ClinVar Miner

List of variants reported as pathogenic for Fanconi anemia

Included ClinVar conditions (38):
Minimum submission review status: Collection method:
Minimum conflict level:
ClinVar version:
Total variants: 451
Download table as spreadsheet
HGVS dbSNP
FANCA, IVS7DS, G-A, +5
FANCB, 1-BP DEL, 1650T
FANCB, 1-BP INS, 1838T
FANCB, 1-BP INS, 811T
FANCB, 3314-BP DEL
FANCD2, 376A-G
FANCD2, EX17 DEL
FANCG, IVS13, G-C, -1
FANCI, 2T-C
FANCI, IVS31AS, A-G, -88
FANCL, 3-BP DEL, 1007TAT
FANCL, 4-BP DUP, 1095AATT
LRG_497t1:c.1_250del
NC_000003.12:g.(?_10028648)_(10043874_?)del
NC_000003.12:g.(?_10028648)_(10046733_?)del
NC_000003.12:g.(?_10064723)_(10146642_?)del
NC_000009.12:g.(?_95101700)_(95508367_?)del
NC_000015.10:g.(?_89247629)_(89317131_?)del
NC_000016.10:g.(?_13928022)_(13928241_?)del
NC_000016.10:g.(?_3608430)_(3609566_?)del
NC_000016.10:g.(?_89752138)_(89792547_?)del
NC_000016.10:g.(?_89758571)_(89784970_?)del
NC_000016.10:g.(?_89761943)_(89920218_?)del
NC_000016.10:g.(?_89767135)_(89816621_?)del
NC_000016.10:g.(?_89775736)_(89775821_?)del
NC_000016.10:g.(?_89782853)_(89784970_?)del
NC_000016.10:g.(?_89791397)_(89792553_?)del
NC_000016.10:g.(?_89810701)_(89816621_?)del
NC_000016.10:g.(?_89814514)_(89816621_?)del
NC_000016.9:g.(?_89831292)_(89833651_?)del
NC_000017.10:g.(?_56769999)_(56787357_?)del
NC_000017.11:g.(?_58692638)_(58734228_?)del
NC_000017.11:g.(?_58696687)_(58696865_?)del
NC_000017.11:g.(?_58703196)_(58709990_?)del
NC_000017.11:g.(?_58709849)_(58734232_?)del
NC_000017.11:g.(?_58720740)_(58720818_?)del
NC_000017.11:g.(?_58720740)_(58724106_?)del
NC_000017.11:g.(?_58720746)_(58734342_?)del
NC_000017.11:g.(?_61683286)_(61716073_?)del
NC_000017.11:g.(?_61683290)_(61684146_?)del
NC_000017.11:g.(?_61743007)_(61808763_?)del
NC_000017.11:g.(?_61776395)_(61801480_?)del
NC_000017.11:g.(?_61776395)_(61861545_?)del
NC_000017.11:g.(?_61847101)_(61849256_?)del
NC_000017.11:g.(?_61857052)_(61861545_?)del
NC_000017.11:g.(?_61859786)_(61861549_?)del
NG_011706.1:g.10587_63081del
NG_011706.1:g.13291_71928del
NG_011706.1:g.38556_38651del
NG_011706.1:g.72891_76699del
NG_011708.1:g.11963G>A rs878854342
NM_000059.3(BRCA2):c.100G>T (p.Glu34Ter) rs80358391
NM_000059.3(BRCA2):c.1399A>T (p.Lys467Ter) rs80358427
NM_000059.3(BRCA2):c.145G>T (p.Glu49Ter) rs80358435
NM_000059.3(BRCA2):c.3109C>T (p.Gln1037Ter) rs80358557
NM_000059.3(BRCA2):c.4243G>T (p.Glu1415Ter) rs397507327
NM_000059.3(BRCA2):c.4648G>T (p.Glu1550Ter) rs80358695
NM_000059.3(BRCA2):c.4965C>G (p.Tyr1655Ter) rs80358721
NM_000059.3(BRCA2):c.5453C>A (p.Ser1818Ter)
NM_000059.3(BRCA2):c.5609_5610delTCinsAG (p.Phe1870Ter) rs276174859
NM_000059.3(BRCA2):c.5682C>G (p.Tyr1894Ter) rs41293497
NM_000059.3(BRCA2):c.5791C>T (p.Gln1931Ter) rs80358807
NM_000059.3(BRCA2):c.5857G>T (p.Glu1953Ter) rs80358814
NM_000059.3(BRCA2):c.5946delT (p.Ser1982Argfs) rs80359550
NM_000059.3(BRCA2):c.631+1G>A rs81002897
NM_000059.3(BRCA2):c.631+2T>G rs81002899
