rs6885467
NM_024577.3(SH3TC2):c.*47C>T rs79738100
NM_024577.3(SH3TC2):c.*4920T>G rs550230926
NM_024577.3(SH3TC2):c.*4935A>T rs149921013
NM_024577.3(SH3TC2):c.*5020C>T rs371723580
NM_024577.3(SH3TC2):c.*5279delG rs573168274
NM_024577.3(SH3TC2):c.*5304G>A rs886060171
NM_024577.3(SH3TC2):c.*5305C>A rs886060170
NM_024577.3(SH3TC2):c.*5368C>T rs189202481
NM_024577.3(SH3TC2):c.*5419G>A rs886060169
NM_024577.3(SH3TC2):c.*5490G>A rs1432795
NM_024577.3(SH3TC2):c.*5576C>T rs886060168
NM_024577.3(SH3TC2):c.*5634C>A rs565468168
NM_024577.3(SH3TC2):c.*5666A>G rs749263197
NM_024577.3(SH3TC2):c.*5689A>C rs537285537
NM_024577.3(SH3TC2):c.*5740C>T rs886060167
NM_024577.3(SH3TC2):c.*5747C>T rs886060166
NM_024577.3(SH3TC2):c.*578C>T rs567100275
NM_024577.3(SH3TC2):c.*5799C>T rs17109208
NM_024577.3(SH3TC2):c.*5933G>A rs886060165
NM_024577.3(SH3TC2):c.*5999G>A rs79866394
NM_024577.3(SH3TC2):c.*6047T>A rs139490756
NM_024577.3(SH3TC2):c.*6051G>A rs146293131
NM_024577.3(SH3TC2):c.*6104C>T rs556527140
NM_024577.3(SH3TC2):c.*6162C>T rs17795115
NM_024577.3(SH3TC2):c.*623T>C rs886060190
NM_024577.3(SH3TC2):c.*6242A>G rs142279453
NM_024577.3(SH3TC2):c.*626G>A rs781581124
NM_024577.3(SH3TC2):c.*6301C>T rs188143654
NM_024577.3(SH3TC2):c.*6302T>A rs545169695
NM_024577.3(SH3TC2):c.*6350G>A rs184940808
NM_024577.3(SH3TC2):c.*6392C>A rs114817736
NM_024577.3(SH3TC2):c.*6436G>T rs11168079
NM_024577.3(SH3TC2):c.*6470T>C rs185164450
NM_024577.3(SH3TC2):c.*6510G>A rs116056843
NM_024577.3(SH3TC2):c.*6557T>C rs199797914
NM_024577.3(SH3TC2):c.*6563_*6564delCT rs368030230
NM_024577.3(SH3TC2):c.*6623G>A rs78100143
NM_024577.3(SH3TC2):c.*6682G>C rs557452648
NM_024577.3(SH3TC2):c.*6692A>G rs11168078
NM_024577.3(SH3TC2):c.*6820T>C rs60176324
NM_024577.3(SH3TC2):c.*6836T>C rs757138006
NM_024577.3(SH3TC2):c.*6873_*6875delACA rs567997802
NM_024577.3(SH3TC2):c.*6993T>C rs563203537
NM_024577.3(SH3TC2):c.*7006T>C rs187720692
NM_024577.3(SH3TC2):c.*7021_*7025delATATT rs886060164
NM_024577.3(SH3TC2):c.*711A>C rs567593663
NM_024577.3(SH3TC2):c.*7189C>G rs886060163
NM_024577.3(SH3TC2):c.*7197G>C rs886060162
NM_024577.3(SH3TC2):c.*719G>A rs10050933
NM_024577.3(SH3TC2):c.*7256A>C rs886060161
NM_024577.3(SH3TC2):c.*7269A>G rs763490898
NM_024577.3(SH3TC2):c.*7285G>C rs886060160
NM_024577.3(SH3TC2):c.*7291G>A rs748202204
NM_024577.3(SH3TC2):c.*7292C>T rs1347130
NM_024577.3(SH3TC2):c.*7391A>C rs886060159
NM_024577.3(SH3TC2):c.*7394A>G rs886060158
NM_024577.3(SH3TC2):c.*7452G>A rs761137746
NM_024577.3(SH3TC2):c.*7570G>A rs886060157
NM_024577.3(SH3TC2):c.*7939C>A rs144288040
NM_024577.3(SH3TC2):c.*8053G>A rs115027318
NM_024577.3(SH3TC2):c.*8077A>G rs886060156
NM_024577.3(SH3TC2):c.*8111A>C rs17109205
NM_024577.3(SH3TC2):c.*8216T>C rs886060155
NM_024577.3(SH3TC2):c.*8217A>G rs768467653
NM_024577.3(SH3TC2):c.*8248G>C rs56309414
NM_024577.3(SH3TC2):c.*8277G>A rs147532508
NM_024577.3(SH3TC2):c.*8283A>T rs780934660
NM_024577.3(SH3TC2):c.*8313G>A rs770951592
NM_024577.3(SH3TC2):c.*8364C>T rs886060154
NM_024577.3(SH3TC2):c.*837G>A rs565462353
NM_024577.3(SH3TC2):c.*839delC rs886060189
NM_024577.3(SH3TC2):c.*8423T>C rs10036103
NM_024577.3(SH3TC2):c.*8438_*8439delCT rs146811206
NM_024577.3(SH3TC2):c.*8438_*8439dupCT rs146811206
NM_024577.3(SH3TC2):c.*8521C>A rs886060152
NM_024577.3(SH3TC2):c.*8567G>A rs369239776
NM_024577.3(SH3TC2):c.*858_*861delTTTT rs5872107
NM_024577.3(SH3TC2):c.*8622delT rs562125931
NM_024577.3(SH3TC2):c.*862delG rs886060188
NM_024577.3(SH3TC2):c.*862dupG rs886060187
NM_024577.3(SH3TC2):c.*86C>T rs886060194
NM_024577.3(SH3TC2):c.*8748G>A rs190904760
NM_024577.3(SH3TC2):c.*8756G>T rs7733177
NM_024577.3(SH3TC2):c.*882G>A rs775429372
NM_024577.3(SH3TC2):c.*8878T>A rs886060151
NM_024577.3(SH3TC2):c.*9073G>C rs886060150
NM_024577.3(SH3TC2):c.*9121delT rs886060149
NM_024577.3(SH3TC2):c.*9233T>A rs886060148
NM_024577.3(SH3TC2):c.*929G>C rs1432798
NM_024577.3(SH3TC2):c.*932T>A rs886060186
NM_024577.3(SH3TC2):c.*9340G>C rs886060147
NM_024577.3(SH3TC2):c.*9357T>G rs147996031
NM_024577.3(SH3TC2):c.*9361C>T rs573872364
NM_024577.3(SH3TC2):c.*9503C>T rs533786708
NM_024577.3(SH3TC2):c.*9830C>T rs557247993
NM_024577.3(SH3TC2):c.*9953C>T rs535186520
NM_024577.3(SH3TC2):c.*9969T>C rs761191045
NM_024577.3(SH3TC2):c.*9969_*9972delTATT rs113518050
NM_024577.3(SH3TC2):c.*9972T>C rs778531473
NM_024577.3(SH3TC2):c.*9980_*9981insTATT rs1554119372
NM_024577.3(SH3TC2):c.*9998_*10013dup rs201323132
NM_024577.3(SH3TC2):c.*99G>A rs886060193
NM_024577.3(SH3TC2):c.-92C>T rs886060200
NM_024577.3(SH3TC2):c.1002-7G>A rs752528409
NM_024577.3(SH3TC2):c.101C>A (p.Ala34Asp)
NM_024577.3(SH3TC2):c.1040G>C (p.Cys347Ser)
NM_024577.3(SH3TC2):c.1105C>T (p.Arg369Cys) rs569974719
NM_024577.3(SH3TC2):c.1177+10G>A rs139257109
NM_024577.3(SH3TC2):c.1177+5G>A
NM_024577.3(SH3TC2):c.1177+9C>T rs375581325
NM_024577.3(SH3TC2):c.1178-1G>A rs80338922
NM_024577.3(SH3TC2):c.1178-8C>T rs202042438
NM_024577.3(SH3TC2):c.1178C>T (p.Ala393Val) rs148321018
NM_024577.3(SH3TC2):c.1194T>C (p.Gly398=) rs1432793
NM_024577.3(SH3TC2):c.1194_1195delTTinsCC (p.Phe399Leu) rs1554121791
NM_024577.3(SH3TC2):c.11G>T (p.Cys4Phe)
NM_024577.3(SH3TC2):c.1233_1235dupTCA (p.His411_Gln412insHis) rs886060198
NM_024577.3(SH3TC2):c.1240G>A (p.Val414Met)
NM_024577.3(SH3TC2):c.1244G>T (p.Gly415Val)
NM_024577.3(SH3TC2):c.1245G>A (p.Gly415=) rs748870159
NM_024577.3(SH3TC2):c.1284G>A (p.Glu428=) rs367691494
NM_024577.3(SH3TC2):c.1298C>T (p.Ser433Leu) rs200967041
NM_024577.3(SH3TC2):c.1299G>A (p.Ser433=) rs140904010
NM_024577.3(SH3TC2):c.1318C>T (p.Arg440Cys)
NM_024577.3(SH3TC2):c.1325C>T (p.Pro442Leu) rs370613184
NM_024577.3(SH3TC2):c.1329G>A (p.Glu443=) rs150135768
NM_024577.3(SH3TC2):c.1350G>A (p.Pro450=) rs17722227
NM_024577.3(SH3TC2):c.1355T>C (p.Leu452Pro) rs1235312791
NM_024577.3(SH3TC2):c.137A>C (p.Gln46Pro) rs146162276
NM_024577.3(SH3TC2):c.1401C>A (p.Phe467Leu)
NM_024577.3(SH3TC2):c.1402G>T (p.Ala468Ser) rs6875902
NM_024577.3(SH3TC2):c.1402_1403delGCinsTT (p.Ala468Phe) rs863224780
NM_024577.3(SH3TC2):c.1431G>A (p.Glu477=) rs887057321
NM_024577.3(SH3TC2):c.1443C>T (p.Asp481=) rs146666910
NM_024577.3(SH3TC2):c.1469_1471delCCT (p.Ser490del) rs755728218
NM_024577.3(SH3TC2):c.1473C>T (p.Phe491=) rs144016931
NM_024577.3(SH3TC2):c.1482C>T (p.Leu494=) rs200665714
NM_024577.3(SH3TC2):c.1483A>G (p.Thr495Ala) rs10077543
NM_024577.3(SH3TC2):c.1520_1523delTTGT (p.Phe507Trpfs)
NM_024577.3(SH3TC2):c.1522G>A (p.Val508Met) rs148155691
NM_024577.3(SH3TC2):c.1584C>T (p.Ala528=) rs762967613
