ClinVar Miner

List of variants in gene ZNF469 reported as benign for Ehlers-Danlos syndrome

Included ClinVar conditions (36):
Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 27
Download table as spreadsheet
HGVS dbSNP
NM_001127464.2(ZNF469):c.*870delT rs35684712
NM_001367624.1(ZNF469):c.*1001A>G rs3848234
NM_001367624.1(ZNF469):c.*551_*577TCCTCCCTCTGACCACAGGGTCATGCC[3] rs6145934
NM_001367624.1(ZNF469):c.*618T>G rs3859020
NM_001367624.1(ZNF469):c.*788G>A rs3894713
NM_001367624.1(ZNF469):c.*8G>A rs45504291
NM_001367624.1(ZNF469):c.1069T>C (p.Ser357Pro) rs11648572
NM_001367624.1(ZNF469):c.10972G>C (p.Glu3658Gln) rs1105066
NM_001367624.1(ZNF469):c.1098A>C (p.Arg366Ser) rs11640794
NM_001367624.1(ZNF469):c.10990= (p.Ala3664=) rs904783
NM_001367624.1(ZNF469):c.11757A>G (p.Pro3919=) rs4782301
NM_001367624.1(ZNF469):c.11856C>T (p.Ser3952=) rs4782362
NM_001367624.1(ZNF469):c.1529G>C (p.Gly510Ala) rs7199961
NM_001367624.1(ZNF469):c.1776A>G (p.Pro592=) rs12927001
NM_001367624.1(ZNF469):c.2130T>C (p.Pro710=) rs12918876
NM_001367624.1(ZNF469):c.3153T>C (p.Ile1051=) rs9924504
NM_001367624.1(ZNF469):c.3522G>A (p.Pro1174=) rs9938800
NM_001367624.1(ZNF469):c.3568A>G (p.Lys1190Glu) rs7197071
NM_001367624.1(ZNF469):c.4343C>T (p.Pro1448Leu) rs4782300
NM_001367624.1(ZNF469):c.4419T>G (p.Ser1473=) rs12445417
NM_001367624.1(ZNF469):c.457C>G (p.Pro153Ala) rs532620482
NM_001367624.1(ZNF469):c.5661C>G (p.Thr1887=) rs9931465
NM_001367624.1(ZNF469):c.6462G>A (p.Pro2154=) rs61472141
NM_001367624.1(ZNF469):c.7156G>C (p.Gly2386Arg) rs12598474
NM_001367624.1(ZNF469):c.8093T>A (p.Leu2698Gln) rs3812956
NM_001367624.1(ZNF469):c.8604C>T (p.Arg2868=) rs3812953
NM_001367624.1(ZNF469):c.8627A>G (p.His2876Arg) rs1983014

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.