NM_000059.3(BRCA2):c.658_659delGT (p.Val220Ilefs) rs80359604
NM_000059.3(BRCA2):c.6656C>G (p.Ser2219Ter) rs80358893
NM_000059.3(BRCA2):c.6952C>T (p.Arg2318Ter) rs80358920
NM_000059.3(BRCA2):c.7007G>A (p.Arg2336His) rs28897743
NM_000059.3(BRCA2):c.7464_7465insTA (p.Asp2489Terfs) rs886038169
NM_000059.3(BRCA2):c.7480C>T (p.Arg2494Ter) rs80358972
NM_000059.3(BRCA2):c.7529T>C (p.Leu2510Pro) rs80358979
NM_000059.3(BRCA2):c.7579delG (p.Val2527Terfs) rs1555286294
NM_000059.3(BRCA2):c.7879A>T (p.Ile2627Phe) rs80359014
NM_000059.3(BRCA2):c.7988A>T (p.Glu2663Val) rs80359031
NM_000059.3(BRCA2):c.8167G>C (p.Asp2723His) rs41293511
NM_000059.3(BRCA2):c.8187G>T (p.Lys2729Asn) rs80359065
NM_000059.3(BRCA2):c.8219T>A (p.Leu2740Ter) rs80359070
NM_000059.3(BRCA2):c.8488-1G>A rs397507404
NM_000059.3(BRCA2):c.8732C>A (p.Ala2911Glu) rs80359130
NM_000059.3(BRCA2):c.9117G>A (p.Pro3039=) rs28897756
NM_000059.3(BRCA2):c.9196C>T (p.Gln3066Ter) rs80359180
NM_000059.3(BRCA2):c.9294C>G (p.Tyr3098Ter) rs80359200
NM_000059.3(BRCA2):c.92G>A (p.Trp31Ter) rs397508045
NM_000059.3(BRCA2):c.9382C>T (p.Arg3128Ter) rs80359212
NM_000059.3(BRCA2):c.9672dupA (p.Tyr3225Ilefs) rs80359773
NM_000059.3(BRCA2):c.9693delA (p.Leu3232Phefs)
NM_000135.2(FANCA):c.1007_3066del
NM_000135.2(FANCA):c.1074_1075delGT (p.Tyr359Profs) rs878853660
NM_000135.2(FANCA):c.1115_1118delTTGG (p.Val372Alafs) rs397507552
NM_000135.2(FANCA):c.154C>T (p.Arg52Ter) rs773159223
NM_000135.2(FANCA):c.1606delT (p.Ser536Glnfs) rs587776570
NM_000135.2(FANCA):c.1615del (p.Asp539Thrfs) rs778507965
NM_000135.2(FANCA):c.1771C>T (p.Arg591Ter) rs753980264
NM_000135.2(FANCA):c.1827-1G>A rs555449842
NM_000135.2(FANCA):c.1981A>T (p.Arg661Ter) rs1060501878
NM_000135.2(FANCA):c.238delT (p.Cys80Valfs) rs864622187
NM_000135.2(FANCA):c.2529C>A (p.Tyr843Ter) rs1247378731
NM_000135.2(FANCA):c.2546delC (p.Ser849Phefs) rs1060501876
NM_000135.2(FANCA):c.2574C>G (p.Ser858Arg) rs17233141
NM_000135.2(FANCA):c.2730_2731delCT (p.Trp911Aspfs) rs878853663
NM_000135.2(FANCA):c.2749C>T (p.Arg917Ter) rs1060501880
NM_000135.2(FANCA):c.283+3A>C rs786204204
NM_000135.2(FANCA):c.2851C>T (p.Arg951Trp) rs755546887
NM_000135.2(FANCA):c.295C>T (p.Gln99Ter) rs1057516430
NM_000135.2(FANCA):c.3066+1G>T rs587783028
NM_000135.2(FANCA):c.3349A>G (p.Arg1117Gly) rs149277003
NM_000135.2(FANCA):c.3391A>G (p.Thr1131Ala) rs574034197
NM_000135.2(FANCA):c.3403_3405delTTC (p.Phe1135del) rs786204246
NM_000135.2(FANCA):c.3761_3762delAG (p.Glu1254Glyfs) rs868273545
NM_000135.2(FANCA):c.3788_3790delTCT (p.Phe1263del) rs397507553
NM_000135.2(FANCA):c.416_417delTG (p.Val139Glyfs) rs864622188
NM_000135.2(FANCA):c.65G>A (p.Trp22Ter) rs761341952
NM_000135.2(FANCA):c.709+5G>A rs759877008
NM_000135.2(FANCA):c.862G>T (p.Glu288Ter) rs148100796
NM_000135.2(FANCA):c.894_1006del113 (p.Trp298Cysfs)
NM_000135.2(FANCA):c.97delG (p.Glu33Lysfs) rs786204238
NM_000135.2(FANCA):c.987_990delTCAC (p.His330Alafs) rs772359099
NM_000135.2:c.1471_1626del
NM_000135.2:c.1627_1900del
NM_000135.2:c.2533_2536delCTCT
