ClinVar Miner

List of variants in gene MED12 studied for FG syndrome

Included ClinVar conditions (8):
Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 144
Download table as spreadsheet
NM_005120.2(MED12):c.204+12_204+13delCT rs200301833
NM_005120.3(MED12):c.1030A>C (p.Thr344Pro) rs1556334571
NM_005120.3(MED12):c.1039A>G (p.Ser347Gly) rs752300879
NM_005120.3(MED12):c.1140C>T (p.His380=) rs753714929
NM_005120.3(MED12):c.1167G>A (p.Lys389=) rs374324656
NM_005120.3(MED12):c.1208A>G (p.Asn403Ser)
NM_005120.3(MED12):c.1264C>T (p.Arg422Trp) rs368913305
NM_005120.3(MED12):c.1269G>A (p.Glu423=) rs758467351
NM_005120.3(MED12):c.1332C>T (p.Cys444=) rs746205041
NM_005120.3(MED12):c.1386G>T (p.Val462=) rs186153976
NM_005120.3(MED12):c.1485+6C>T rs565198403
NM_005120.3(MED12):c.1546C>T (p.Arg516Cys) rs1569481124
NM_005120.3(MED12):c.1619G>A (p.Arg540His)
NM_005120.3(MED12):c.1671C>T (p.Ser557=) rs1556335123
NM_005120.3(MED12):c.1682C>T (p.Pro561Leu) rs766485358
NM_005120.3(MED12):c.1695T>A (p.Ile565=) rs138984044
NM_005120.3(MED12):c.1744+4C>T rs780750721
NM_005120.3(MED12):c.1744+5G>A rs368353373
NM_005120.3(MED12):c.1849A>G (p.Thr617Ala) rs765417606
NM_005120.3(MED12):c.1862G>A (p.Arg621Gln) rs1057519381
NM_005120.3(MED12):c.1924G>A (p.Asp642Asn) rs1556335288
NM_005120.3(MED12):c.1956C>T (p.Ser652=) rs199873151
NM_005120.3(MED12):c.1963A>G (p.Ser655Gly) rs1569481250
NM_005120.3(MED12):c.2023C>T (p.Leu675Phe) rs1307587368
NM_005120.3(MED12):c.2068A>G (p.Thr690Ala) rs878854752
NM_005120.3(MED12):c.2136C>T (p.Pro712=) rs377207665
NM_005120.3(MED12):c.2169G>A (p.Gly723=) rs1060504497
NM_005120.3(MED12):c.2220C>T (p.Ile740=) rs370195616
NM_005120.3(MED12):c.2259G>A (p.Arg753=) rs61752446
NM_005120.3(MED12):c.2383C>T (p.Pro795Ser)
NM_005120.3(MED12):c.2422+6T>G rs1569481413
NM_005120.3(MED12):c.2444G>A (p.Arg815Gln) rs762905361
NM_005120.3(MED12):c.2450G>A (p.Arg817His)
NM_005120.3(MED12):c.2545T>C (p.Ser849Pro) rs1135401775
NM_005120.3(MED12):c.2571G>C (p.Thr857=) rs368090262
NM_005120.3(MED12):c.281C>T (p.Pro94Leu)
NM_005120.3(MED12):c.2873G>A (p.Gly958Glu) rs397515554
NM_005120.3(MED12):c.2881C>T (p.Arg961Trp) rs80338758
NM_005120.3(MED12):c.2886C>T (p.Ser962=) rs34761462
NM_005120.3(MED12):c.2895C>T (p.Ser965=) rs1060504496
NM_005120.3(MED12):c.3063C>T (p.Phe1021=) rs797045698
NM_005120.3(MED12):c.3067A>G (p.Ile1023Val) rs879255526
NM_005120.3(MED12):c.3110C>T (p.Thr1037Met)
NM_005120.3(MED12):c.3125G>A (p.Ser1042Asn) rs1556336419
NM_005120.3(MED12):c.3204C>T (p.Pro1068=) rs201807437
NM_005120.3(MED12):c.3498G>A (p.Glu1166=) rs1556336751
NM_005120.3(MED12):c.3582G>A (p.Lys1194=) rs1060504499