NM_024577.3(SH3TC2):c.1585_1587delCGTinsTGG (p.Arg529Trp) rs863224781
NM_024577.3(SH3TC2):c.1586G>A (p.Arg529His) rs80338923
NM_024577.3(SH3TC2):c.1586_1587delGTinsAG (p.Arg529Gln) rs863224454
NM_024577.3(SH3TC2):c.1587T>G (p.Arg529=) rs1432794
NM_024577.3(SH3TC2):c.1597C>T (p.Leu533Phe) rs1554121725
NM_024577.3(SH3TC2):c.1607G>A (p.Arg536Gln) rs369977771
NM_024577.3(SH3TC2):c.1654G>A (p.Glu552Lys)
NM_024577.3(SH3TC2):c.1654G>C (p.Glu552Gln) rs551953142
NM_024577.3(SH3TC2):c.1662delC (p.Ile555Serfs) rs863224520
NM_024577.3(SH3TC2):c.1721A>G (p.Asn574Ser) rs201256776
NM_024577.3(SH3TC2):c.1738C>A (p.Leu580Met)
NM_024577.3(SH3TC2):c.1747_1748delAG (p.Arg583Alafs) rs80338924
NM_024577.3(SH3TC2):c.1767C>T (p.Ser589=) rs139898175
NM_024577.3(SH3TC2):c.1768G>A (p.Ala590Thr)
NM_024577.3(SH3TC2):c.1788T>A (p.Gly596=) rs141893132
NM_024577.3(SH3TC2):c.1794G>C (p.Leu598=) rs1554121710
NM_024577.3(SH3TC2):c.1814G>A (p.Arg605His) rs186864272
NM_024577.3(SH3TC2):c.1830G>A (p.Lys610=) rs370025626
NM_024577.3(SH3TC2):c.1831C>A (p.His611Asn) rs886060197
NM_024577.3(SH3TC2):c.1839C>T (p.Leu613=) rs182893450
NM_024577.3(SH3TC2):c.1842C>T (p.Asp614=) rs138411915
NM_024577.3(SH3TC2):c.1845G>A (p.Val615=) rs914238218
NM_024577.3(SH3TC2):c.1854C>T (p.Tyr618=) rs1483284949
NM_024577.3(SH3TC2):c.1861C>T (p.Arg621Cys) rs201403149
NM_024577.3(SH3TC2):c.1862G>A (p.Arg621His) rs143032801
NM_024577.3(SH3TC2):c.1868_1869delGG (p.Gly623Aspfs) rs1554121691
NM_024577.3(SH3TC2):c.1889C>T (p.Pro630Leu) rs749260578
NM_024577.3(SH3TC2):c.188G>A (p.Arg63Lys) rs747938069
NM_024577.3(SH3TC2):c.1922G>A (p.Arg641His)
NM_024577.3(SH3TC2):c.1942C>T (p.Arg648Trp) rs537049075
NM_024577.3(SH3TC2):c.1947C>T (p.His649=) rs576049662
NM_024577.3(SH3TC2):c.1969G>A (p.Glu657Lys) rs80338925
NM_024577.3(SH3TC2):c.1972C>T (p.Arg658Cys) rs80338926
NM_024577.3(SH3TC2):c.1973G>A (p.Arg658His) rs138040787
NM_024577.3(SH3TC2):c.1978C>T (p.Gln660Ter) rs1554121665
NM_024577.3(SH3TC2):c.1982T>C (p.Leu661Pro) rs80338927
NM_024577.3(SH3TC2):c.1A>G (p.Met1Val) rs864309709
NM_024577.3(SH3TC2):c.200A>G (p.Asn67Ser)
NM_024577.3(SH3TC2):c.2017G>A (p.Ala673Thr) rs201985394
NM_024577.3(SH3TC2):c.2023G>A (p.Val675Ile) rs764633604
NM_024577.3(SH3TC2):c.2056C>T (p.Pro686Ser)
NM_024577.3(SH3TC2):c.2072_2090delCCTCTGTCCAGCAACATGG (p.Ala691Valfs) rs878855092
NM_024577.3(SH3TC2):c.2087A>G (p.His696Arg) rs17109261
NM_024577.3(SH3TC2):c.2094C>T (p.Ile698=) rs886060196
NM_024577.3(SH3TC2):c.211C>T (p.Gln71Ter) rs864622663
NM_024577.3(SH3TC2):c.2146C>T (p.Gln716Ter)
NM_024577.3(SH3TC2):c.217_227delGCTGCTCGGAGinsCCAGTAA (p.Ala73Profs) rs80338919
NM_024577.3(SH3TC2):c.2191delG (p.Glu731Lysfs) rs80338928
NM_024577.3(SH3TC2):c.2199T>A (p.Ser733=) rs1220210982
NM_024577.3(SH3TC2):c.2215A>G (p.Met739Val)
NM_024577.3(SH3TC2):c.2235T>G (p.Ala745=) rs78120278
NM_024577.3(SH3TC2):c.2254G>A (p.Asp752Asn) rs749008572
NM_024577.3(SH3TC2):c.2263A>C (p.Thr755Pro)
NM_024577.3(SH3TC2):c.2273C>A (p.Ala758Asp) rs200006756
NM_024577.3(SH3TC2):c.2285T>C (p.Ile762Thr) rs751351645
NM_024577.3(SH3TC2):c.2304C>T (p.Leu768=) rs140829706
NM_024577.3(SH3TC2):c.2306A>G (p.Glu769Gly) rs151317042
NM_024577.3(SH3TC2):c.2322C>T (p.Asp774=) rs17795193
NM_024577.3(SH3TC2):c.2348C>T (p.Ala783Val) rs377372640
NM_024577.3(SH3TC2):c.238G>A (p.Ala80Thr) rs112507765
NM_024577.3(SH3TC2):c.2398C>T (p.Leu800Phe) rs764616291
NM_024577.3(SH3TC2):c.2407G>A (p.Ala803Thr)
NM_024577.3(SH3TC2):c.2418T>G (p.Tyr806Ter)
NM_024577.3(SH3TC2):c.2464C>T (p.Leu822=) rs752906301
NM_024577.3(SH3TC2):c.2470T>C (p.Cys824Arg) rs1554121601
NM_024577.3(SH3TC2):c.2491_2492delAG (p.Leu832Hisfs) rs80338929
NM_024577.3(SH3TC2):c.2492G>A (p.Ser831Asn) rs375034766
NM_024577.3(SH3TC2):c.2528G>A (p.Gly843Glu) rs1463859150
NM_024577.3(SH3TC2):c.2528G>T (p.Gly843Val) rs1463859150
NM_024577.3(SH3TC2):c.2549G>C (p.Gly850Ala)
NM_024577.3(SH3TC2):c.2552G>A (p.Arg851Gln) rs751621364
NM_024577.3(SH3TC2):c.255C>T (p.Asp85=) rs886060199
NM_024577.3(SH3TC2):c.2578C>T (p.Leu860Phe) rs139958177
NM_024577.3(SH3TC2):c.257A>G (p.Gln86Arg)
NM_024577.3(SH3TC2):c.2582G>A (p.Arg861Gln) rs142971473
NM_024577.3(SH3TC2):c.259G>C (p.Glu87Gln) rs947749200
NM_024577.3(SH3TC2):c.2640delC (p.Asn881Ilefs)
NM_024577.3(SH3TC2):c.2642A>G (p.Asn881Ser) rs80338930
NM_024577.3(SH3TC2):c.2642A>T (p.Asn881Ile) rs80338930
NM_024577.3(SH3TC2):c.2657G>A (p.Ser886Asn) rs780085307
NM_024577.3(SH3TC2):c.2671G>A (p.Ala891Thr) rs779223727
NM_024577.3(SH3TC2):c.2691C>G (p.Asn897Lys) rs73795753
NM_024577.3(SH3TC2):c.2710C>T (p.Arg904Ter) rs80338931
NM_024577.3(SH3TC2):c.279+1G>A rs1198337036
NM_024577.3(SH3TC2):c.279+4A>G
NM_024577.3(SH3TC2):c.279G>A (p.Lys93=) rs776221160
NM_024577.3(SH3TC2):c.280-2A>G
NM_024577.3(SH3TC2):c.280-5C>T rs201937366
NM_024577.3(SH3TC2):c.2812C>T (p.His938Tyr) rs144688852
NM_024577.3(SH3TC2):c.2829T>G (p.Tyr943Ter) rs80338932
NM_024577.3(SH3TC2):c.285C>T (p.Leu95=) rs574669908
NM_024577.3(SH3TC2):c.2860C>T (p.Arg954Ter) rs80338933
NM_024577.3(SH3TC2):c.2868A>G (p.Leu956=) rs115507662
NM_024577.3(SH3TC2):c.2872+9G>A rs76488338
NM_024577.3(SH3TC2):c.2897T>C (p.Leu966Pro) rs1060501469
NM_024577.3(SH3TC2):c.28delG (p.Glu10Serfs) rs80338918
NM_024577.3(SH3TC2):c.2913C>T (p.Ser971=) rs13436308
NM_024577.3(SH3TC2):c.2935G>T (p.Ala979Ser)
NM_024577.3(SH3TC2):c.2954A>G (p.Glu985Gly) rs575937427
NM_024577.3(SH3TC2):c.2989C>T (p.Arg997Trp)
NM_024577.3(SH3TC2):c.2990G>A (p.Arg997Gln) rs140307699
NM_024577.3(SH3TC2):c.3034C>T (p.Arg1012Trp) rs541197556
NM_024577.3(SH3TC2):c.3039C>A (p.Asn1013Lys) rs753381949
NM_024577.3(SH3TC2):c.3049G>A (p.Ala1017Thr) rs186029710
NM_024577.3(SH3TC2):c.3077G>A (p.Cys1026Tyr) rs367656036
NM_024577.3(SH3TC2):c.3094C>T (p.Arg1032Cys) rs375603885
NM_024577.3(SH3TC2):c.3099C>G (p.Ile1033Met) rs1554120576
NM_024577.3(SH3TC2):c.3127G>T (p.Ala1043Ser) rs200819602
NM_024577.3(SH3TC2):c.3149C>T (p.Ala1050Val) rs570067509
NM_024577.3(SH3TC2):c.3154C>T (p.Arg1052Ter) rs370115218
NM_024577.3(SH3TC2):c.3157C>T (p.Leu1053Phe)
NM_024577.3(SH3TC2):c.3160C>T (p.His1054Tyr) rs769133498
NM_024577.3(SH3TC2):c.3166C>T (p.Leu1056Phe) rs201805333
NM_024577.3(SH3TC2):c.3168C>T (p.Leu1056=) rs200795092
NM_024577.3(SH3TC2):c.31C>T (p.Arg11Trp) rs149762843
NM_024577.3(SH3TC2):c.3283T>C (p.Phe1095Leu)
NM_024577.3(SH3TC2):c.3293C>T (p.Thr1098Ile) rs199514987
NM_024577.3(SH3TC2):c.3294C>T (p.Thr1098=) rs193067884
NM_024577.3(SH3TC2):c.32G>A (p.Arg11Gln)
NM_024577.3(SH3TC2):c.3303G>A (p.Arg1101=) rs755006924
NM_024577.3(SH3TC2):c.3303delG (p.Arg1101Serfs) rs864622664