NM_000135.3(FANCA):c.(?_-1)_522+?del
NM_000135.3(FANCA):c.100A>T (p.Lys34Ter) rs772858764
NM_000135.3(FANCA):c.1340C>G (p.Ser447Ter) rs149551759
NM_000135.3(FANCA):c.1359+1G>C rs1555561294
NM_000135.3(FANCA):c.1378C>T (p.Arg460Ter) rs1438828232
NM_000135.3(FANCA):c.1809dup (p.Ile604Tyrfs) rs1343140664
NM_000135.3(FANCA):c.1814_1815delAG (p.Glu605Valfs) rs759899153
NM_000135.3(FANCA):c.1A>G (p.Met1Val) rs772751654
NM_000135.3(FANCA):c.2151+1G>A rs1555548428
NM_000135.3(FANCA):c.2172dup (p.Ser725Valfs) rs1555547955
NM_000135.3(FANCA):c.2398G>T (p.Glu800Ter) rs1555547474
NM_000135.3(FANCA):c.2535_2536del (p.Cys846Glnfs) rs763378933
NM_000135.3(FANCA):c.2557C>T (p.Arg853Ter) rs752160950
NM_000135.3(FANCA):c.2587_2588dup (p.Leu864Alafs)
NM_000135.3(FANCA):c.2601+1G>T rs1188581065
NM_000135.3(FANCA):c.2602-2A>T rs1555545592
NM_000135.3(FANCA):c.2812_2830dup (p.Asp944Glyfs) rs1283284704
NM_000135.3(FANCA):c.2839dup (p.Ser947Phefs) rs756367276
NM_000135.3(FANCA):c.2840C>G (p.Ser947Ter) rs745568821
NM_000135.3(FANCA):c.2852G>A (p.Arg951Gln) rs755922289
NM_000135.3(FANCA):c.2870G>A (p.Trp957Ter) rs927630499
NM_000135.3(FANCA):c.2T>C (p.Met1Thr) rs769479800
NM_000135.3(FANCA):c.3085G>T (p.Glu1029Ter) rs1555538740
NM_000135.3(FANCA):c.3188G>A (p.Trp1063Ter) rs1166286386
NM_000135.3(FANCA):c.3316G>T (p.Glu1106Ter) rs777825824
NM_000135.3(FANCA):c.3348+1G>A rs751266148
NM_000135.3(FANCA):c.3520_3522delTGG (p.Trp1174del) rs1555536446
NM_000135.3(FANCA):c.3558dup (p.Arg1187Glufs) rs747851434
NM_000135.3(FANCA):c.3634dup (p.Ser1212Phefs)
NM_000135.3(FANCA):c.3720_3724del (p.Glu1240Aspfs) rs794726660
NM_000135.3(FANCA):c.3813dup (p.His1272Thrfs) rs1555534521
NM_000135.3(FANCA):c.4069_4082del (p.Ala1357Leufs) rs747892390
NM_000135.3(FANCA):c.4261-2A>C rs915983602
NM_000135.3(FANCA):c.427A>T (p.Lys143Ter) rs539460201
NM_000135.3(FANCA):c.513G>A (p.Trp171Ter) rs121907930
NM_000135.3(FANCA):c.549G>A (p.Trp183Ter) rs758528624
NM_000135.3(FANCA):c.643_644delTG (p.Cys215Leufs) rs1338138752
NM_000135.3(FANCA):c.718C>T (p.Gln240Ter) rs1184639006
NM_000135.3(FANCA):c.916_917delAC (p.Thr306Alafs) rs764122657
NM_000135.4(FANCA):c.1979T>C (p.Leu660Pro)
NM_000135.4(FANCA):c.2317-2A>G
NM_000135.4(FANCA):c.2639G>A (p.Arg880Gln) rs372254398
NM_000135.4(FANCA):c.2778+1G>A
NM_000135.4(FANCA):c.3913C>T (p.Leu1305Phe) rs753700179
NM_000135.4(FANCA):c.4124_4125del (p.Thr1375Serfs) rs776969626
NM_000136.2(FANCC):c.-78-?_250+?del
NM_000136.2(FANCC):c.1162G>T (p.Gly388Ter) rs371897078
NM_000136.2(FANCC):c.1290C>A (p.Tyr430Ter) rs766105286
NM_000136.2(FANCC):c.1302dupT (p.Gly435Trpfs) rs730881709
NM_000136.2(FANCC):c.1312_1329+68dup rs1554829415
NM_000136.2(FANCC):c.1392_1402delCCAGGACCTGC (p.Gln465Aspfs)
NM_000136.2(FANCC):c.1393C>T (p.Gln465Ter)
NM_000136.2(FANCC):c.1487T>G (p.Leu496Arg) rs121917785
NM_000136.2(FANCC):c.1642C>T (p.Arg548Ter) rs104886457
NM_000136.2(FANCC):c.165+1G>T rs794726668
NM_000136.2(FANCC):c.1661T>C (p.Leu554Pro) rs104886458
