ClinVar Miner

List of variants reported as pathogenic for Usher syndrome by OMIM

Included ClinVar conditions (31):
Minimum submission review status: Collection method:
Minimum conflict level:
ClinVar version:
Total variants: 76
Download table as spreadsheet
HGVS dbSNP
DFNB31, IVS2DS, G-A, +1
MYO7A, IVS27AS, G-C, -1
NG_007083.1:g.371658_507674del
NM_000260.4(MYO7A):c.1797G>A (p.Met599Ile) rs121965082
NM_000260.4(MYO7A):c.1884C>A (p.Cys628Ter) rs121965083
NM_000260.4(MYO7A):c.1996C>T (p.Arg666Ter) rs121965085
NM_000260.4(MYO7A):c.448C>T (p.Arg150Ter) rs121965079
NM_000260.4(MYO7A):c.634C>T (p.Arg212Cys) rs121965080
NM_000260.4(MYO7A):c.635G>A (p.Arg212His) rs28934610
NM_000260.4(MYO7A):c.652_657del (p.Asp218_Ile219del) rs1555062984
NM_000260.4(MYO7A):c.700C>T (p.Gln234Ter) rs41298133
NM_000260.4(MYO7A):c.905G>A (p.Arg302His) rs41298135
NM_000260.4(MYO7A):c.93C>A (p.Cys31Ter) rs35689081
NM_001195794.1(CLRN1):c.118T>G (p.Cys40Gly) rs121908143
NM_001195794.1(CLRN1):c.144T>G (p.Asn48Lys) rs111033258
NM_001195794.1(CLRN1):c.188_210del (p.Tyr63fs) rs1553776036
NM_001195794.1(CLRN1):c.189C>A (p.Tyr63Ter) rs111033267
NM_002109.6(HARS1):c.1361A>C (p.Tyr454Ser) rs387906639
NM_005709.3(USH1C):c.238dupC (p.Arg80Profs) rs397515359
NM_006383.4(CIB2):c.192G>C (p.Glu64Asp) rs145415848
NM_007123.5(USH2A):c.2299del (p.Glu767fs) rs80338903
NM_007123.5(USH2A):c.2898del (p.Thr967fs) rs397518008
NM_007123.5(USH2A):c.3129dup (p.Val1044fs) rs786205115
NM_007123.5(USH2A):c.779T>G (p.Leu260Ter) rs121912598
NM_014960.5(ARSG):c.133G>T (p.Asp45Tyr) rs1568445893
NM_015404.4(WHRN):c.307C>T (p.Gln103Ter) rs137852840
NM_015404.4(WHRN):c.680dup (p.Tyr228fs) rs1306987034
NM_015404.4(WHRN):c.737del (p.Pro246fs) rs1589229634
NM_022124.6(CDH23):c.193del (p.Leu65fs) rs796051861
NM_022124.6(CDH23):c.3839_3841TGA[1] (p.Met1281del) rs796051860
NM_022124.6(CDH23):c.3880C>T (p.Gln1294Ter) rs121908350
NM_022124.6(CDH23):c.4488G>C (p.Gln1496His) rs121908347
NM_022124.6(CDH23):c.5237G>A (p.Arg1746Gln) rs111033270
NM_022124.6(CDH23):c.7362+5G>A rs727502931
NM_032119.4(ADGRV1):c.18131A>G (p.Tyr6044Cys) rs121909763
NM_032119.4(ADGRV1):c.18732_18750del (p.Gly6243_Tyr6244insTer) rs796051865
NM_032119.4(ADGRV1):c.2258_2270del (p.Gln753fs) rs796051866
NM_032119.4(ADGRV1):c.5357_5358del (p.Lys1786fs) rs796051867
NM_032119.4(ADGRV1):c.6901C>T (p.Gln2301Ter) rs121909762
NM_032119.4(ADGRV1):c.8713_8716dup (p.Ile2906fs) rs796051863
NM_032119.4(ADGRV1):c.8790del (p.Met2931fs) rs796051864
NM_033056.4(PCDH15):c.1088del (p.Leu363fs) rs199469706
NM_033056.4(PCDH15):c.1940C>G (p.Ser647Ter) rs137853004
NM_033056.4(PCDH15):c.733C>T (p.Arg245Ter) rs111033260
NM_033056.4(PCDH15):c.7C>T (p.Arg3Ter) rs137853001
NM_052995.2(CLRN1):c.131T>A (p.Met44Lys) rs121908141
NM_052995.2(CLRN1):c.221T>C (p.Leu74Pro) rs121908142
NM_052995.2(CLRN1):c.231_233del (p.Ile77_Leu78delinsMet) rs1085307049
NM_052995.2(CLRN1):c.300T>G (p.Tyr100Ter) rs121908140
NM_153676.4(USH1C):c.216G>A (p.Val72=) rs151045328
NM_153676.4(USH1C):c.2227-1G>A rs778110397
NM_153676.4(USH1C):c.308G>A (p.Arg103His) rs397514500
NM_153676.4(USH1C):c.36+1G>T rs1403777293
NM_153676.4(USH1C):c.496+21GCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGGGAGCAGG[9] rs55983148
NM_153676.4(USH1C):c.497-2del rs1480243085
NM_153676.4(USH1C):c.91C>T (p.Arg31Ter) rs121908370
NM_173477.5(USH1G):c.113G>A (p.Trp38Ter) rs104894652
NM_173477.5(USH1G):c.143T>C (p.Leu48Pro) rs104894651
NM_173477.5(USH1G):c.186_187del (p.Ile63fs) rs730880268
NM_173477.5(USH1G):c.394dup (p.Val132fs) rs587776546
NM_173477.5(USH1G):c.832_851del (p.Ser278fs) rs397515345
NM_206933.3(USH2A):c.240_241insGATC (p.Gln81fs) rs587776538
NM_206933.3(USH2A):c.4334_4335CT[2] (p.Cys1447fs) rs111033367
NM_206933.3(USH2A):c.7595-2144A>G rs786200928
NM_206933.3(USH2A):c.8890dup (p.Trp2964fs) rs786205116
NM_206933.4(USH2A):c.11864G>A (p.Trp3955Ter) rs111033364
NM_206933.4(USH2A):c.1256G>T (p.Cys419Phe) rs121912600
NM_206933.4(USH2A):c.2209C>T (p.Arg737Ter) rs111033334
NM_206933.4(USH2A):c.949C>A (p.Arg317=) rs111033272
NM_206933.4(USH2A):c.956G>A (p.Cys319Tyr) rs121912599
PCDH15, 3-BP DEL, 5601AAC
PCDH15, IVS27, A-G, -2
USH1C, 1-BP DEL, 1220G
USH1C, IVS5DS, G-A, +1
USH1G, 15-BP DEL, NT163
m.12258C>A rs118203888

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.