NM_024577.3(SH3TC2):c.3315G>A (p.Val1105=) rs375970910
NM_024577.3(SH3TC2):c.3325C>T (p.Arg1109Ter) rs80338934
NM_024577.3(SH3TC2):c.3326G>C (p.Arg1109Pro) rs80338935
NM_024577.3(SH3TC2):c.3328-1G>T rs1554120331
NM_024577.3(SH3TC2):c.3341delC (p.Pro1114Leufs) rs80338936
NM_024577.3(SH3TC2):c.3362C>T (p.Ala1121Val) rs115577291
NM_024577.3(SH3TC2):c.3364G>A (p.Val1122Met) rs1554120326
NM_024577.3(SH3TC2):c.3380G>A (p.Arg1127Gln) rs139192433
NM_024577.3(SH3TC2):c.3413G>A (p.Ser1138Asn) rs150805608
NM_024577.3(SH3TC2):c.3425_3435delATGAGAAGGCT (p.Tyr1142Phefs) rs1222150652
NM_024577.3(SH3TC2):c.3433G>T (p.Ala1145Ser) rs141715248
NM_024577.3(SH3TC2):c.3472G>A (p.Val1158Ile) rs55853803
NM_024577.3(SH3TC2):c.3479-8A>G rs147800229
NM_024577.3(SH3TC2):c.3511C>T (p.Arg1171Cys) rs759785462
NM_024577.3(SH3TC2):c.3512G>C (p.Arg1171Pro) rs200728983
NM_024577.3(SH3TC2):c.3550A>G (p.Met1184Val) rs142451273
NM_024577.3(SH3TC2):c.3594A>C (p.Pro1198=) rs6871030
NM_024577.3(SH3TC2):c.3594A>G (p.Pro1198=) rs6871030
NM_024577.3(SH3TC2):c.3596G>A (p.Trp1199Ter)
NM_024577.3(SH3TC2):c.3600G>A (p.Leu1200=) rs886060195
NM_024577.3(SH3TC2):c.3601C>T (p.Gln1201Ter) rs80338937
NM_024577.3(SH3TC2):c.3610A>G (p.Lys1204Glu) rs571409696
NM_024577.3(SH3TC2):c.3644G>A (p.Arg1215His) rs145390629
NM_024577.3(SH3TC2):c.3675+2dup rs1554120215
NM_024577.3(SH3TC2):c.3676-9C>T rs748694034
NM_024577.3(SH3TC2):c.3686A>T (p.Asp1229Val) rs146920285
NM_024577.3(SH3TC2):c.3723G>A (p.Ala1241=) rs777895612
NM_024577.3(SH3TC2):c.3757A>G (p.Ile1253Val) rs147931490
NM_024577.3(SH3TC2):c.3771G>A (p.Leu1257=) rs1472880531
NM_024577.3(SH3TC2):c.3795G>C (p.Leu1265=) rs144873879
NM_024577.3(SH3TC2):c.3813C>T (p.Ser1271=) rs140985600
NM_024577.3(SH3TC2):c.3833C>T (p.Ala1278Val) rs374516818
NM_024577.3(SH3TC2):c.3834G>A (p.Ala1278=) rs117804174
NM_024577.3(SH3TC2):c.3835C>T (p.Arg1279Trp)
NM_024577.3(SH3TC2):c.3847G>C (p.Gly1283Arg) rs370844006
NM_024577.3(SH3TC2):c.385+2T>C rs773554464
NM_024577.3(SH3TC2):c.385+3A>G
NM_024577.3(SH3TC2):c.385+4_385+8delTGGTA rs148930563
NM_024577.3(SH3TC2):c.3852_3854delTGG (p.Gly1285del) rs1554120043
NM_024577.3(SH3TC2):c.390C>T (p.Tyr130=) rs776623792
NM_024577.3(SH3TC2):c.46G>A (p.Gly16Ser) rs753975938
NM_024577.3(SH3TC2):c.477T>A (p.Ser159=) rs77574155
NM_024577.3(SH3TC2):c.4G>A (p.Gly2Ser) rs1554124107
NM_024577.3(SH3TC2):c.505T>C (p.Tyr169His) rs80359890
NM_024577.3(SH3TC2):c.512G>A (p.Gly171Glu) rs17722293
NM_024577.3(SH3TC2):c.517C>A (p.Leu173Met) rs147633804
NM_024577.3(SH3TC2):c.529+10G>A rs768567281
NM_024577.3(SH3TC2):c.529+1G>A
NM_024577.3(SH3TC2):c.529+7G>A rs747615694
NM_024577.3(SH3TC2):c.529+8T>A rs780594631
NM_024577.3(SH3TC2):c.530-2A>G rs80338920
NM_024577.3(SH3TC2):c.539_541delTCT (p.Phe180del) rs763476083
NM_024577.3(SH3TC2):c.549C>T (p.Ala183=) rs147013935
NM_024577.3(SH3TC2):c.558C>T (p.Ser186=) rs141289653
NM_024577.3(SH3TC2):c.560T>C (p.Val187Ala) rs1554122762
NM_024577.3(SH3TC2):c.574G>A (p.Glu192Lys)
NM_024577.3(SH3TC2):c.58G>T (p.Glu20Ter)
NM_024577.3(SH3TC2):c.645C>T (p.Ser215=) rs80227512
NM_024577.3(SH3TC2):c.661T>C (p.Ser221Pro)
NM_024577.3(SH3TC2):c.680G>A (p.Arg227Gln) rs1257812868
NM_024577.3(SH3TC2):c.689T>C (p.Val230Ala) rs148634904
NM_024577.3(SH3TC2):c.732-6T>C rs1554122676
NM_024577.3(SH3TC2):c.73G>T (p.Asp25Tyr) rs10066882
NM_024577.3(SH3TC2):c.751C>T (p.Pro251Ser) rs144963732
NM_024577.3(SH3TC2):c.794C>T (p.Ser265Phe) rs149873249
NM_024577.3(SH3TC2):c.79A>G (p.Thr27Ala) rs141649676
NM_024577.3(SH3TC2):c.805+9G>A rs143808719
NM_024577.3(SH3TC2):c.806-1G>A rs1554122560
NM_024577.3(SH3TC2):c.820_821insT (p.Lys274Ilefs) rs879253859
NM_024577.3(SH3TC2):c.82G>C (p.Val28Leu) rs1399431033
NM_024577.3(SH3TC2):c.830C>T (p.Thr277Met) rs757969875
NM_024577.3(SH3TC2):c.831G>A (p.Thr277=) rs750308484
NM_024577.3(SH3TC2):c.86C>T (p.Ser29Leu) rs559570623
NM_024577.3(SH3TC2):c.894C>T (p.Ile298=) rs779808918
NM_024577.3(SH3TC2):c.89G>A (p.Ser30Asn) rs765890403
NM_024577.3(SH3TC2):c.908C>A (p.Pro303His) rs778572329
NM_024577.3(SH3TC2):c.920G>A (p.Trp307Ter) rs80338921
NM_024577.3(SH3TC2):c.929G>A (p.Gly310Glu)
NM_024577.3(SH3TC2):c.935C>T (p.Ser312Leu) rs151205080
NM_024577.3(SH3TC2):c.956G>T (p.Gly319Val) rs753423455
NM_030962.3(SBF2):c.*112G>A rs144513995
NM_030962.3(SBF2):c.*1144A>G rs3751001
NM_030962.3(SBF2):c.*1255G>A rs886048774
NM_030962.3(SBF2):c.*1364C>T rs10118
NM_030962.3(SBF2):c.*1399T>C rs60154961
NM_030962.3(SBF2):c.*1413A>G rs59613534
NM_030962.3(SBF2):c.*1439C>A rs531522907
NM_030962.3(SBF2):c.*1441C>T rs562275980
NM_030962.3(SBF2):c.*1515G>A rs1045634
NM_030962.3(SBF2):c.*1619A>C rs360126
NM_030962.3(SBF2):c.*1686G>A rs376521838
NM_030962.3(SBF2):c.*177A>C rs192542785
NM_030962.3(SBF2):c.*19G>A rs770446132
NM_030962.3(SBF2):c.*291C>T rs114604750
NM_030962.3(SBF2):c.*375G>A rs533676532
NM_030962.3(SBF2):c.*375G>C rs533676532
NM_030962.3(SBF2):c.*40A>C rs3751000
NM_030962.3(SBF2):c.*480G>A rs148002177
NM_030962.3(SBF2):c.*514C>T rs3829252
NM_030962.3(SBF2):c.*51T>C rs41275194
NM_030962.3(SBF2):c.*631T>C rs573284772
NM_030962.3(SBF2):c.*730G>A rs886048777
NM_030962.3(SBF2):c.*875G>A rs886048776
NM_030962.3(SBF2):c.*882T>C rs886048775
NM_030962.3(SBF2):c.-101A>C rs886047577
NM_030962.3(SBF2):c.-106C>T rs886047578
NM_030962.3(SBF2):c.-118G>T rs563422015
NM_030962.3(SBF2):c.-128C>T rs886047579
NM_030962.3(SBF2):c.-37G>T rs756232914
NM_030962.3(SBF2):c.1024C>T (p.Arg342Ter)
NM_030962.3(SBF2):c.1045A>G (p.Lys349Glu) rs746685729
NM_030962.3(SBF2):c.1061A>C (p.Glu354Ala) rs761829741
NM_030962.3(SBF2):c.1067G>A (p.Arg356Gln) rs188588431
NM_030962.3(SBF2):c.1071C>T (p.Ala357=) rs775272908
NM_030962.3(SBF2):c.1130T>G (p.Ile377Arg) rs371432409
NM_030962.3(SBF2):c.1164C>T (p.His388=) rs959559753
NM_030962.3(SBF2):c.1173A>G (p.Ala391=) rs79470805
NM_030962.3(SBF2):c.1222C>G (p.Leu408Val)
NM_030962.3(SBF2):c.1226G>T (p.Ser409Ile)
NM_030962.3(SBF2):c.1296+7C>T rs774033750
NM_030962.3(SBF2):c.1297-2A>G
NM_030962.3(SBF2):c.1297-6T>C rs1554975593
NM_030962.3(SBF2):c.129G>A (p.Gln43=) rs761285505
NM_030962.3(SBF2):c.1327G>C (p.Val443Leu) rs765958389
NM_030962.3(SBF2):c.1333G>A (p.Glu445Lys)
NM_030962.3(SBF2):c.1337A>G (p.Asn446Ser)
NM_030962.3(SBF2):c.136G>C (p.Glu46Gln) rs878855130
NM_030962.3(SBF2):c.1395+8_1395+11delAGTA rs763174480
NM_030962.3(SBF2):c.1396-6T>C rs369973804
NM_030962.3(SBF2):c.141+9T>A rs760322801
NM_030962.3(SBF2):c.1424A>G (p.Gln475Arg) rs199894823
NM_030962.3(SBF2):c.1459C>A (p.Arg487=) rs120074139