NM_000136.2(FANCC):c.1663C>T (p.Arg555Ter) rs370974124
NM_000136.2(FANCC):c.251-2A>G rs1057517219
NM_000136.2(FANCC):c.29dupG (p.Cys10Trpfs) rs878853671
NM_000136.2(FANCC):c.319C>T (p.Gln107Ter) rs730881731
NM_000136.2(FANCC):c.339G>A (p.Trp113Ter) rs1057516291
NM_000136.2(FANCC):c.355_360delTCTCATinsA (p.Ser119Asnfs) rs587779904
NM_000136.2(FANCC):c.37C>T (p.Gln13Ter) rs121917784
NM_000136.2(FANCC):c.389_390delAA (p.Glu130Glyfs)
NM_000136.2(FANCC):c.455dupA (p.Asn152Lysfs) rs774170058
NM_000136.2(FANCC):c.456+4A>T rs104886456
NM_000136.2(FANCC):c.485dupG (p.Glu163Argfs) rs1554842611
NM_000136.2(FANCC):c.487_490delGAGA (p.Glu163Ilefs) rs730881708
NM_000136.2(FANCC):c.489_490delGA (p.Asn164Serfs) rs730881708
NM_000136.2(FANCC):c.519del (p.Arg173Serfs)
NM_000136.2(FANCC):c.520C>T (p.Arg174Ter) rs781542763
NM_000136.2(FANCC):c.535C>T (p.Arg179Ter) rs769039987
NM_000136.2(FANCC):c.553C>T (p.Arg185Ter) rs121917783
NM_000136.2(FANCC):c.65G>A (p.Trp22Ter) rs377294947
NM_000136.2(FANCC):c.67delG (p.Asp23Ilefs) rs104886459
NM_000136.2(FANCC):c.997-?_1154+?del
NM_000136.3(FANCC):c.1555dup (p.Thr519Asnfs) rs794726667
NM_001018113.3(FANCB):c.1496+5G>A
NM_001018113.3(FANCB):c.1857_1858del (p.Arg619Serfs)
NM_001018113.3(FANCB):c.2150T>G (p.Leu717Ter)
NM_001018115.2(FANCD2):c.3707G>A (p.Arg1236His) rs121917786
NM_001018115.2(FANCD2):c.553dup (p.Arg185Lysfs) rs1553607671
NM_001018115.2(FANCD2):c.904C>T (p.Arg302Trp) rs121917787
NM_001018115.2(FANCD2):c.958C>T (p.Gln320Ter) rs121917788
NM_001113378.1(FANCI):c.1461T>A (p.Tyr487Ter) rs769248873
NM_001113378.1(FANCI):c.2422A>T (p.Lys808Ter) rs375656231
NM_001113378.1(FANCI):c.3493delG (p.Asp1165Thrfs) rs758597713
NM_001113378.1(FANCI):c.3623_3624delTG (p.Cys1209Leufs) rs770318990
NM_001113378.1(FANCI):c.3662delA (p.Lys1221Argfs)
NM_001113378.1(FANCI):c.3780T>A (p.Tyr1260Ter) rs1060501900
NM_001113378.1(FANCI):c.3853C>T (p.Arg1285Ter) rs121918164
NM_001113378.1(FANCI):c.3854G>A (p.Arg1285Gln) rs121918163
NM_001113378.1(FANCI):c.507G>A (p.Trp169Ter) rs878854181
NM_001114636.1(FANCL):c.1111_1114dupATTA (p.Thr372Asnfs) rs759217526
NM_002875.4(RAD51):c.877G>A (p.Ala293Thr) rs1057519413
NM_004629.1(FANCG):c.1066C>T (p.Gln356Ter) rs121434426
NM_004629.1(FANCG):c.1077-2A>G rs769547477
NM_004629.1(FANCG):c.1153dup (p.Ser387Leufs)
NM_004629.1(FANCG):c.1183_1192delGAGGTGTTTT (p.Glu395Trpfs) rs397507559
NM_004629.1(FANCG):c.1480+1G>C rs149616199
NM_004629.1(FANCG):c.156dupG (p.Leu53Alafs) rs863224506
NM_004629.1(FANCG):c.1642C>T (p.Arg548Ter)
NM_004629.1(FANCG):c.1795_1804del (p.Trp599Profs) rs397507560
NM_004629.1(FANCG):c.307+1G>C rs200479612
NM_004629.1(FANCG):c.313G>T (p.Glu105Ter) rs121434425
NM_004629.1(FANCG):c.637_643del (p.Tyr213Lysfs) rs587776640
NM_004629.1(FANCG):c.652C>T (p.Gln218Ter)
NM_004629.1(FANCG):c.925-2A>G rs397507561
NM_004629.1:c.1158delC
NM_005236.2(ERCC4):c.1484_1488delCTCAA (p.Thr495Asnfs) rs397509400
NM_005236.2(ERCC4):c.1731delC (p.Tyr577Terfs) rs1555468482
