ClinVar Miner

List of variants in gene CREBBP reported as uncertain significance for Rubinstein-Taybi syndrome

Included ClinVar conditions (5):
Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 27
Download table as spreadsheet
NM_004380.2(CREBBP):c.1149G>A (p.Pro383=) rs61759495
NM_004380.2(CREBBP):c.164A>G (p.Asn55Ser) rs587783466
NM_004380.2(CREBBP):c.1732C>T (p.Pro578Ser) rs148023511
NM_004380.2(CREBBP):c.1955A>C (p.His652Pro) rs587783468
NM_004380.2(CREBBP):c.2141G>T (p.Arg714Leu) rs141098117
NM_004380.2(CREBBP):c.2312A>G (p.Gln771Arg) rs147805823
NM_004380.2(CREBBP):c.2314C>A (p.Pro772Thr) rs1555482779
NM_004380.2(CREBBP):c.2606T>C (p.Leu869Pro) rs587783472
NM_004380.2(CREBBP):c.2679G>A (p.Ser893=) rs587783474
NM_004380.2(CREBBP):c.2811G>A (p.Pro937=) rs146168040
NM_004380.2(CREBBP):c.3190G>A (p.Glu1064Lys) rs886041006
NM_004380.2(CREBBP):c.3500A>G (p.Tyr1167Cys) rs587783481
NM_004380.2(CREBBP):c.3989A>G (p.Gln1330Arg) rs587783487
NM_004380.2(CREBBP):c.4421_4422delGTinsTC (p.Cys1474Phe) rs1555473126
NM_004380.2(CREBBP):c.4894T>C (p.Phe1632Leu) rs587783501
NM_004380.2(CREBBP):c.5051C>A (p.Ser1684Tyr) rs1555471841
NM_004380.2(CREBBP):c.5719G>A (p.Ala1907Thr) rs199990883
NM_004380.2(CREBBP):c.5740G>A (p.Val1914Met)
NM_004380.2(CREBBP):c.5800T>C (p.Ser1934Pro) rs587783504
NM_004380.2(CREBBP):c.5837C>A (p.Pro1946Gln)
NM_004380.2(CREBBP):c.6071C>T (p.Ala2024Val) rs745551441
NM_004380.2(CREBBP):c.6444C>T (p.Gly2148=) rs148539895
NM_004380.2(CREBBP):c.6449C>T (p.Pro2150Leu) rs587783512
NM_004380.2(CREBBP):c.7058_7078delGGCCCCAGTCCCAGCCTCCAC (p.Arg2353_Pro2359del)
NM_004380.2(CREBBP):c.7162G>A (p.Ala2388Thr)
NM_004380.2(CREBBP):c.7311G>T (p.Lys2437Asn)

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.