NM_030962.3(SBF2):c.1459C>T (p.Arg487Ter) rs120074139
NM_030962.3(SBF2):c.1491T>C (p.Asn497=) rs767806871
NM_030962.3(SBF2):c.1509A>G (p.Glu503=) rs143773975
NM_030962.3(SBF2):c.1519G>A (p.Glu507Lys) rs139217120
NM_030962.3(SBF2):c.1569G>A (p.Lys523=) rs776951161
NM_030962.3(SBF2):c.1573T>C (p.Cys525Arg) rs746860317
NM_030962.3(SBF2):c.1594C>T (p.Pro532Ser) rs1001858508
NM_030962.3(SBF2):c.1601-4C>G rs886048784
NM_030962.3(SBF2):c.1610T>C (p.Met537Thr) rs1278738726
NM_030962.3(SBF2):c.1618G>T (p.Val540Leu) rs201806063
NM_030962.3(SBF2):c.1768G>A (p.Asp590Asn)
NM_030962.3(SBF2):c.1799G>A (p.Arg600Gln) rs185968327
NM_030962.3(SBF2):c.1893C>T (p.Ala631=) rs760154688
NM_030962.3(SBF2):c.1894G>A (p.Ala632Thr) rs1386270581
NM_030962.3(SBF2):c.1930-10G>T rs765561519
NM_030962.3(SBF2):c.1951C>T (p.Gln651Ter)
NM_030962.3(SBF2):c.1967G>C (p.Cys656Ser) rs138120231
NM_030962.3(SBF2):c.1971A>G (p.Val657=) rs368639697
NM_030962.3(SBF2):c.2014A>G (p.Thr672Ala)
NM_030962.3(SBF2):c.2035G>A (p.Glu679Lys) rs7102464
NM_030962.3(SBF2):c.2050C>G (p.Leu684Val) rs146987383
NM_030962.3(SBF2):c.2081C>T (p.Ala694Val)
NM_030962.3(SBF2):c.20_21delAC (p.Tyr7Phefs)
NM_030962.3(SBF2):c.2100+7G>A rs370918433
NM_030962.3(SBF2):c.215A>C (p.Asp72Ala) rs1060500000
NM_030962.3(SBF2):c.2160A>G (p.Gln720=) rs1247703447
NM_030962.3(SBF2):c.2197C>G (p.Gln733Glu) rs145199888
NM_030962.3(SBF2):c.2254A>G (p.Asn752Asp) rs775455068
NM_030962.3(SBF2):c.2260A>T (p.Met754Leu)
NM_030962.3(SBF2):c.2319G>A (p.Ala773=) rs201547070
NM_030962.3(SBF2):c.2323G>A (p.Gly775Ser) rs141330687
NM_030962.3(SBF2):c.2329T>G (p.Trp777Gly)
NM_030962.3(SBF2):c.2337C>T (p.Ser779=) rs140730386
NM_030962.3(SBF2):c.2338G>A (p.Gly780Arg) rs775404093
NM_030962.3(SBF2):c.2350A>G (p.Ile784Val) rs758912920
NM_030962.3(SBF2):c.2397A>G (p.Thr799=) rs759550730
NM_030962.3(SBF2):c.23T>G (p.Phe8Cys) rs886047576
NM_030962.3(SBF2):c.2424T>A (p.Asn808Lys)
NM_030962.3(SBF2):c.2431A>G (p.Ile811Val) rs764765082
NM_030962.3(SBF2):c.2450G>A (p.Arg817Gln) rs369653070
NM_030962.3(SBF2):c.2457T>G (p.Ile819Met)
NM_030962.3(SBF2):c.2474A>G (p.Lys825Arg) rs753921188
NM_030962.3(SBF2):c.2516G>C (p.Ser839Thr) rs1060500002
NM_030962.3(SBF2):c.2536+1G>A rs1060500001
NM_030962.3(SBF2):c.2537-5C>T rs886048783
NM_030962.3(SBF2):c.257A>T (p.Tyr86Phe) rs745669920
NM_030962.3(SBF2):c.2598G>A (p.Pro866=) rs376372877
NM_030962.3(SBF2):c.2600C>T (p.Pro867Leu) rs370198639
NM_030962.3(SBF2):c.2611-19_2611-16delAATC rs202029370
NM_030962.3(SBF2):c.2669G>A (p.Arg890Gln) rs755699993
NM_030962.3(SBF2):c.2689G>A (p.Gly897Arg) rs1554924568
NM_030962.3(SBF2):c.2789C>T (p.Thr930Ile)
NM_030962.3(SBF2):c.2795A>G (p.His932Arg) rs1554924467
NM_030962.3(SBF2):c.280-5T>C rs368118378
NM_030962.3(SBF2):c.2819C>T (p.Thr940Ile) rs756720332
NM_030962.3(SBF2):c.2828G>A (p.Arg943Gln) rs753298285
NM_030962.3(SBF2):c.2850C>T (p.Ile950=) rs74642088
NM_030962.3(SBF2):c.2870C>A (p.Thr957Lys) rs886048782
NM_030962.3(SBF2):c.2872A>G (p.Met958Val) rs901770002
NM_030962.3(SBF2):c.2875C>T (p.Gln959Ter) rs120074137
NM_030962.3(SBF2):c.291G>A (p.Lys97=) rs150056369
NM_030962.3(SBF2):c.2938A>G (p.Ile980Val)
NM_030962.3(SBF2):c.2963T>G (p.Val988Gly) rs778766567
NM_030962.3(SBF2):c.3001A>T (p.Met1001Leu) rs781742897
NM_030962.3(SBF2):c.3006G>T (p.Lys1002Asn) rs572884226
NM_030962.3(SBF2):c.3016C>T (p.Pro1006Ser) rs886048781
NM_030962.3(SBF2):c.3040G>A (p.Ala1014Thr)
NM_030962.3(SBF2):c.3086A>G (p.Gln1029Arg)
NM_030962.3(SBF2):c.3110G>C (p.Arg1037Pro) rs748477865
NM_030962.3(SBF2):c.3111-6T>C rs16907139
NM_030962.3(SBF2):c.3127A>G (p.Ile1043Val) rs147438385
NM_030962.3(SBF2):c.3135A>G (p.Lys1045=) rs1554920965
NM_030962.3(SBF2):c.313A>G (p.Lys105Glu)
NM_030962.3(SBF2):c.3163A>G (p.Ile1055Val) rs142891020
NM_030962.3(SBF2):c.3169C>T (p.Arg1057Trp) rs536949808
NM_030962.3(SBF2):c.3170G>A (p.Arg1057Gln) rs138612196
NM_030962.3(SBF2):c.3203T>G (p.Ile1068Ser)
NM_030962.3(SBF2):c.3257-10A>T rs1348371983
NM_030962.3(SBF2):c.3257-5C>G rs886048780
NM_030962.3(SBF2):c.3283A>G (p.Ser1095Gly) rs2942402
NM_030962.3(SBF2):c.3290C>A (p.Thr1097Asn) rs141894081
NM_030962.3(SBF2):c.3292C>G (p.Leu1098Val) rs117957652
NM_030962.3(SBF2):c.3304G>A (p.Glu1102Lys) rs778262784
NM_030962.3(SBF2):c.3433A>G (p.Arg1145Gly) rs145647154
NM_030962.3(SBF2):c.3436A>T (p.Met1146Leu) rs377277274
NM_030962.3(SBF2):c.3451C>T (p.Arg1151Trp) rs140550985
NM_030962.3(SBF2):c.3457T>C (p.Tyr1153His) rs1060499998
NM_030962.3(SBF2):c.3466C>T (p.Leu1156Phe)
NM_030962.3(SBF2):c.3526C>T (p.Arg1176Ter)
NM_030962.3(SBF2):c.3582C>T (p.Leu1194=) rs201514622
NM_030962.3(SBF2):c.3586C>T (p.Arg1196Ter) rs120074138
NM_030962.3(SBF2):c.3587G>A (p.Arg1196Gln)
NM_030962.3(SBF2):c.3617T>C (p.Val1206Ala) rs766573319
NM_030962.3(SBF2):c.3646C>G (p.Gln1216Glu) rs12574508
NM_030962.3(SBF2):c.3651C>T (p.Ala1217=) rs550913752
NM_030962.3(SBF2):c.3712T>A (p.Leu1238Ile)
NM_030962.3(SBF2):c.3745A>G (p.Arg1249Gly) rs1554914278
NM_030962.3(SBF2):c.3754A>T (p.Ser1252Cys) rs139967004
NM_030962.3(SBF2):c.3761T>C (p.Leu1254Pro) rs762211340
NM_030962.3(SBF2):c.3812G>A (p.Arg1271His)
NM_030962.3(SBF2):c.3819C>T (p.Ser1273=) rs145351367
NM_030962.3(SBF2):c.3824G>A (p.Arg1275His) rs150028248
NM_030962.3(SBF2):c.3831C>G (p.Ile1277Met) rs139522696
NM_030962.3(SBF2):c.3837T>G (p.Ser1279=) rs1554909254
NM_030962.3(SBF2):c.3843A>G (p.Thr1281=) rs147597665
NM_030962.3(SBF2):c.3877A>G (p.Lys1293Glu) rs200594508
NM_030962.3(SBF2):c.3887C>T (p.Ser1296Leu)
NM_030962.3(SBF2):c.3888G>A (p.Ser1296=) rs375669985
NM_030962.3(SBF2):c.389C>T (p.Pro130Leu)
NM_030962.3(SBF2):c.3931A>G (p.Lys1311Glu)
NM_030962.3(SBF2):c.3935G>A (p.Arg1312Gln)
NM_030962.3(SBF2):c.3938A>G (p.Gln1313Arg) rs1554909178
NM_030962.3(SBF2):c.3989T>C (p.Val1330Ala) rs147350002
NM_030962.3(SBF2):c.402+5A>G rs1060503800
NM_030962.3(SBF2):c.4038C>G (p.Ile1346Met)
NM_030962.3(SBF2):c.4095C>T (p.Ile1365=) rs142904756
NM_030962.3(SBF2):c.4096C>T (p.Pro1366Ser) rs115927577
NM_030962.3(SBF2):c.4102G>A (p.Asp1368Asn)
NM_030962.3(SBF2):c.4107A>C (p.Ser1369=) rs769205402
NM_030962.3(SBF2):c.4120C>G (p.Leu1374Val) rs746286799
NM_030962.3(SBF2):c.415T>G (p.Leu139Val) rs146361949
NM_030962.3(SBF2):c.4263A>G (p.Thr1421=) rs368381654
NM_030962.3(SBF2):c.427G>A (p.Val143Met) rs142469360
NM_030962.3(SBF2):c.4335G>A (p.Glu1445=) rs1370306059
NM_030962.3(SBF2):c.4394G>A (p.Gly1465Glu) rs762165359
NM_030962.3(SBF2):c.4443+1G>A
NM_030962.3(SBF2):c.4465G>A (p.Glu1489Lys) rs864622502
NM_030962.3(SBF2):c.4515G>A (p.Val1505=) rs144935862