NM_005236.2(ERCC4):c.1765C>T (p.Arg589Trp) rs147105770
NM_005236.2(ERCC4):c.2065C>A (p.Arg689Ser) rs149364215
NM_005236.2(ERCC4):c.2371_2398dup (p.Ile800Thrfs) rs397509401
NM_005236.2(ERCC4):c.689T>C (p.Leu230Pro) rs397509402
NM_006341.3(MAD2L2):c.254T>A (p.Val85Glu) rs1057517674
NM_007294.3(BRCA1):c.110C>A (p.Thr37Lys) rs80356880
NM_007294.3(BRCA1):c.1115G>A (p.Trp372Ter) rs397508838
NM_007294.3(BRCA1):c.117T>A (p.Cys39Ter) rs886040898
NM_007294.3(BRCA1):c.1292T>G (p.Leu431Ter) rs80357346
NM_007294.3(BRCA1):c.131G>T (p.Cys44Phe) rs80357446
NM_007294.3(BRCA1):c.1687C>T (p.Gln563Ter) rs80356898
NM_007294.3(BRCA1):c.181T>G (p.Cys61Gly) rs28897672
NM_007294.3(BRCA1):c.211A>G (p.Arg71Gly) rs80357382
NM_007294.3(BRCA1):c.241C>T (p.Gln81Ter) rs80357350
NM_007294.3(BRCA1):c.2457delC (p.Asp821Ilefs) rs80357669
NM_007294.3(BRCA1):c.2709T>A (p.Cys903Ter) rs1555589094
NM_007294.3(BRCA1):c.2722G>T (p.Glu908Ter) rs80356978
NM_007294.3(BRCA1):c.3097G>T (p.Glu1033Ter) rs273899698
NM_007294.3(BRCA1):c.3598C>T (p.Gln1200Ter) rs62625307
NM_007294.3(BRCA1):c.3893C>A (p.Ser1298Ter) rs80357440
NM_007294.3(BRCA1):c.3G>T (p.Met1Ile) rs80357475
NM_007294.3(BRCA1):c.4054G>T (p.Glu1352Ter) rs80357202
NM_007294.3(BRCA1):c.4327C>T (p.Arg1443Ter) rs41293455
NM_007294.3(BRCA1):c.4485-1G>A rs80358189
NM_007294.3(BRCA1):c.4524G>A (p.Trp1508Ter) rs80356885
NM_007294.3(BRCA1):c.4675+1G>A rs80358044
NM_007294.3(BRCA1):c.5095C>T (p.Arg1699Trp) rs55770810
NM_007294.3(BRCA1):c.5194-12G>A rs80358079
NM_007294.3(BRCA1):c.5207T>C (p.Val1736Ala) rs45553935
NM_007294.3(BRCA1):c.5251C>T (p.Arg1751Ter) rs80357123
NM_007294.3(BRCA1):c.5444G>A (p.Trp1815Ter) rs80356962
NM_007294.3(BRCA1):c.594_597delTGTG (p.Ser198Argfs) rs797045175
NM_007294.3(BRCA1):c.925A>T (p.Lys309Ter) rs879255498
NM_014176.3(UBE2T):c.179+5G>A rs796052212
NM_014176.4(UBE2T):c.4C>G (p.Gln2Glu) rs774357609
NM_018062.3(FANCL):c.1007_1009delTAT (p.Ile336_Cys337delinsSer) rs747253294
NM_018062.3(FANCL):c.211C>T (p.Gln71Ter) rs753105795
NM_018062.3(FANCL):c.268del (p.Leu90Phefs) rs869320684
NM_018062.3(FANCL):c.40dup (p.Leu14Profs)
NM_018062.3(FANCL):c.426_438delTGCTTCTGGTAGA (p.Asp142Glufs) rs878855046
NM_018062.3(FANCL):c.430del (p.Ser144Leufs) rs869320685
NM_018062.3(FANCL):c.759_762delTCTT (p.Phe253Leufs) rs1553435610
NM_018062.3(FANCL):c.822-15_822-9delins177
NM_018124.3(RFWD3):c.1916T>A (p.Ile639Lys) rs1555524842
NM_018124.4(RFWD3):c.204_205dup (p.Leu69Profs) rs1205970095
NM_021922.2(FANCE):c.355C>T (p.Gln119Ter) rs121434505
NM_021922.2(FANCE):c.421C>T (p.Arg141Ter) rs121434506
NM_022725.3(FANCF):c.16C>T (p.Gln6Ter) rs104894221
NM_022725.3(FANCF):c.230_252delTTCCGGGATTAGCGAACTTCCAG (p.Val77Glyfs) rs730880277
NM_022725.3(FANCF):c.327C>G (p.Tyr109Ter) rs104894222
NM_022725.3(FANCF):c.349_395del (p.Gly120Profs) rs730880278
NM_022725.3(FANCF):c.484_485delCT (p.Leu162Aspfs) rs587778340
NM_024675.3(PALB2):c.106C>T (p.Gln36Ter) rs757369748
NM_024675.3(PALB2):c.1240C>T (p.Arg414Ter) rs180177100