NM_005120.3(MED12):c.3587C>A (p.Thr1196Lys) rs1556336812
NM_005120.3(MED12):c.3691+4C>T rs373381746
NM_005120.3(MED12):c.3693G>T (p.Gly1231=)
NM_005120.3(MED12):c.3699G>A (p.Ala1233=) rs184162709
NM_005120.3(MED12):c.3721A>G (p.Thr1241Ala)
NM_005120.3(MED12):c.3745C>T (p.Leu1249Phe) rs1422779785
NM_005120.3(MED12):c.3762_3764AGG[1] (p.Gly1257del)
NM_005120.3(MED12):c.3769G>A (p.Gly1257Ser)
NM_005120.3(MED12):c.3796C>T (p.Arg1266Cys) rs1060502168
NM_005120.3(MED12):c.3797G>A (p.Arg1266His) rs587780391
NM_005120.3(MED12):c.380C>T (p.Thr127Met) rs775072642
NM_005120.3(MED12):c.381G>A (p.Thr127=) rs202125318
NM_005120.3(MED12):c.3849G>T (p.Leu1283=) rs377409217
NM_005120.3(MED12):c.3942T>C (p.Ser1314=) rs3810670
NM_005120.3(MED12):c.4021C>T (p.Arg1341Trp) rs777250096
NM_005120.3(MED12):c.4028G>A (p.Arg1343His) rs201044355
NM_005120.3(MED12):c.4111C>T (p.Pro1371Ser) rs587778437
NM_005120.3(MED12):c.4147G>A (p.Ala1383Thr) rs863223696
NM_005120.3(MED12):c.4154C>T (p.Ala1385Val) rs771349148
NM_005120.3(MED12):c.4179A>C (p.Ser1393=) rs376058351
NM_005120.3(MED12):c.4231A>G (p.Ser1411Gly)
NM_005120.3(MED12):c.4238C>A (p.Thr1413Asn) rs759532414
NM_005120.3(MED12):c.4253+4G>A rs750162341
NM_005120.3(MED12):c.438A>G (p.Leu146=) rs35068602
NM_005120.3(MED12):c.4425A>G (p.Leu1475=) rs370211858
NM_005120.3(MED12):c.4651A>G (p.Thr1551Ala)
NM_005120.3(MED12):c.4665G>A (p.Thr1555=) rs375001801
NM_005120.3(MED12):c.4806G>T (p.Ser1602=) rs755218771
NM_005120.3(MED12):c.492T>C (p.Cys164=) rs886039163
NM_005120.3(MED12):c.5017_5019AAG[1] (p.Lys1674del)
NM_005120.3(MED12):c.503C>T (p.Ala168Val)
NM_005120.3(MED12):c.5192G>A (p.Arg1731Lys) rs1569482278
NM_005120.3(MED12):c.5253G>A (p.Pro1751=) rs770067057
NM_005120.3(MED12):c.5336C>T (p.Thr1779Ile) rs1556338856
NM_005120.3(MED12):c.5345G>A (p.Arg1782His) rs1060502167
NM_005120.3(MED12):c.5360C>G (p.Thr1787Ser)
NM_005120.3(MED12):c.5400+6C>T rs192656109
NM_005120.3(MED12):c.5423G>A (p.Arg1808Gln)
NM_005120.3(MED12):c.5427C>T (p.Ser1809=) rs772462354
NM_005120.3(MED12):c.5490A>C (p.Thr1830=) rs762466624
NM_005120.3(MED12):c.5535C>T (p.Asn1845=) rs34784349
NM_005120.3(MED12):c.5585G>A (p.Arg1862His) rs773713291
NM_005120.3(MED12):c.5602C>G (p.Leu1868Val)
NM_005120.3(MED12):c.5616A>G (p.Pro1872=) rs750250372
NM_005120.3(MED12):c.5650G>A (p.Gly1884Ser) rs147354926
NM_005120.3(MED12):c.5653G>A (p.Val1885Ile)
NM_005120.3(MED12):c.5655C>T (p.Val1885=) rs1556339100
NM_005120.3(MED12):c.5659G>A (p.Gly1887Ser) rs758621985
NM_005120.3(MED12):c.568A>G (p.Ile190Val) rs374780236
NM_005120.3(MED12):c.5711C>T (p.Ala1904Val) rs200663107