NM_030962.3(SBF2):c.4522C>T (p.Arg1508Cys) rs141108330
NM_030962.3(SBF2):c.4523G>A (p.Arg1508His) rs770619905
NM_030962.3(SBF2):c.4533A>G (p.Thr1511=) rs79251068
NM_030962.3(SBF2):c.4571-6C>T rs2645029
NM_030962.3(SBF2):c.4603G>A (p.Ala1535Thr) rs546392558
NM_030962.3(SBF2):c.4659C>T (p.Pro1553=) rs368478401
NM_030962.3(SBF2):c.4666T>C (p.Phe1556Leu) rs189911105
NM_030962.3(SBF2):c.4687T>C (p.Leu1563=) rs563878786
NM_030962.3(SBF2):c.4693A>G (p.Ile1565Val) rs115345208
NM_030962.3(SBF2):c.4699-9C>A rs376668219
NM_030962.3(SBF2):c.4701T>G (p.Ala1567=) rs750656969
NM_030962.3(SBF2):c.4712A>G (p.Asn1571Ser) rs371960255
NM_030962.3(SBF2):c.4733A>G (p.Lys1578Arg) rs775360425
NM_030962.3(SBF2):c.4799C>T (p.Thr1600Ile) rs183468503
NM_030962.3(SBF2):c.4805A>G (p.Lys1602Arg)
NM_030962.3(SBF2):c.4809C>T (p.His1603=) rs199670153
NM_030962.3(SBF2):c.4872G>T (p.Val1624=) rs539369489
NM_030962.3(SBF2):c.4890T>A (p.Asp1630Glu) rs963997810
NM_030962.3(SBF2):c.4931G>A (p.Ser1644Asn) rs754078134
NM_030962.3(SBF2):c.4933-13_4933-9delAATTT
NM_030962.3(SBF2):c.4933-15T>C rs75447733
NM_030962.3(SBF2):c.4960A>C (p.Asn1654His)
NM_030962.3(SBF2):c.5004C>T (p.Thr1668=) rs150598413
NM_030962.3(SBF2):c.5014_5016delAAA (p.Lys1672del) rs750958357
NM_030962.3(SBF2):c.5016A>G (p.Lys1672=)
NM_030962.3(SBF2):c.5017G>A (p.Glu1673Lys) rs764823510
NM_030962.3(SBF2):c.5020_5022delGAA (p.Glu1674del) rs572571832
NM_030962.3(SBF2):c.5035C>T (p.Arg1679Cys) rs79401259
NM_030962.3(SBF2):c.5037+1G>A rs1060499999
NM_030962.3(SBF2):c.5037C>T (p.Arg1679=) rs200784979
NM_030962.3(SBF2):c.5041C>T (p.Gln1681Ter)
NM_030962.3(SBF2):c.5054C>G (p.Ser1685Trp) rs148468522
NM_030962.3(SBF2):c.5058A>T (p.Arg1686Ser) rs146230559
NM_030962.3(SBF2):c.5102G>A (p.Arg1701Lys)
NM_030962.3(SBF2):c.5112A>G (p.Leu1704=) rs370420894
NM_030962.3(SBF2):c.513+4A>G rs1554990552
NM_030962.3(SBF2):c.514-12C>T rs770141264
NM_030962.3(SBF2):c.5205G>C (p.Gln1735His) rs878855131
NM_030962.3(SBF2):c.5209A>T (p.Thr1737Ser)
NM_030962.3(SBF2):c.5231+14C>T rs371184526
NM_030962.3(SBF2):c.5232-7C>A rs752774091
NM_030962.3(SBF2):c.5245A>G (p.Thr1749Ala) rs1288312315
NM_030962.3(SBF2):c.527T>C (p.Leu176Ser) rs1554990128
NM_030962.3(SBF2):c.5296G>A (p.Val1766Ile) rs886048779
NM_030962.3(SBF2):c.5375C>G (p.Ala1792Gly)
NM_030962.3(SBF2):c.5375C>T (p.Ala1792Val) rs1554897834
NM_030962.3(SBF2):c.5410A>G (p.Met1804Val) rs755264093
NM_030962.3(SBF2):c.546G>T (p.Gln182His) rs886047534
NM_030962.3(SBF2):c.5483G>A (p.Cys1828Tyr)
NM_030962.3(SBF2):c.5503G>A (p.Ala1835Thr) rs886048778
NM_030962.3(SBF2):c.568G>A (p.Asp190Asn)
NM_030962.3(SBF2):c.586G>A (p.Gly196Ser)
NM_030962.3(SBF2):c.612G>A (p.Gln204=) rs1554990046
NM_030962.3(SBF2):c.645T>C (p.Phe215=) rs148187321
NM_030962.3(SBF2):c.700C>T (p.Leu234Phe) rs749378136
NM_030962.3(SBF2):c.705T>C (p.Ser235=) rs143209062
NM_030962.3(SBF2):c.735G>A (p.Met245Ile) rs1554981022
NM_030962.3(SBF2):c.747A>G (p.Lys249=) rs1554981019
NM_030962.3(SBF2):c.753-16T>A rs7128234
NM_030962.3(SBF2):c.769A>G (p.Ile257Val) rs756866661
NM_030962.3(SBF2):c.777G>A (p.Pro259=) rs142261202
NM_030962.3(SBF2):c.783G>T (p.Gln261His)
NM_030962.3(SBF2):c.796C>G (p.Leu266Val)
NM_030962.3(SBF2):c.832T>A (p.Ser278Thr) rs746749228
NM_030962.3(SBF2):c.898A>G (p.Ile300Val) rs141669540
NM_030962.3(SBF2):c.909C>T (p.Pro303=) rs16907355
NM_030962.3(SBF2):c.925T>G (p.Ser309Ala) rs1300253311
NM_030962.3(SBF2):c.93T>C (p.Phe31=) rs200263159
NM_030962.3(SBF2):c.942A>G (p.Pro314=) rs753903194
NM_030962.3(SBF2):c.946C>T (p.Leu316=) rs374841593
NM_030962.3:c.754_823del
NM_033497.2(HK1):c.4G>A (p.Gly2Arg)
NM_033498.2(HK1):c.-249-3838G>C rs797044964
NM_033500.2(HK1):c.-390-3818G>C rs397514654
NM_139241.2(FGD4):c.1698G>H rs281865064
NM_139241.3(FGD4):c.*1006C>T rs886049260
NM_139241.3(FGD4):c.*1007G>A rs114843464
NM_139241.3(FGD4):c.*1068A>G rs537833755
NM_139241.3(FGD4):c.*1133A>C rs10844268
NM_139241.3(FGD4):c.*1148C>T rs56110646
NM_139241.3(FGD4):c.*1160G>A rs540745195
NM_139241.3(FGD4):c.*1274G>A rs570269532
NM_139241.3(FGD4):c.*1354A>G rs886049261
NM_139241.3(FGD4):c.*1356T>G rs886049262
NM_139241.3(FGD4):c.*1454A>G rs7964947
NM_139241.3(FGD4):c.*1485T>C rs55970127
NM_139241.3(FGD4):c.*1492T>G rs7980205
NM_139241.3(FGD4):c.*1704C>G rs886049263
NM_139241.3(FGD4):c.*1723C>T rs4931030
NM_139241.3(FGD4):c.*1781G>A rs886049264
NM_139241.3(FGD4):c.*1828A>T rs4931031
NM_139241.3(FGD4):c.*1866T>G rs886049265
NM_139241.3(FGD4):c.*1908G>C rs886049266
NM_139241.3(FGD4):c.*1954A>G rs1239829
NM_139241.3(FGD4):c.*2026A>G rs765502938
NM_139241.3(FGD4):c.*2103A>G rs55963204
NM_139241.3(FGD4):c.*2203T>C rs41276678
NM_139241.3(FGD4):c.*22G>A rs114284024
NM_139241.3(FGD4):c.*2374G>T rs753715337
NM_139241.3(FGD4):c.*2462C>A rs575272682
NM_139241.3(FGD4):c.*2537C>A rs115173894
NM_139241.3(FGD4):c.*2638A>G rs193167910
NM_139241.3(FGD4):c.*2813C>T rs148195158
NM_139241.3(FGD4):c.*290G>A rs79732949
NM_139241.3(FGD4):c.*2928_*2931del rs549931906
NM_139241.3(FGD4):c.*3037C>A rs886049267
NM_139241.3(FGD4):c.*3044T>C rs747748956
NM_139241.3(FGD4):c.*3121_*3122del rs57627640
NM_139241.3(FGD4):c.*3121_*3122dup rs57627640
NM_139241.3(FGD4):c.*3130G>A rs73087441
NM_139241.3(FGD4):c.*3130G>T rs73087441
NM_139241.3(FGD4):c.*3148del rs797002948
NM_139241.3(FGD4):c.*3150A>G rs542871416
NM_139241.3(FGD4):c.*3340A>C rs75320947
NM_139241.3(FGD4):c.*3367G>T rs188648275
NM_139241.3(FGD4):c.*3438C>T rs886049269
NM_139241.3(FGD4):c.*3482G>T rs886049270
NM_139241.3(FGD4):c.*3630T>C rs73313005
NM_139241.3(FGD4):c.*3676A>G rs189489067
NM_139241.3(FGD4):c.*3770G>T rs11052123
NM_139241.3(FGD4):c.*3814A>G rs886049271
NM_139241.3(FGD4):c.*3894_*3895del rs780175220
NM_139241.3(FGD4):c.*3905A>G rs886049273
NM_139241.3(FGD4):c.*3920del rs144034303
NM_139241.3(FGD4):c.*4063A>G rs62642552
NM_139241.3(FGD4):c.*411A>G rs886049256
NM_139241.3(FGD4):c.*4128C>T rs12312970
NM_139241.3(FGD4):c.*4211T>C rs75583772
NM_139241.3(FGD4):c.*4268A>G rs542163387
NM_139241.3(FGD4):c.*4369dup rs35874340
NM_139241.3(FGD4):c.*4438A>G rs11052124
NM_139241.3(FGD4):c.*4454G>A rs147515673
NM_139241.3(FGD4):c.*4497G>A rs367545740
NM_139241.3(FGD4):c.*4652T>C rs16920125
NM_139241.3(FGD4):c.*4756A>G rs763037960
NM_139241.3(FGD4):c.*4772dup rs567814235
NM_139241.3(FGD4):c.*4831C>T rs145433607
NM_139241.3(FGD4):c.*4862C>A rs886049275
NM_139241.3(FGD4):c.*4925A>T rs886049276
NM_139241.3(FGD4):c.*4956T>A rs149215917
NM_139241.3(FGD4):c.*4977G>C rs575914495
NM_139241.3(FGD4):c.*497T>C rs886049257
NM_139241.3(FGD4):c.*4991A>G rs1239830