NM_024675.3(PALB2):c.1653T>A (p.Tyr551Ter) rs118203997
NM_024675.3(PALB2):c.1676_1677delAAinsG (p.Gln559Argfs) rs515726073
NM_024675.3(PALB2):c.2393_2394insCT (p.Thr799Leufs) rs180177113
NM_024675.3(PALB2):c.2521delA (p.Thr841Glnfs) rs180177116
NM_024675.3(PALB2):c.2834+1G>T rs587776419
NM_024675.3(PALB2):c.2962C>T (p.Gln988Ter) rs118203999
NM_024675.3(PALB2):c.3116delA (p.Asn1039Ilefs) rs180177133
NM_024675.3(PALB2):c.3323delA (p.Tyr1108Serfs) rs180177135
NM_024675.3(PALB2):c.3549C>A (p.Tyr1183Ter) rs118203998
NM_024675.3(PALB2):c.3549C>G (p.Tyr1183Ter) rs118203998
NM_024675.3(PALB2):c.395delT (p.Val132Alafs) rs180177085
NM_024675.3(PALB2):c.757_758delCT (p.Leu253Ilefs) rs180177092
NM_032043.2(BRIP1):c.-31+498_187del
NM_032043.2(BRIP1):c.1018_1019insCT (p.Leu340Profs) rs878855134
NM_032043.2(BRIP1):c.103G>T (p.Gly35Ter) rs373104267
NM_032043.2(BRIP1):c.1045G>C (p.Ala349Pro) rs149364097
NM_032043.2(BRIP1):c.1066C>T (p.Arg356Ter) rs730881633
NM_032043.2(BRIP1):c.1072_1087delCTAATACAAGATGCTG (p.Leu358Thrfs)
NM_032043.2(BRIP1):c.1109_1110dup (p.Tyr371Thrfs)
NM_032043.2(BRIP1):c.1126_1127delCA (p.Gln376Asnfs) rs587780224
NM_032043.2(BRIP1):c.1162C>T (p.Gln388Ter)
NM_032043.2(BRIP1):c.1204_1205insTGTG (p.Ala402Valfs) rs730881647
NM_032043.2(BRIP1):c.1236delA (p.Val413Phefs) rs863224525
NM_032043.2(BRIP1):c.1240C>T (p.Gln414Ter) rs368796923
NM_032043.2(BRIP1):c.1315C>T (p.Arg439Ter) rs587780226
NM_032043.2(BRIP1):c.133G>T (p.Glu45Ter) rs587781292
NM_032043.2(BRIP1):c.1343G>A (p.Trp448Ter) rs775171520
NM_032043.2(BRIP1):c.1372G>T (p.Glu458Ter) rs587780228
NM_032043.2(BRIP1):c.1383T>G (p.Tyr461Ter) rs587780875
NM_032043.2(BRIP1):c.1414G>T (p.Glu472Ter) rs1555605902
NM_032043.2(BRIP1):c.1495C>T (p.Gln499Ter) rs1060501739
NM_032043.2(BRIP1):c.1510delA (p.Ile504Serfs) rs775735278
NM_032043.2(BRIP1):c.1510dupA (p.Ile504Asnfs) rs775735278
NM_032043.2(BRIP1):c.1537delG (p.Ala513Glnfs)
NM_032043.2(BRIP1):c.1594dup (p.Met532Asnfs) rs1339743866
NM_032043.2(BRIP1):c.1661delA (p.Gln554Argfs)
NM_032043.2(BRIP1):c.1697_1698insTATATCAAATTGATATTTCAACAAC (p.Lys567Ilefs) rs878855140
NM_032043.2(BRIP1):c.1702_1703delAA (p.Asn568Trpfs) rs1057519365
NM_032043.2(BRIP1):c.1791delT (p.Val598Trpfs)
NM_032043.2(BRIP1):c.1831delG (p.Val611Phefs)
NM_032043.2(BRIP1):c.1853_1854insG (p.Pro619Thrfs) rs587781985
NM_032043.2(BRIP1):c.1871C>A (p.Ser624Ter) rs587781321
NM_032043.2(BRIP1):c.1918_1919delAT (p.Ile640Hisfs) rs1555602127
NM_032043.2(BRIP1):c.193C>T (p.Gln65Ter) rs575595017
NM_032043.2(BRIP1):c.1941G>A (p.Trp647Ter) rs786202760
NM_032043.2(BRIP1):c.1970delG (p.Gly657Valfs) rs760782298
NM_032043.2(BRIP1):c.2010dupT (p.Glu671Terfs) rs775537066
NM_032043.2(BRIP1):c.2038_2039delTT (p.Leu680Valfs) rs587778134
NM_032043.2(BRIP1):c.2038_2039dupTT (p.Leu680Phefs) rs587778134
NM_032043.2(BRIP1):c.2108delAinsTCC (p.Lys703Ilefs) rs786203384
NM_032043.2(BRIP1):c.210delA (p.Lys70Asnfs) rs1555617925
NM_032043.2(BRIP1):c.2111T>A (p.Leu704Ter) rs1057517643
