ClinVar Miner

List of variants studied for Leber congenital amaurosis by Diagnostics Division,Centre for DNA Fingerprinting and Diagnostics

Included ClinVar conditions (39):
Minimum submission review status: Collection method:
Minimum conflict level:
ClinVar version:
Total variants: 2
Download table as spreadsheet
NM_017777.3(MKS1):c.958G>A (p.Val320Ile) rs386834053
NM_020366.3(RPGRIP1):c.900_906+14delTCAAGAGGTGAGTTGCCATCA rs886039911

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.