NM_139241.3(FGD4):c.*5020G>C rs886049277
NM_139241.3(FGD4):c.*5072A>G rs886049278
NM_139241.3(FGD4):c.*5152C>T rs886049279
NM_139241.3(FGD4):c.*5177G>A rs777896036
NM_139241.3(FGD4):c.*5198G>A rs1133509
NM_139241.3(FGD4):c.*5223G>A rs886049280
NM_139241.3(FGD4):c.*5244G>A rs186014657
NM_139241.3(FGD4):c.*5309C>T rs556209722
NM_139241.3(FGD4):c.*5329G>C rs886049281
NM_139241.3(FGD4):c.*5484T>C rs577630567
NM_139241.3(FGD4):c.*734G>A rs886049258
NM_139241.3(FGD4):c.*762G>T rs886049259
NM_139241.3(FGD4):c.*792A>T rs140601094
NM_139241.3(FGD4):c.*795G>A rs112398567
NM_139241.3(FGD4):c.-144A>T rs886049253
NM_139241.3(FGD4):c.-246+9C>T rs531501340
NM_139241.3(FGD4):c.-246G>C rs77113168
NM_139241.3(FGD4):c.-289A>G rs56168193
NM_139241.3(FGD4):c.-36C>A rs199744649
NM_139241.3(FGD4):c.-370G>A rs184708096
NM_139241.3(FGD4):c.-421A>C rs192626243
NM_139241.3(FGD4):c.-433C>T rs11052033
NM_139241.3(FGD4):c.-447T>C rs886049252
NM_139241.3(FGD4):c.1033A>G (p.Met345Val)
NM_139241.3(FGD4):c.1059C>T (p.Pro353=) rs16920084
NM_139241.3(FGD4):c.1061G>A (p.Arg354Gln) rs1415031307
NM_139241.3(FGD4):c.1091G>C (p.Arg364Thr)
NM_139241.3(FGD4):c.1132+13T>C rs762177862
NM_139241.3(FGD4):c.1135T>G (p.Ser379Ala) rs1396328756
NM_139241.3(FGD4):c.1175G>A (p.Ser392Asn) rs781528826
NM_139241.3(FGD4):c.1192-9A>G rs1555217855
NM_139241.3(FGD4):c.1194G>A (p.Glu398=) rs746263549
NM_139241.3(FGD4):c.1198C>G (p.Leu400Val) rs750265200
NM_139241.3(FGD4):c.1242_1244delAGA (p.Glu414del)
NM_139241.3(FGD4):c.1246A>G (p.Ile416Val) rs1060501903
NM_139241.3(FGD4):c.1258T>A (p.Ser420Thr) rs759385629
NM_139241.3(FGD4):c.1305G>A (p.Arg435=) rs10844253
NM_139241.3(FGD4):c.1325G>A (p.Arg442His) rs281865063
NM_139241.3(FGD4):c.1327T>C (p.Tyr443His) rs1555217941
NM_139241.3(FGD4):c.1339-12C>T rs73083501
NM_139241.3(FGD4):c.1348A>G (p.Met450Val) rs201186597
NM_139241.3(FGD4):c.1366C>A (p.Pro456Thr) rs138160928
NM_139241.3(FGD4):c.1511+4A>G rs760192025
NM_139241.3(FGD4):c.1512-7A>G rs200542541
NM_139241.3(FGD4):c.1515T>C (p.Ser505=) rs60803891
NM_139241.3(FGD4):c.1518G>A (p.Ala506=) rs11052110
NM_139241.3(FGD4):c.1543-8T>C rs115061722
NM_139241.3(FGD4):c.1560C>T (p.Ile520=) rs61748364
NM_139241.3(FGD4):c.1562A>G (p.Asp521Gly) rs141237776
NM_139241.3(FGD4):c.1628_1629delAG (p.Glu543Glyfs)
NM_139241.3(FGD4):c.1636-7T>C rs11052113
NM_139241.3(FGD4):c.1659C>G (p.Ala553=) rs188104446
NM_139241.3(FGD4):c.1711C>A (p.Pro571Thr) rs144693221
NM_139241.3(FGD4):c.1711C>G (p.Pro571Ala) rs144693221
NM_139241.3(FGD4):c.1712C>A (p.Pro571His) rs145071617
NM_139241.3(FGD4):c.1722A>G (p.Ala574=) rs771910342
NM_139241.3(FGD4):c.1729C>T (p.Arg577Ter) rs778377449
NM_139241.3(FGD4):c.1756G>T (p.Gly586Ter) rs118203973
NM_139241.3(FGD4):c.1762-2A>G rs281865065
NM_139241.3(FGD4):c.1814G>A (p.Gly605Asp) rs886049255
NM_139241.3(FGD4):c.184C>T (p.Pro62Ser) rs1555209302
NM_139241.3(FGD4):c.1865_1866delCA (p.Thr622Argfs) rs1555223595
NM_139241.3(FGD4):c.1877A>T (p.Glu626Val) rs1484964809
NM_139241.3(FGD4):c.1929C>A (p.Asn643Lys) rs1555224749
NM_139241.3(FGD4):c.192A>G (p.Gln64=) rs771558628
NM_139241.3(FGD4):c.1950T>G (p.Leu650=) rs1358873743
NM_139241.3(FGD4):c.1962G>A (p.Glu654=) rs201822384
NM_139241.3(FGD4):c.1991G>C (p.Cys664Ser)
NM_139241.3(FGD4):c.2041delC (p.Gln681Argfs) rs1060501904
NM_139241.3(FGD4):c.2101A>G (p.Arg701Gly)
NM_139241.3(FGD4):c.2106C>T (p.Ser702=) rs777555137
NM_139241.3(FGD4):c.2149G>A (p.Val717Met) rs61753359
NM_139241.3(FGD4):c.2197A>G (p.Lys733Glu)
NM_139241.3(FGD4):c.2199A>C (p.Lys733Asn) rs770729087
NM_139241.3(FGD4):c.2211dup (p.Ala738Serfs)
NM_139241.3(FGD4):c.2214T>C (p.Ala738=) rs200144770
NM_139241.3(FGD4):c.236C>T (p.Thr79Ile) rs145115430
NM_139241.3(FGD4):c.255A>T (p.Ala85=) rs139357821
NM_139241.3(FGD4):c.310G>A (p.Glu104Lys) rs752621629
NM_139241.3(FGD4):c.329T>C (p.Leu110Pro) rs142609007
NM_139241.3(FGD4):c.374C>G (p.Thr125Arg)
NM_139241.3(FGD4):c.381A>G (p.Ile127Met) rs774466701
NM_139241.3(FGD4):c.398A>G (p.Asp133Gly) rs759415605
NM_139241.3(FGD4):c.417T>A (p.Pro139=) rs1295234161
NM_139241.3(FGD4):c.435C>G (p.Asp145Glu) rs904582
NM_139241.3(FGD4):c.435C>T (p.Asp145=) rs904582
NM_139241.3(FGD4):c.437G>T (p.Ser146Ile) rs1208033042
NM_139241.3(FGD4):c.443A>T (p.Asp148Val)
NM_139241.3(FGD4):c.479G>A (p.Gly160Asp) rs201826412
NM_139241.3(FGD4):c.50C>G (p.Pro17Arg) rs371407163
NM_139241.3(FGD4):c.514del (p.Ala172Glnfs)
NM_139241.3(FGD4):c.539A>G (p.Glu180Gly) rs1452437045
NM_139241.3(FGD4):c.542G>A (p.Arg181Lys)
NM_139241.3(FGD4):c.569T>A (p.Leu190Gln) rs144980336
NM_139241.3(FGD4):c.569T>C (p.Leu190Pro) rs144980336
NM_139241.3(FGD4):c.58G>A (p.Val20Ile) rs755068251
NM_139241.3(FGD4):c.593A>G (p.Glu198Gly)
NM_139241.3(FGD4):c.635A>G (p.Asn212Ser) rs147969494
NM_139241.3(FGD4):c.667A>C (p.Asn223His) rs761788290
NM_139241.3(FGD4):c.670C>T (p.Arg224Ter) rs118203972
NM_139241.3(FGD4):c.732G>A (p.Ser244=) rs34555341
NM_139241.3(FGD4):c.740C>T (p.Ala247Val) rs1295394925
NM_139241.3(FGD4):c.783T>C (p.Asn261=) rs201678865
NM_139241.3(FGD4):c.823C>T (p.Arg275Ter) rs118203974
NM_139241.3(FGD4):c.836+10G>T rs41276676
NM_139241.3(FGD4):c.852A>G (p.Arg284=) rs773609461
NM_139241.3(FGD4):c.885C>T (p.Phe295=) rs151083690
NM_139241.3(FGD4):c.893T>C (p.Met298Thr) rs63749871
NM_139241.3(FGD4):c.893T>G (p.Met298Arg) rs63749871
NM_139241.3(FGD4):c.955C>T (p.Arg319Cys) rs1131691854
NM_139241.3(FGD4):c.956G>A (p.Arg319His)
NM_139241.3(FGD4):c.991delC (p.Gln331Argfs)
NM_139241.3(FGD4):c.993+4A>T rs767855809
NM_139241.3(FGD4):c.993+8G>A rs12823621
NM_139241.3(FGD4):c.994-4A>G rs886049254
NM_181882.2(PRX):c.*144C>T rs189487790
NM_181882.2(PRX):c.*152A>G rs886054435
NM_181882.2(PRX):c.-114T>G rs367716653
NM_181882.2(PRX):c.-143G>A rs559995627
NM_181882.2(PRX):c.-160C>T rs763423646
NM_181882.2(PRX):c.-198-14C>T rs886054442
NM_181882.2(PRX):c.-199+7G>C rs541213273
NM_181882.2(PRX):c.-20A>C rs780315081
NM_181882.2(PRX):c.-236G>A rs552436076
NM_181882.2(PRX):c.1013C>T (p.Ala338Val)
NM_181882.2(PRX):c.1019C>T (p.Pro340Leu) rs780373582
NM_181882.2(PRX):c.1026A>C (p.Ala342=) rs150772010
NM_181882.2(PRX):c.1051C>T (p.Pro351Ser) rs73933276
NM_181882.2(PRX):c.1087C>G (p.Pro363Ala) rs886054439
NM_181882.2(PRX):c.1100C>A (p.Ala367Asp) rs143400291
NM_181882.2(PRX):c.1102C>T (p.Arg368Ter) rs104894715
NM_181882.2(PRX):c.1129G>T (p.Val377Leu) rs754081921
NM_181882.2(PRX):c.1141A>C (p.Ser381Arg) rs1049349860
NM_181882.2(PRX):c.1144C>G (p.Pro382Ala)
NM_181882.2(PRX):c.1215C>T (p.Pro405=) rs377184301
NM_181882.2(PRX):c.1216G>A (p.Ala406Thr) rs117336941