NM_032043.2(BRIP1):c.2114_2118delAAGAA (p.Lys705Thrfs) rs864622611
NM_032043.2(BRIP1):c.2133delT (p.Gly712Valfs)
NM_032043.2(BRIP1):c.2138T>G (p.Leu713Ter) rs878855145
NM_032043.2(BRIP1):c.2205dup (p.Asp736Terfs) rs1555591385
NM_032043.2(BRIP1):c.2221dup (p.Val741Glyfs)
NM_032043.2(BRIP1):c.2223_2225dup (p.Tyr742_Ser1076delinsTer) rs1310861578
NM_032043.2(BRIP1):c.2244C>G (p.Tyr748Ter) rs1257401983
NM_032043.2(BRIP1):c.2255_2256delAA (p.Lys752Argfs) rs730881649
NM_032043.2(BRIP1):c.2273dupT (p.Ala759Serfs) rs587780236
NM_032043.2(BRIP1):c.2377C>T (p.Gln793Ter) rs587782574
NM_032043.2(BRIP1):c.2392C>T (p.Arg798Ter) rs137852986
NM_032043.2(BRIP1):c.2400C>G (p.Tyr800Ter) rs574552037
NM_032043.2(BRIP1):c.2464dup (p.Tyr822Leufs) rs1483527885
NM_032043.2(BRIP1):c.2479C>T (p.Gln827Ter) rs786203898
NM_032043.2(BRIP1):c.2517G>A (p.Trp839Ter) rs1555574803
NM_032043.2(BRIP1):c.2576-1G>A rs587782539
NM_032043.2(BRIP1):c.2589G>A (p.Trp863Ter) rs1555573497
NM_032043.2(BRIP1):c.2605C>T (p.Gln869Ter)
NM_032043.2(BRIP1):c.2640delC (p.Leu881Trpfs)
NM_032043.2(BRIP1):c.2684_2687delCCAT (p.Ser895Terfs) rs760551339
NM_032043.2(BRIP1):c.270C>A (p.Cys90Ter) rs1060501740
NM_032043.2(BRIP1):c.2732dupT (p.Thr912Aspfs) rs752780954
NM_032043.2(BRIP1):c.2765T>G (p.Leu922Ter) rs587782410
NM_032043.2(BRIP1):c.2786_2789delTATC (p.Leu929Hisfs) rs1295703239
NM_032043.2(BRIP1):c.2786_2789dupTATC (p.Pro931Ilefs) rs1295703239
NM_032043.2(BRIP1):c.2792delC (p.Pro931Glnfs) rs1555573327
NM_032043.2(BRIP1):c.290_293delACAA (p.Asn97Metfs) rs763009188
NM_032043.2(BRIP1):c.2947delA (p.Ile983Leufs) rs774684620
NM_032043.2(BRIP1):c.2947dupA (p.Ile983Asnfs) rs774684620
NM_032043.2(BRIP1):c.2990_2993delCAAA (p.Thr997Argfs) rs771028677
NM_032043.2(BRIP1):c.2992_2995delAAGA (p.Lys998Glufs) rs786203717
NM_032043.2(BRIP1):c.30del (p.Ile10Metfs)
NM_032043.2(BRIP1):c.358_361dup (p.Thr121Argfs)
NM_032043.2(BRIP1):c.394dupA (p.Thr132Asnfs) rs587781416
NM_032043.2(BRIP1):c.440dupA (p.Tyr147Terfs) rs786203521
NM_032043.2(BRIP1):c.448G>T (p.Glu150Ter) rs762701532
NM_032043.2(BRIP1):c.462dup (p.Gln155Serfs)
NM_032043.2(BRIP1):c.463C>T (p.Gln155Ter) rs587781786
NM_032043.2(BRIP1):c.46delT (p.Tyr16Thrfs) rs876660613
NM_032043.2(BRIP1):c.477_481delAAGAA (p.Lys159Asnfs) rs1555616143
NM_032043.2(BRIP1):c.484C>T (p.Arg162Ter) rs747604569
NM_032043.2(BRIP1):c.514A>T (p.Lys172Ter)
NM_032043.2(BRIP1):c.548delT (p.Leu183Trpfs) rs1060501778
NM_032043.2(BRIP1):c.55dup (p.Tyr19Leufs)
NM_032043.2(BRIP1):c.632delC (p.Pro211Leufs) rs1060501779
NM_032043.2(BRIP1):c.633delT (p.Gly212Alafs) rs779466229
NM_032043.2(BRIP1):c.68dupC (p.Ser24Valfs) rs1555618716
NM_032043.2(BRIP1):c.840delT (p.His281Ilefs) rs1555609191
NM_032043.2(BRIP1):c.890delA (p.Lys297Serfs) rs786202610
NM_032043.2(BRIP1):c.918delC (p.Asn306Lysfs) rs1555609116
NM_032043.2(BRIP1):c.939T>G (p.Tyr313Ter)
NM_032043.2(BRIP1):c.94-7_178dup rs1555618396
NM_032444.3(SLX4):c.2137C>T (p.Arg713Ter) rs760126773
