ClinVar Miner

List of variants in gene FANCF reported as pathogenic for anemia (disease)

Included ClinVar conditions (258):
Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 5
Download table as spreadsheet
NM_022725.3(FANCF):c.16C>T (p.Gln6Ter) rs104894221
NM_022725.3(FANCF):c.230_252delTTCCGGGATTAGCGAACTTCCAG (p.Val77Glyfs) rs730880277
NM_022725.3(FANCF):c.327C>G (p.Tyr109Ter) rs104894222
NM_022725.3(FANCF):c.349_395del (p.Gly120Profs) rs730880278
NM_022725.3(FANCF):c.484_485delCT (p.Leu162Aspfs) rs587778340

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.