NM_181882.2(PRX):c.1222C>T (p.Pro408Ser) rs150244426
NM_181882.2(PRX):c.1281C>T (p.Ile427=) rs76960467
NM_181882.2(PRX):c.133C>G (p.Arg45Gly) rs115090201
NM_181882.2(PRX):c.1369G>A (p.Glu457Lys) rs142064826
NM_181882.2(PRX):c.1369G>C (p.Glu457Gln) rs142064826
NM_181882.2(PRX):c.1390C>T (p.Arg464Ter)
NM_181882.2(PRX):c.1391G>A (p.Arg464Gln) rs553211374
NM_181882.2(PRX):c.13A>G (p.Ser5Gly)
NM_181882.2(PRX):c.1460C>T (p.Pro487Leu)
NM_181882.2(PRX):c.1461G>A (p.Pro487=) rs757009052
NM_181882.2(PRX):c.1483G>C (p.Glu495Gln) rs146789340
NM_181882.2(PRX):c.1483_1560del78 (p.Glu495_Val520del) rs1555801137
NM_181882.2(PRX):c.1500A>G (p.Ser500=) rs777104457
NM_181882.2(PRX):c.1510C>T (p.Leu504Phe) rs192607896
NM_181882.2(PRX):c.1538C>T (p.Pro513Leu)
NM_181882.2(PRX):c.1546C>T (p.Arg516Trp) rs144305922
NM_181882.2(PRX):c.1568T>C (p.Leu523Pro) rs550446238
NM_181882.2(PRX):c.1574T>C (p.Val525Ala) rs149715830
NM_181882.2(PRX):c.1578G>A (p.Ser526=) rs567690884
NM_181882.2(PRX):c.1578_1601dup (p.Met536_Ala537insLysLeuProLysValProGluMet) rs764208864
NM_181882.2(PRX):c.15C>G (p.Ser5Arg)
NM_181882.2(PRX):c.1613T>C (p.Val538Ala) rs765791679
NM_181882.2(PRX):c.1624C>T (p.Arg542Trp) rs201337455
NM_181882.2(PRX):c.1625G>A (p.Arg542Gln) rs139586219
NM_181882.2(PRX):c.1651G>A (p.Val551Met) rs61733448
NM_181882.2(PRX):c.1658A>G (p.Glu553Gly) rs879254301
NM_181882.2(PRX):c.1714G>A (p.Val572Met) rs370979792
NM_181882.2(PRX):c.1718A>G (p.Gln573Arg)
NM_181882.2(PRX):c.176T>C (p.Leu59Pro)
NM_181882.2(PRX):c.1813C>T (p.Leu605Phe) rs1555801070
NM_181882.2(PRX):c.1828G>A (p.Glu610Lys) rs537664679
NM_181882.2(PRX):c.1836C>T (p.Ala612=) rs574899855
NM_181882.2(PRX):c.1837G>A (p.Val613Met) rs773222045
NM_181882.2(PRX):c.185-6C>T rs747043680
NM_181882.2(PRX):c.185-8G>A rs768814221
NM_181882.2(PRX):c.185-9C>T rs1555801635
NM_181882.2(PRX):c.1891C>G (p.Leu631Val) rs886054438
NM_181882.2(PRX):c.1900_1914delATGAAACTCCCTGAG (p.Met634_Glu638del)
NM_181882.2(PRX):c.1906C>T (p.Leu636Phe)
NM_181882.2(PRX):c.1935C>T (p.Pro645=) rs763132536
NM_181882.2(PRX):c.1951G>A (p.Asp651Asn) rs3814290
NM_181882.2(PRX):c.1964C>T (p.Pro655Leu) rs118003416
NM_181882.2(PRX):c.1979C>T (p.Pro660Leu) rs748737580
NM_181882.2(PRX):c.1980G>A (p.Pro660=) rs777413169
NM_181882.2(PRX):c.200G>A (p.Ser67Asn)
NM_181882.2(PRX):c.2017A>G (p.Met673Val) rs61735531
NM_181882.2(PRX):c.2033T>C (p.Val678Ala)
NM_181882.2(PRX):c.2036G>A (p.Arg679Gln) rs145856805
NM_181882.2(PRX):c.2043C>T (p.Pro681=) rs56743160
NM_181882.2(PRX):c.2071A>C (p.Met691Leu) rs886054437
NM_181882.2(PRX):c.2077C>G (p.Leu693Val) rs758696889
NM_181882.2(PRX):c.2098delG (p.Ala700Profs) rs281865062
NM_181882.2(PRX):c.2101G>A (p.Val701Met) rs116855701
NM_181882.2(PRX):c.2145T>A (p.Cys715Ter) rs104894707
NM_181882.2(PRX):c.2209G>A (p.Val737Met) rs1237761863
NM_181882.2(PRX):c.2215G>A (p.Asp739Asn) rs779294844
NM_181882.2(PRX):c.2229C>T (p.Pro743=) rs144975214
NM_181882.2(PRX):c.2243C>T (p.Pro748Leu)
NM_181882.2(PRX):c.2254G>A (p.Glu752Lys) rs147587689
NM_181882.2(PRX):c.2282C>T (p.Pro761Leu) rs530370432
NM_181882.2(PRX):c.2285A>G (p.Lys762Arg)
NM_181882.2(PRX):c.2289delT (p.Asp765Thrfs) rs797045102
NM_181882.2(PRX):c.2292C>G (p.Pro764=) rs142637195
NM_181882.2(PRX):c.2292C>T (p.Pro764=) rs142637195
NM_181882.2(PRX):c.2293G>T (p.Asp765Tyr)
NM_181882.2(PRX):c.2307G>A (p.Pro769=) rs148655811
NM_181882.2(PRX):c.2311G>C (p.Ala771Pro)
NM_181882.2(PRX):c.231C>G (p.Tyr77Ter)
NM_181882.2(PRX):c.2353A>G (p.Lys785Glu)
NM_181882.2(PRX):c.237C>T (p.Asp79=) rs376174896
NM_181882.2(PRX):c.2440T>C (p.Ser814Pro)
NM_181882.2(PRX):c.2449C>T (p.Arg817Cys) rs147441856
NM_181882.2(PRX):c.2464G>A (p.Glu822Lys) rs772009400
NM_181882.2(PRX):c.2469G>A (p.Ala823=) rs61733450
NM_181882.2(PRX):c.247delC (p.Leu83Cysfs) rs281865061
NM_181882.2(PRX):c.2494G>C (p.Val832Leu) rs116139153
NM_181882.2(PRX):c.2534C>T (p.Ala845Val)
NM_181882.2(PRX):c.2536C>T (p.His846Tyr) rs765595266
NM_181882.2(PRX):c.2548C>G (p.Pro850Ala) rs141686828
NM_181882.2(PRX):c.256T>C (p.Cys86Arg)
NM_181882.2(PRX):c.2573A>G (p.Glu858Gly)
NM_181882.2(PRX):c.2605G>A (p.Gly869Arg) rs1555800819
NM_181882.2(PRX):c.2619C>T (p.Ala873=) rs761066015
NM_181882.2(PRX):c.2620G>A (p.Ala874Thr) rs145790961
NM_181882.2(PRX):c.2641C>A (p.Arg881=) rs375201649
NM_181882.2(PRX):c.2641C>T (p.Arg881Trp) rs375201649
NM_181882.2(PRX):c.2645T>C (p.Val882Ala) rs268671
NM_181882.2(PRX):c.2651G>A (p.Gly884Asp) rs139005780
NM_181882.2(PRX):c.2655T>C (p.Pro885=) rs268672
NM_181882.2(PRX):c.2677G>A (p.Glu893Lys) rs201270794
NM_181882.2(PRX):c.2690G>A (p.Arg897Gln) rs752531623
NM_181882.2(PRX):c.27+8C>A rs769214562
NM_181882.2(PRX):c.2727C>T (p.Pro909=) rs61735546
NM_181882.2(PRX):c.2728G>A (p.Ala910Thr) rs145203783
NM_181882.2(PRX):c.2730C>T (p.Ala910=) rs878855283
NM_181882.2(PRX):c.2731G>A (p.Val911Met)
NM_181882.2(PRX):c.2746G>C (p.Gly916Arg) rs775152960
NM_181882.2(PRX):c.2763A>G (p.Ile921Met) rs268673
NM_181882.2(PRX):c.2775C>T (p.Val925=) rs201792838
NM_181882.2(PRX):c.2787del (p.Lys930Serfs) rs754521978
NM_181882.2(PRX):c.2816C>G (p.Ser939Trp) rs761769929
NM_181882.2(PRX):c.2819G>A (p.Gly940Glu) rs1322545345
NM_181882.2(PRX):c.281_283delTCT (p.Phe94del)
NM_181882.2(PRX):c.2854G>C (p.Gly952Arg) rs1060502972
NM_181882.2(PRX):c.2857C>T (p.Arg953Ter) rs104894714
NM_181882.2(PRX):c.2876T>C (p.Val959Ala)
NM_181882.2(PRX):c.2909G>A (p.Arg970Gln)
NM_181882.2(PRX):c.2916G>T (p.Gly972=) rs1555800751
NM_181882.2(PRX):c.2933A>G (p.Lys978Arg) rs767386430
NM_181882.2(PRX):c.2943G>A (p.Gly981=) rs142228732
NM_181882.2(PRX):c.296C>T (p.Thr99Ile)
NM_181882.2(PRX):c.2999C>T (p.Ala1000Val) rs765924621
NM_181882.2(PRX):c.3014_3015insT (p.Lys1006Glnfs) rs1301129751
NM_181882.2(PRX):c.3037G>A (p.Asp1013Asn)
NM_181882.2(PRX):c.3041T>C (p.Leu1014Pro)
NM_181882.2(PRX):c.306C>T (p.Thr102=) rs744389
NM_181882.2(PRX):c.3094G>A (p.Asp1032Asn) rs772431799
NM_181882.2(PRX):c.3145G>A (p.Gly1049Ser) rs186086914
NM_181882.2(PRX):c.3186G>T (p.Lys1062Asn) rs139188673
NM_181882.2(PRX):c.3190C>T (p.Pro1064Ser) rs937051533
NM_181882.2(PRX):c.3208C>T (p.Arg1070Ter) rs104894708
NM_181882.2(PRX):c.3209G>A (p.Arg1070Gln) rs146222815
NM_181882.2(PRX):c.3218A>G (p.Glu1073Gly) rs61733451
NM_181882.2(PRX):c.3220G>A (p.Ala1074Thr) rs886054436
NM_181882.2(PRX):c.3238C>T (p.Arg1080Cys)
NM_181882.2(PRX):c.3248C>G (p.Pro1083Arg) rs3745202
NM_181882.2(PRX):c.3271G>A (p.Ala1091Thr) rs368459753
NM_181882.2(PRX):c.3288C>A (p.Ile1096=) rs375122789
NM_181882.2(PRX):c.3352G>A (p.Val1118Ile)