NM_032444.3(SLX4):c.2449del (p.Glu817Asnfs)
NM_032444.3(SLX4):c.3726_3729delGAGC (p.Ser1243Alafs) rs878855162
NM_032444.3(SLX4):c.4862del (p.Leu1621Cysfs)
NM_032444.3(SLX4):c.59del (p.Leu20Argfs) rs1315905872
NM_032444.3(SLX4):c.860delG (p.Ser287Thrfs) rs752720263
NM_032444.4(SLX4):c.1163+2T>A
NM_032444.4(SLX4):c.514del (p.Leu172Phefs)
NM_033084.4(FANCD2):c.-33-?_1098+?del
NM_033084.4(FANCD2):c.1201del (p.Arg401Glyfs) rs1553608812
NM_033084.4(FANCD2):c.2444G>A (p.Arg815Gln) rs766567785
NM_033084.4(FANCD2):c.2487C>G (p.Tyr829Ter) rs1289665675
NM_058216.1(RAD51C):c.(?_-1)_(*1_?)del
NM_058216.2(RAD51C):c.(?_-1)_837+?del
NM_058216.2(RAD51C):c.145+1G>T rs757128712
NM_058216.2(RAD51C):c.181_182delCT (p.Leu61Alafs) rs786203945
NM_058216.2(RAD51C):c.186_187delAA (p.Gln62Hisfs) rs587782170
NM_058216.2(RAD51C):c.199G>T (p.Glu67Ter)
NM_058216.2(RAD51C):c.250A>T (p.Lys84Ter) rs1555593616
NM_058216.2(RAD51C):c.312T>A (p.Cys104Ter) rs1555593715
NM_058216.2(RAD51C):c.31C>T (p.Gln11Ter)
NM_058216.2(RAD51C):c.363_371delAGAAATTTGinsC (p.Glu122Trpfs)
NM_058216.2(RAD51C):c.394dupA (p.Thr132Asnfs) rs730881940
NM_058216.2(RAD51C):c.397C>T (p.Gln133Ter) rs387907159
NM_058216.2(RAD51C):c.502A>T (p.Arg168Ter) rs587781490
NM_058216.2(RAD51C):c.50delT (p.Phe17Serfs) rs1555591851
NM_058216.2(RAD51C):c.535delC (p.His179Thrfs) rs1555594864
NM_058216.2(RAD51C):c.572-?_*(1_?)del
NM_058216.2(RAD51C):c.572-?_*120del
NM_058216.2(RAD51C):c.572-?_705+?del (p.(?))
NM_058216.2(RAD51C):c.577C>T (p.Arg193Ter) rs200293302
NM_058216.2(RAD51C):c.589G>T (p.Glu197Ter) rs1555597094
NM_058216.2(RAD51C):c.630T>G (p.Tyr210Ter) rs786201909
NM_058216.2(RAD51C):c.701C>G (p.Ser234Ter) rs587782818
NM_058216.2(RAD51C):c.706-2A>G rs587780259
NM_058216.2(RAD51C):c.706-?_*120del
NM_058216.2(RAD51C):c.709C>T (p.Arg237Ter) rs770637624
NM_058216.2(RAD51C):c.732delT (p.Ile244Metfs) rs1060502601
NM_058216.2(RAD51C):c.73delGinsTTC (p.Val25Phefs)
NM_058216.2(RAD51C):c.773G>A (p.Arg258His) rs267606997
NM_058216.2(RAD51C):c.774delT (p.Thr259Leufs) rs754367349
NM_058216.2(RAD51C):c.851_854delATCA (p.Asn284Argfs) rs1060502605
NM_058216.2(RAD51C):c.890_899delTTGTTCCTGC (p.Leu297Hisfs) rs1555602141
NM_058216.2(RAD51C):c.905-2A>C rs779582317
NM_058216.2(RAD51C):c.905-2A>G rs779582317
NM_058216.2(RAD51C):c.905-2_905-1delAG rs587781995
NM_058216.2(RAD51C):c.905-3_906delCAGGG rs730881941
NM_058216.2(RAD51C):c.914G>A (p.Trp305Ter) rs876659874
NM_058216.2(RAD51C):c.93delG (p.Phe32Serfs) rs730881942
NM_058216.2(RAD51C):c.955C>T (p.Arg319Ter) rs587781287
NM_058216.2(RAD51C):c.966-?_1026+?del
NM_058216.2(RAD51C):c.97C>T (p.Gln33Ter) rs587782528
NM_058216.2(RAD51C):c.97_98delCA (p.Gln33Aspfs) rs587780840
NM_058216.3(RAD51C):c.224dup (p.Tyr75Terfs) rs730881939
NM_058216.3(RAD51C):c.525dup (p.Cys176Leufs) rs768793789
PALB2:c.49-?_2586+?del
SLX4, 1-BP DEL, 1093C
SLX4, 1-BP DEL, 286A
SLX4, 4,890-BP DEL/2-BP INS
SLX4, IVS5DS, 1-BP DUP, T, +3

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.