List of variants in gene USH1C reported as pathogenic for Usher syndrome

Minimum submission review status:		Collection method:
Minimum conflict level: Report conflict between different conditions
Gene type: Distinguish antisense genes from sense genes
Show significances as they were submitted (without aggregation into standard terms)
		ClinVar version:

Total variants: 20

Download table as spreadsheet

HGVS	dbSNP	gnomAD frequency
NM_153676.4(USH1C):c.2014-1G>A	rs150567427	0.00183
NM_153676.4(USH1C):c.2167C>T (p.Gln723Ter)	rs146451547	0.00068
NM_153676.4(USH1C):c.308G>A (p.Arg103His)	rs397514500	0.00006
NM_153676.4(USH1C):c.216G>A (p.Val72=)	rs151045328	0.00002
NM_153676.4(USH1C):c.1039C>T (p.Gln347Ter)	rs762551629	0.00001
NM_153676.4(USH1C):c.497-2del	rs1480243085	0.00001
NM_153676.4(USH1C):c.91C>T (p.Arg31Ter)	rs121908370	0.00001
NM_005709.4(USH1C):c.1220del (p.Gly407fs)	rs1207247951
NM_153676.4(USH1C):c.2227-1G>A	rs778110397
NM_153676.4(USH1C):c.2380+1G>C	rs1060499916
NM_153676.4(USH1C):c.238dup (p.Arg80fs)	rs397515359
NM_153676.4(USH1C):c.263del (p.Val88fs)	rs1850961650
NM_153676.4(USH1C):c.36+1G>T	rs1403777293
NM_153676.4(USH1C):c.496+1G>A	rs138138689
NM_153676.4(USH1C):c.496+1G>T	rs138138689
NM_153676.4(USH1C):c.496+21GCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGGGAGCAGG[9]	rs55983148
NM_153676.4(USH1C):c.580-2A>T	rs1850678559
NM_153676.4(USH1C):c.777del (p.Glu260fs)
NM_153676.4(USH1C):c.7C>T (p.Arg3Ter)	rs876657624
NM_153676.4(USH1C):c.841_848del (p.Ser281fs)	rs1064797153

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.