ClinVar Miner

List of variants in gene RPGRIP1 reported as likely pathogenic for Leber congenital amaurosis

Included ClinVar conditions (39):
Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 7
Download table as spreadsheet
HGVS dbSNP
NM_020366.3(RPGRIP1):c.1116del (p.Lys372fs) rs776880045
NM_020366.3(RPGRIP1):c.2941C>T (p.Arg981Ter) rs780667159
NM_020366.3(RPGRIP1):c.3120G>A (p.Trp1040Ter) rs1555303320
NM_020366.3(RPGRIP1):c.673del (p.His225fs) rs752263228
NM_020366.3(RPGRIP1):c.900_906+14delTCAAGAGGTGAGTTGCCATCA rs886039911
NM_020366.3(RPGRIP1):c.931-2A>G
Single allele

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.