NM_005120.3(MED12):c.5898dup (p.Ser1967fs) rs879255527
NM_005120.3(MED12):c.5922G>T (p.Gln1974His) rs879255528
NM_005120.3(MED12):c.5989G>T (p.Gly1997Cys) rs1556339260
NM_005120.3(MED12):c.6017A>C (p.Tyr2006Ser) rs769232520
NM_005120.3(MED12):c.6097A>G (p.Met2033Val) rs372606012
NM_005120.3(MED12):c.6103G>A (p.Ala2035Thr)
NM_005120.3(MED12):c.6150_6152GCA[7] (p.Gln2076dup)
NM_005120.3(MED12):c.616C>G (p.Arg206Gly) rs1556334331
NM_005120.3(MED12):c.6177_6200ACAGCAACAGCAGCAGCAGCAGCA[1] (p.Gln2069_Gln2076del) rs773709991
NM_005120.3(MED12):c.6186_6188GCA[3] (p.Gln2075_Gln2076del) rs754533796
NM_005120.3(MED12):c.6201A>G (p.Gln2067=) rs375793297
NM_005120.3(MED12):c.6208_6210CAG[6] (p.Gln2076del) rs757160341
NM_005120.3(MED12):c.6208_6210CAG[8] (p.Gln2076dup) rs757160341
NM_005120.3(MED12):c.6239G>A (p.Arg2080Gln)
NM_005120.3(MED12):c.6241_6243CAG[5] (p.Gln2086del) rs786200971
NM_005120.3(MED12):c.6241_6243CAG[7] (p.Gln2086dup) rs786200971
NM_005120.3(MED12):c.6273G>A (p.Gln2091=) rs1556340048
NM_005120.3(MED12):c.6273_6278dup (p.Gln2115_His2116insGlnGln)
NM_005120.3(MED12):c.6279_6284ACAGCA[3] (p.Gln2114_Gln2115dup) rs761195801
NM_005120.3(MED12):c.6288_6290GCA[5] (p.Gln2114_Gln2115del) rs766775649
NM_005120.3(MED12):c.6288_6290GCA[6] (p.Gln2115del) rs766775649
NM_005120.3(MED12):c.6288_6290GCA[8] (p.Gln2115dup) rs766775649
NM_005120.3(MED12):c.6288_6290GCA[9] (p.Gln2114_Gln2115dup) rs766775649
NM_005120.3(MED12):c.628G>C (p.Ala210Pro) rs1379201163
NM_005120.3(MED12):c.6291G>A (p.Gln2097=) rs756285149
NM_005120.3(MED12):c.6294G>A (p.Gln2098=) rs1408739478
NM_005120.3(MED12):c.6297G>A (p.Gln2099=) rs1480313864
NM_005120.3(MED12):c.6300G>A (p.Gln2100=) rs1556340080
NM_005120.3(MED12):c.6303G>A (p.Gln2101=) rs1490399010
NM_005120.3(MED12):c.6309_6314ACAGCA[1] (p.Gln2114_Gln2115del) rs764789036
NM_005120.3(MED12):c.6309_6314ACAGCA[3] (p.Gln2114_Gln2115dup) rs764789036
NM_005120.3(MED12):c.6321G>A (p.Gln2107=) rs778103349
NM_005120.3(MED12):c.6321_6335del (p.Gln2111_Gln2115del) rs727503869
NM_005120.3(MED12):c.6324G>A (p.Gln2108=) rs749807888
NM_005120.3(MED12):c.6327G>A (p.Gln2109=) rs1333460909
NM_005120.3(MED12):c.6333G>A (p.Gln2111=) rs1556340108
NM_005120.3(MED12):c.6348_6359dup (p.His2116_Gln2119dup) rs398124200
NM_005120.3(MED12):c.6351G>A (p.Gln2117=) rs1175039083
NM_005120.3(MED12):c.6526C>T (p.Arg2176Cys) rs777818556
NM_005120.3(MED12):c.653C>T (p.Thr218Met) rs369083173
NM_005120.3(MED12):c.708C>T (p.Thr236=) rs34668206
NM_005120.3(MED12):c.727A>C (p.Met243Leu)
NM_005120.3(MED12):c.817C>T (p.Leu273Phe)

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.