NM_181882.2(PRX):c.3352G>T (p.Val1118Phe) rs143654708
NM_181882.2(PRX):c.336G>A (p.Val112=) rs369268369
NM_181882.2(PRX):c.3373G>A (p.Gly1125Ser) rs148939995
NM_181882.2(PRX):c.3375C>T (p.Gly1125=) rs755560307
NM_181882.2(PRX):c.3376C>A (p.Leu1126Met)
NM_181882.2(PRX):c.3394G>A (p.Gly1132Arg) rs268674
NM_181882.2(PRX):c.3400G>T (p.Val1134Leu) rs786204203
NM_181882.2(PRX):c.3416A>G (p.His1139Arg) rs1268527552
NM_181882.2(PRX):c.3419A>T (p.Asp1140Val) rs923473427
NM_181882.2(PRX):c.3496C>T (p.Pro1166Ser) rs147826200
NM_181882.2(PRX):c.353delA (p.Lys118Argfs)
NM_181882.2(PRX):c.3549C>T (p.Tyr1183=) rs367876251
NM_181882.2(PRX):c.3562C>A (p.Pro1188Thr)
NM_181882.2(PRX):c.3562C>T (p.Pro1188Ser) rs878855284
NM_181882.2(PRX):c.3580C>G (p.Leu1194Val) rs149732789
NM_181882.2(PRX):c.3583C>T (p.Pro1195Ser) rs1555800544
NM_181882.2(PRX):c.361C>T (p.Arg121Trp) rs750435566
NM_181882.2(PRX):c.3656C>T (p.Pro1219Leu) rs201393544
NM_181882.2(PRX):c.3702C>T (p.Gly1234=) rs139950446
NM_181882.2(PRX):c.3703G>T (p.Glu1235Ter) rs1385904344
NM_181882.2(PRX):c.3708G>A (p.Ala1236=) rs202119177
NM_181882.2(PRX):c.3769G>A (p.Gly1257Arg) rs200332462
NM_181882.2(PRX):c.3775G>A (p.Glu1259Lys) rs751742049
NM_181882.2(PRX):c.3799G>A (p.Gly1267Arg) rs542711361
NM_181882.2(PRX):c.379C>T (p.Leu127=) rs886054441
NM_181882.2(PRX):c.3802G>A (p.Ala1268Thr) rs146061247
NM_181882.2(PRX):c.3802G>C (p.Ala1268Pro) rs146061247
NM_181882.2(PRX):c.3804C>T (p.Ala1268=) rs553825184
NM_181882.2(PRX):c.3831C>G (p.Pro1277=) rs577796628
NM_181882.2(PRX):c.3835G>C (p.Val1279Leu) rs747247972
NM_181882.2(PRX):c.3838G>C (p.Glu1280Gln) rs146205352
NM_181882.2(PRX):c.3845C>T (p.Ser1282Leu) rs753530396
NM_181882.2(PRX):c.3846G>A (p.Ser1282=) rs143289108
NM_181882.2(PRX):c.3849A>G (p.Pro1283=) rs757247849
NM_181882.2(PRX):c.3853G>A (p.Gly1285Arg) rs374370759
NM_181882.2(PRX):c.3863A>T (p.His1288Leu)
NM_181882.2(PRX):c.3867C>T (p.Ala1289=) rs759245840
NM_181882.2(PRX):c.3868G>A (p.Glu1290Lys) rs773955274
NM_181882.2(PRX):c.3919C>T (p.Arg1307Trp)
NM_181882.2(PRX):c.3939G>A (p.Leu1313=) rs140109585
NM_181882.2(PRX):c.3947C>T (p.Ala1316Val) rs142762689
NM_181882.2(PRX):c.4044G>C (p.Gly1348=) rs76088917
NM_181882.2(PRX):c.4058A>C (p.Glu1353Ala) rs1555800424
NM_181882.2(PRX):c.4074_4079delGGAGGA (p.Glu1360_Glu1361del) rs139624657
NM_181882.2(PRX):c.4077_4079delGGA (p.Glu1361del) rs139624657
NM_181882.2(PRX):c.4108C>A (p.Arg1370Ser)
NM_181882.2(PRX):c.4109G>A (p.Arg1370His) rs756687548
NM_181882.2(PRX):c.4111C>T (p.Arg1371Trp) rs753339248
NM_181882.2(PRX):c.4112G>A (p.Arg1371Gln) rs377009047
NM_181882.2(PRX):c.4115G>T (p.Gly1372Val) rs751906783
NM_181882.2(PRX):c.4117C>T (p.Arg1373Trp) rs766729202
NM_181882.2(PRX):c.4118G>A (p.Arg1373Gln) rs763294661
NM_181882.2(PRX):c.4121T>G (p.Val1374Gly) rs773512610
NM_181882.2(PRX):c.4130G>A (p.Arg1377His)
NM_181882.2(PRX):c.4138C>T (p.Arg1380Cys) rs771840476
NM_181882.2(PRX):c.4157C>A (p.Pro1386His) rs372582520
NM_181882.2(PRX):c.4171C>G (p.Arg1391Gly) rs369072136
NM_181882.2(PRX):c.4171C>T (p.Arg1391Trp) rs369072136
NM_181882.2(PRX):c.4196C>T (p.Pro1399Leu) rs764183288
NM_181882.2(PRX):c.4207G>A (p.Val1403Ile) rs139051512
NM_181882.2(PRX):c.4219T>G (p.Ser1407Ala) rs146468976
NM_181882.2(PRX):c.4224C>G (p.Pro1408=) rs1555800370
NM_181882.2(PRX):c.4231C>T (p.Arg1411Cys)
NM_181882.2(PRX):c.4244_4246dup (p.Val1415_Ser1416insLeu) rs771234852
NM_181882.2(PRX):c.4270G>A (p.Gly1424Arg) rs754032938
NM_181882.2(PRX):c.4301G>A (p.Arg1434Gln) rs759435622
NM_181882.2(PRX):c.4304T>C (p.Val1435Ala) rs878855285
NM_181882.2(PRX):c.4307G>A (p.Arg1436Gln) rs368827070
NM_181882.2(PRX):c.4317C>T (p.Ser1439=) rs372280596
NM_181882.2(PRX):c.4318G>A (p.Val1440Met)
NM_181882.2(PRX):c.4333A>G (p.Thr1445Ala) rs368067072
NM_181882.2(PRX):c.4366G>C (p.Ala1456Pro) rs149093940
NM_181882.2(PRX):c.4376C>T (p.Ala1459Val) rs373051724
NM_181882.2(PRX):c.445G>A (p.Ala149Thr) rs142436391
NM_181882.2(PRX):c.457C>T (p.Pro153Ser) rs760295364
NM_181882.2(PRX):c.461T>C (p.Val154Ala) rs1555801518
NM_181882.2(PRX):c.471G>A (p.Glu157=) rs4803335
NM_181882.2(PRX):c.478_492delTTTCCCAAGTTCTCC (p.Phe160_Ser164del) rs1555801508
NM_181882.2(PRX):c.485A>C (p.Lys162Thr) rs879254072
NM_181882.2(PRX):c.493C>T (p.Arg165Cys) rs555499679
NM_181882.2(PRX):c.499C>T (p.Arg167Cys) rs10425452
NM_181882.2(PRX):c.500G>C (p.Arg167Pro) rs757322355
NM_181882.2(PRX):c.502C>T (p.Arg168Trp) rs374193988
NM_181882.2(PRX):c.503G>A (p.Arg168Gln) rs763833871
NM_181882.2(PRX):c.509T>C (p.Leu170Pro) rs1387520113
NM_181882.2(PRX):c.539C>T (p.Pro180Leu) rs540526276
NM_181882.2(PRX):c.540G>A (p.Pro180=) rs371243093
NM_181882.2(PRX):c.554G>A (p.Arg185His) rs76756143
NM_181882.2(PRX):c.559C>T (p.Arg187Cys)
NM_181882.2(PRX):c.580C>T (p.Arg194Cys) rs45521038
NM_181882.2(PRX):c.586C>T (p.Arg196Ter) rs104894706
NM_181882.2(PRX):c.597C>G (p.Ala199=) rs144157275
NM_181882.2(PRX):c.597C>T (p.Ala199=) rs144157275
NM_181882.2(PRX):c.615_616delCCinsTT (p.Arg206Trp)
NM_181882.2(PRX):c.62T>C (p.Val21Ala) rs1167676481
NM_181882.2(PRX):c.631G>T (p.Ala211Ser) rs112973322
NM_181882.2(PRX):c.634C>A (p.Pro212Thr) rs771156102
NM_181882.2(PRX):c.642C>A (p.Pro214=) rs551628239
NM_181882.2(PRX):c.682C>T (p.Arg228Cys) rs751238438
NM_181882.2(PRX):c.683G>A (p.Arg228His) rs562108874
NM_181882.2(PRX):c.718C>T (p.Arg240Trp) rs199863083
NM_181882.2(PRX):c.719G>A (p.Arg240Gln) rs77917609
NM_181882.2(PRX):c.731C>T (p.Ala244Val) rs118071705
NM_181882.2(PRX):c.740G>A (p.Gly247Asp)
NM_181882.2(PRX):c.747C>T (p.Pro249=) rs3814289
NM_181882.2(PRX):c.74C>A (p.Ala25Glu) rs1555802182
NM_181882.2(PRX):c.75G>A (p.Ala25=) rs766160977
NM_181882.2(PRX):c.771C>T (p.Ala257=) rs1555801357
NM_181882.2(PRX):c.794G>T (p.Gly265Val) rs374837022
NM_181882.2(PRX):c.823C>A (p.Leu275Ile) rs200033507
NM_181882.2(PRX):c.833C>T (p.Pro278Leu) rs886054440
NM_181882.2(PRX):c.839C>T (p.Pro280Leu) rs557355077
NM_181882.2(PRX):c.848T>G (p.Val283Gly) rs776556523
NM_181882.2(PRX):c.892C>T (p.Pro298Ser) rs185112635
NM_181882.2(PRX):c.922A>G (p.Thr308Ala) rs753330520
NM_181882.2(PRX):c.936A>G (p.Leu312=) rs752086513
NM_181882.2(PRX):c.946G>C (p.Glu316Gln) rs1555801306
NM_181882.2(PRX):c.960G>A (p.Ser320=) rs775367319
NM_181882.2(PRX):c.966G>T (p.Val322=) rs139544245
NM_181882.2(PRX):c.993G>A (p.Pro331=) rs146323928
NM_181882.2(PRX):c.994A>G (p.Thr332Ala) rs143710873
NM_181882.2:c.979delG
NM_201278.2(MTMR2):c.-153-6_-153-2delTTTTA rs112378876
SBF2, EX11-12DEL
SBF2, IVS32DS, G-C, +1

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.