ClinVar Miner

List of variants in gene BLM reported as pathogenic for DNA repair disease

Included ClinVar conditions (95):
Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 74
Download table as spreadsheet
HGVS dbSNP
NC_000015.10:g.(?_90754805)_(90754944_?)del
NC_000015.10:g.(?_90790643)_(90790850_?)del
NC_000015.10:g.(?_90811195)_(90811416_?)del
NM_000057.2(BLM):c.2206dupT (p.Tyr736Leufs) rs886051551
NM_000057.2(BLM):c.2308-953_2555+4719del
NM_000057.2(BLM):c.2407dupT (p.Trp803Leufs) rs367543012
NM_000057.2(BLM):c.3475_3476delTT (p.Leu1159Ilefs) rs367543033
NM_000057.2(BLM):c.98+1G>T rs750293380
NM_000057.3(BLM):c.1043dup (p.Met348Ilefs)
NM_000057.3(BLM):c.1088-2A>G rs367543015
NM_000057.3(BLM):c.1129delG (p.Glu377Serfs) rs1555419710
NM_000057.3(BLM):c.1295dup (p.Asp433Terfs) rs1555419806
NM_000057.3(BLM):c.1301C>G (p.Ser434Ter) rs754203833
NM_000057.3(BLM):c.1358T>G (p.Leu453Ter) rs730881428
NM_000057.3(BLM):c.1462G>T (p.Glu488Ter)
NM_000057.3(BLM):c.1479_1480delTA (p.Thr494Profs) rs746244182
NM_000057.3(BLM):c.1544delA (p.Asn515Metfs) rs367543043
NM_000057.3(BLM):c.1544dupA (p.Asn515Lysfs) rs367543043
NM_000057.3(BLM):c.1628T>A (p.Leu543Ter) rs367543038
NM_000057.3(BLM):c.1642C>T (p.Gln548Ter) rs200389141
NM_000057.3(BLM):c.1933C>T (p.Gln645Ter) rs373525781
NM_000057.3(BLM):c.1985_1986del (p.Lys662Ilefs) rs762804291
NM_000057.3(BLM):c.2074+1G>T rs367543036
NM_000057.3(BLM):c.2098C>T (p.Gln700Ter) rs367543028
NM_000057.3(BLM):c.213_214delTT (p.Ser72Leufs) rs960430492
NM_000057.3(BLM):c.2193+2T>G rs367543040
NM_000057.3(BLM):c.2207_2212delATCTGAinsTAGATTC (p.Tyr736Leufs) rs113993962
NM_000057.3(BLM):c.2250_2251insAAAT (p.Leu751Lysfs) rs786204471
NM_000057.3(BLM):c.2258T>A (p.Leu753Ter)
NM_000057.3(BLM):c.2343_2344dupGA (p.Asn782Argfs) rs1555420842
NM_000057.3(BLM):c.2353_2354insTT (p.Glu785Valfs)
NM_000057.3(BLM):c.2406+2T>G rs367543016
NM_000057.3(BLM):c.2488dupA (p.Thr830Asnfs) rs367543019
NM_000057.3(BLM):c.2506_2507delAG (p.Arg836Glyfs) rs367543024
NM_000057.3(BLM):c.2506delA (p.Arg836Glyfs)
NM_000057.3(BLM):c.2539delA (p.Ile847Phefs) rs770751979
NM_000057.3(BLM):c.2580_2581delTA (p.His860Glnfs) rs864622347
NM_000057.3(BLM):c.2643G>A (p.Trp881Ter) rs367543039
NM_000057.3(BLM):c.2695C>T (p.Arg899Ter) rs587779884
NM_000057.3(BLM):c.275delA (p.Asn92Metfs) rs367543027
NM_000057.3(BLM):c.2851_2857delATGGGGA (p.Met951Leufs)
NM_000057.3(BLM):c.2855G>T (p.Gly952Val) rs367543034
NM_000057.3(BLM):c.2875C>T (p.Arg959Ter) rs762354041
NM_000057.3(BLM):c.2887C>T (p.His963Tyr) rs367543023
NM_000057.3(BLM):c.2923delC (p.Gln975Lysfs) rs367543014
NM_000057.3(BLM):c.298_299delCA (p.Gln100Glufs) rs745807085
NM_000057.3(BLM):c.3028delG (p.Asp1010Metfs) rs780379121
NM_000057.3(BLM):c.3107G>T (p.Cys1036Phe) rs137853153
NM_000057.3(BLM):c.311C>A (p.Ser104Ter) rs367543030
NM_000057.3(BLM):c.3164G>C (p.Cys1055Ser) rs367543029
NM_000057.3(BLM):c.3191A>T (p.Asp1064Val) rs367543032
NM_000057.3(BLM):c.3197G>A (p.Cys1066Tyr) rs367543025
NM_000057.3(BLM):c.320dupT (p.Leu107Phefs) rs781221411
NM_000057.3(BLM):c.3223dupA (p.Arg1075Lysfs) rs367543022
NM_000057.3(BLM):c.3255_3256insT (p.Arg1086Terfs) rs367543037
NM_000057.3(BLM):c.3261delT (p.Phe1087Leufs) rs1319786857
NM_000057.3(BLM):c.3278C>G (p.Ser1093Ter) rs367543017
NM_000057.3(BLM):c.3415C>T (p.Arg1139Ter) rs587783037
NM_000057.3(BLM):c.3558+1G>A rs148969222
NM_000057.3(BLM):c.3558+1G>T rs148969222
NM_000057.3(BLM):c.3569delTinsAA (p.Met1190Lysfs)
NM_000057.3(BLM):c.3587delG (p.Ser1196Thrfs) rs367543018
NM_000057.3(BLM):c.3681delA (p.Lys1227Asnfs) rs367543020
NM_000057.3(BLM):c.3727dupA (p.Thr1243Asnfs) rs367543021
NM_000057.3(BLM):c.3751-?_*(177_?)del
NM_000057.3(BLM):c.3847C>T (p.Gln1283Ter) rs367543031
NM_000057.3(BLM):c.3960dup (p.Val1321Argfs)
NM_000057.3(BLM):c.557_559delCAA (p.Ser186_Pro521delinsTer) rs367543035
NM_000057.3(BLM):c.582delT (p.Phe194Leufs) rs367543026
NM_000057.3(BLM):c.772_773delCT (p.Leu258Glufs) rs367543013
NM_000057.3(BLM):c.835G>T (p.Glu279Ter)
NM_000057.3(BLM):c.839_888delTACATTCAACTGAGAAAGTTCCATGTATTGAATTTGATGATGATGATTAT (p.Leu280Terfs)
NM_000057.3(BLM):c.991_995delAAAGA (p.Lys331Glyfs) rs786204524
NM_000057.4(BLM):c.1284G>A (p.Trp428Ter) rs1057516964

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.